Effect of 2-Phenylethanol as Antifungal Agent and Common Antifungals (Amphotericin B,Fluconazole,and Itraconazole) on Candida Species Isolated from Chronic and Recurrent Cases of Candidal Vulvovaginitis

Sample size calculation

A sampling method based on easy accessibility was used for 6 months (from February 20 until August 20, 2016). Given the prevalence of RVVC in Iran, with the formula \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$n = {z^2}p \left( {1 - p} \right) \div {d^2}$$ \end{document} (for costing estimation) (n = sample size, z [confidence interval] = 1.96, p [prevalence] = 0.15, d [definitude] = 0.05), 200 patients were identified. ^17,18 Of these, patients with RVVC and CVVC, patients with positive and strong growth on a CHROMagar Candida medium (after 72 h), were selected for the study.

Specimen collection

With patient consent, in accordance with the Declaration of Helsinki, and under gynecologist supervision, vaginal discharge samples were taken with sterile cotton swabs from women with symptoms who had been referred to the gynecology clinic at Lolagar Hospital. The swabs were placed into sterile Falcon tubes containing preservative (2 mL phosphate-buffered saline) (09-8912-100; Medicago, Canada), and an information form for each patient was completed and attached to the corresponding vaginal sample. The samples then were transferred to the mycology laboratory of the Iran University of Medical Sciences.

Direct microscopy

One/two drops of the vaginal sample from the Falcon tube, along with one drop of KOH 10%–20%, were applied to a slide and checked using an optical microscope. Oval-shaped or round yeast cells with false or true hyphae represent Candida species.

Culture

Samples were cultured on CHROMagar medium (CA220; CHROMagar™ Candida, France) and incubated for 2 days at 37°C. After the incubation period, the colors of the CHROMagar plates were recorded and samples carried out on the Sabouraud's dextrose agar slants (1054380500; Merck, Germany) (for purification and maintenance).

Polymerase chain reaction

The presence of the Candida species was diagnosed definitively with the PCR tests by using universal primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (TAG Copenhagen, Denmark) (to amplify the ITS1-5.8S-ITS2 area) and sequencing. Sequencing was done by Bioneer Company for all of the specimens (Republic of Korea). Briefly, isolated Candida species were cultured on a solid yeast extract peptone glucose agar (YEPD) medium (yeast extract, Y1625 [Sigma]; glucose, G8270 [Sigma]; peptone, 146447 [Merck]; agar, 101614 [Merck]; chloramphenicol, C0378 [Sigma, Germany]) and were incubated at 37°C for 24–48 h. According to the rapid DNA extraction protocol, DNA (template DNA) was extracted from a Candida colony. ¹⁹ The primers were purchased and, according to the manufacturer's instructions, mixed with sterilized distilled water and then utilized as follows (for each sample): 12/5λ Master Mix (180301; Ampliqon, Denmark) +1λ ITS1 + 1λ ITS4 + 9/5λ distilled water +1λ template DNA. In a negative control tube, instead of the template DNA, 1λ sterilized distilled water was added. PCR thermal cycles were performed using a thermo cycler (732-2773; Peqlab, Germany). Denaturation was performed for 35 cycles at 98°C (5 min and 30 s), annealing was performed for 1 cycle at 65°C (30 s), and extension was performed for 1 cycle at 72°C (30 s) and another cycle at 72°C (5 min); then, the PCR products were electrophoresed on agarose gel (A9539; Sigma, Germany), and images were recorded from the electrophoresis gels with PCR products.

Stock preparation (common antifungals)

The primary stocks of AMB, FLU, and ITC with a concentration of 128 μg/mL were prepared according to the CLSI M27-A3 protocol ²⁰ for common drug powders, then weighed using an analytical susceptible balance (HR-200; Mettler Toledo Company, Columbus, OH) and solved using the appropriate amount of DMSO (102952; Merck, Germany). These stocks were filtered using a sterile syringe filter with a pore size of 0.22 μm (SFCA013022N; Membrane Solutions, China). Then, at the first weekday of each week of the study period, lower concentrations (from 128 to 0.03125 μg/mL) were prepared using serial dilution according to the CLSI M27-S3 protocol.

PEA stock preparation

To prepare a stock of liquid PEA (P13622; Aldrich) with a concentration of 6,400 μg/mL, according to the PEA minimum inhibitory concentration (MIC) for C. albicans in previous research, ^21,22 calculations were performed according to a pharmacy technician's guidebook. ²³ The calculated amount of 2-phenylethanol's primary stock was dissolved in DMSO and then filtered with a millipore filter (0.22 μm pore size). Thus, concentrations of 6,400 to 100 μg/mL were prepared in DMSO using serial dilutions.

