Characterization of the Mitochondrial Genome of the Diamondback Moth Plutella xylostella (Lepidoptera: Plutellidae) and Phylogenetic Analysis of Advanced Moths and Butterflies

Abstract

Here we determined the mitochondrial genome sequence of a notorious pest, the diamondback moth Plutella xylostella (Lepidoptera: Yponomeutoidea: Plutellidae). The mitochondrial genome contains 37 typical animal mitochondrial genes and an A+T-rich region. The gene arrangement is identical to that of other ditrysian lepidopteran mitochondrial genomes, but different from the ancestral gene arrangement in the non-ditrysian Hepialidae of Lepidoptera. The start codon of the cox1 gene is CGA, which is dissimilar to its homologs in most other insects. In Lepidoptera, cox1 and cox2 have low nucleotide diversities, while the nad6, nad2, and nad3 genes are highly variable. Phylogenetic analyses uncovered the reciprocal monophyly of Ditrysia, Apoditrysia, Obtectomera, and Macrolepidoptera, and the placement of the Hesperiidae within Papilionoidea. Our analyses suggest that the complete mitochondrial genome sequences are a promising marker toward fully resolving the phylogenetic relationships within Lepidoptera.

Introduction

I n recent years, the rapid increase in complete mitochondrial genome sequences available via public databases has provided an opportunity to use whole genomes in evolutionary studies (Boore et al., 1998; Dowton et al., 2009a, 2009b; Wei et al., 2010a, 2010b). Notably, high level phylogenetic relationships among or within some insect orders, such as the holometabolous insects (Wei et al., 2010b), Neuropterida (Cameron et al., 2009), Orthoptera (Zhou et al., 2010), Hemiptera (Hua et al., 2008; Hua et al., 2009), Coleoptera (Kim et al., 2009a), Diptera (Cameron et al., 2007), and Hymenoptera (Castro and Dowton, 2007; Cameron et al., 2008; Dowton et al., 2009a; Gotzek et al., 2010; Wei et al., 2010b), have been robustly reconstructed by employing the complete mitochondrial genome.

Lepidoptera is one of the most species-rich and widely distributed insect orders, the members of which function as herbivores, pollinators, and prey. This order also constitutes one of the most damaging groups of pests to agriculture overall. Current classifications divide the order Lepidoptera into four suborders (Kristensen, 1984), with Glossata, the most advanced suborder, containing more than 99 percent of all Lepidoptera. Among the major clades of Glossata, Ditrysia contains advanced moths and butterflies and includes 98 percent of all Lepidoptera (Minet, 1991). The understanding of the phylogenetic relationships among Lepidoptera is essential to study this important insect order and will contribute meaningful information that can be used in the reconstruction of the tree of life. Presently, the phylogenetic relationships among the non-ditrysian lineages of Lepidoptera is well accepted (Nielsen and Kristensen, 1996), while the internal relationships among the major groups of Ditrysia are still controversial, although effort has been made using morphological and molecular characters (Kristensen et al., 2007; Regier et al., 2009). Within Ditrysia, three clades, that is, Apoditrysia, Obtectomera, and Macrolepidoptera have been recognized. The most authoritative phylogenetic analyses on the major groups of Ditrysia pointed out that further gene and taxon sampling are needed to strongly resolve individual deeper nodes (Regier et al., 2009; Mutanen et al., 2010). The early radiations of ditrysian superfamilies are likely to have been rapid (Kristensen et al., 2007). Thus, the resolution of its phylogenetic relationships will most likely require accurate analytical methods and many genes to provide sufficiently powerful information. Complete mitochondrial genome sequences have proved to be a powerful tool for the construction of high-level phylogenetic relationships in Lepidoptera (Hong et al., 2008; Li et al., 2010; Kim et al., 2011). However, no mitochondrial genomes have been sequenced from the family Plutellidae.

Here we determined the representative mitochondrial genome sequence of Plutellidae from a notorious pest, the diamondback moth Plutella xylostella. Subsequently, the phylogenetic relationships among major lineages of the advanced moths and butterflies were reconstructed using the complete mitochondrial genome sequences.

Materials and Methods

Specimens, DNA extraction, PCR amplification, and sequencing

P. xylostella specimens were obtained from a strain reared in the Laboratory of Integrated Pest Management, Beijing Academy of Agriculture and Forestry Sciences. Total genomic DNA was extracted from a single fourth instar larva using the DNeasy tissue kit according to the manufacturer's protocol (Qiagen). Nine primer pairs, which were either universal for insect mitochondrial genes or modified specifically for lepidopteran mitochondrial genes, were used according to previous studies (Simon et al., 1994; Simon et al., 2006). The regions of the nine amplified sequences were cox1-cox2, cox2-nad3, nad3-nad5, nad5-nad4, nad4-cob, cob-rrnL, rrnL-rrnS, rrnS-trnY, and trnI-cox1 (Supplementary Table S1; Supplementary Data are available online at www.liebertpub.com/dna). The PCR reactions were performed using Takara LA Taq (Takara Biomedical) with the recommended conditions and reagents. The amplified PCR products were sequenced directly by primer walking from both directions after gel purification. The sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on an ABI 3730 capillary sequencer at Beijing Sunbiotech Co., Ltd.

Genome annotation and secondary structure prediction

The tRNA searches were carried out with the tRNAscan-SE search server (Lowe and Eddy, 1997). All of the 22 typical animal mitochondrial tRNA genes were identified using Mito/Chloroplast as the source along with the Invertebrate Mito genetic code. Protein-coding genes were initially identified using BLAST searches in GenBank and subsequently by alignment with the genes of other lepidopteran insects. The boundary regions of rrnL are located downstream of the 5′ end of trnL1 and upstream of the 3′ end of trnV. The 3′ region of rrnS is located downstream of trnV, and the 5′ region is determined by alignment with genes of other lepidopteran insects. The rRNA structures were constructed by comparison with those in other insects (Cannone et al., 2002). All secondary structures were drawn in XRNA (developed by B. Weiser and available at http://rna.ucsc.edu/rnacenter/xrna/xrna.html).

Evolutionary analysis of protein-coding genes in Lepidoptera

The relative synonymous codon usage (RSCU) values were calculated with the MEGA 5 program (Tamura et al., 2011) for each protein-coding gene, excluding the start and stop codons. The nucleotide diversity (Pi) and the Jukes and Cantor-corrected nucleotide diversity [Pi(JC)] were calculated by the software package DnaSP 4.0 (Rozas et al., 2003). The nucleotide compositional heterogeneity across lepidopteran species was estimated by self-organizing clustering and analysis of heterogeneity (Jermiin et al., 2004) implemented in SeqVis v1.