Yeast suspension preparation

A yeast suspension was prepared in 0.85% sterile normal saline from a young Candida colony (24–48-h incubation at 35°C) using a spectrophotometer (Novaspec II Visible Spectrophotometer; Pharmacia LKB Biotechnology, Cambridge, England) with a wavelength of 530 nm; by changing the cell density, 85%–90% transmittance was achieved. Then, this 1 × 10⁶ cells/mL suspension was diluted in RPMI 1640 (R6504; Sigma, Germany) (with glutamine, without bicarbonate, and with phenol red as a pH indicator) in a 1:50 dilution followed by a 1:20 dilution; the final solution had 1 × 10³–5 × 10³ cells/mL.

MIC calculation for PEA and common drugs

Ninety-six sterile, well-capped microplates (351177; Becton Dickinson) were used for the MIC calculation. One hundred microliters of each common drug (of each concentration) was poured vertically on the plate. Then, 100 μL of yeast suspension was applied to all wells. The final drug concentrations were 128–0.03125 μg/mL for common drugs and 6,400–100 μg/mL for PEA. One hundred microliters of RPMI 1640 medium and 100 μL of yeast suspension were added to the positive control column, 200 μL of RPMI 1640 medium was discarded in the negative control column, and one well was considered a DMSO solvent control, containing 100 μL of RPMI 1640 medium plus DMSO and 100 μL of yeast suspension. The microplates were placed on the shaker (Sepand round shaker; Sepand, Iran) for 3–5 min before being placed in a 35°C incubator (IN30plus; Memmert, Germany); after 48 h, the microplates were read optically using a mirror. For each sample, the concentration in which no growth was observed was considered to be the MIC alone.

Minimum fungicidal concentration calculation

The contents of the MIC well and previous wells were cultured in Sabouraud's glucose agar with a sterile loop and checked after 48 h. The first concentration that had no growth was considered to be the minimum fungicidal concentration (MFC). Antifungal susceptibility was interpreted based on the MICs obtained from the isolates and according to the CLSI M27-S3 protocol.

MIC calculation for PEA in combination with common antifungals

For the MIC calculation, 96-well microplates were used, on which 50 μL of each common drug was poured vertically from columns 1 to 11. Then, 50 μL of PEA was poured horizontally from rows A to G. Fifty microliters of RPMI 1640 medium was added to row H and column 11, so row H contained common drugs alone, while column 11 contained PEA alone. The final concentrations of columns 1–11 of each common drug were 16–0.03125 μg/mL, except for FLU, the concentrations of which were 64–0.03125 μg/mL or 256–0.03125 μg/mL. The final concentrations of rows A to G were 6,400–100 μg/mL. Then, 100 μL of yeast suspension was added to each well. Two wells with 100 μL of RPMI 1640 medium and 100 μL of yeast suspension were considered positive controls, two wells with 200 μL of RPMI 1640 medium were considered negative controls, and one well containing 100 μL of RPMI 1640 medium plus DMSO and 100 μL of yeast suspension was considered a DMSO solvent control. In this way, the highest drug concentration was in the 1st vertical and horizontal well, and the lowest drug concentration was in the 10th vertical and 7th horizontal well. Then, the microplates were placed on a shaker for 3–5 min before being placed in a 35°C incubator; after 48–72 h, the microplates were read optically using a mirror. In column 11 and row H, in which drugs alone were poured, the first well in which no growth was seen was considered to be the MIC alone. In addition, according to the growth pattern in the antifungal combination protocol ²⁴ (Fig. 1), MICs in combination, as well as any synergism, antagonism, or additive (no interaction) effects, were determined using the FICI (fractional inhibitory concentration index) formula. \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document} \begin{align*} FICI = FI { C_X } + FI { C_Y } = { \frac { MIC \ X \ in \ combination } { MIC \ X \ alone } } + { \frac { MIC \ Y \ in \ combination } { MIC \ Y \ alone } } \end{align*} \end{document}

X = drug A

Y = drug B

OPEN IN VIEWER

Fig. 1.

Checkerboard technique (Vitale, Afeltra, and Dannaoui). Interpretation of results based on fungal growth patterns in microplates (black wells): wells marked with A or B are the MICs of drug A or B alone, and wells marked with A + B are the MICs of the combination of two drugs. MIC, minimum inhibitory concentration.

The interpretation of the FICI results was as follows: ≤0.5, synergistic effect; >0.5 but <4, no interaction; and ≥4, antagonistic effect.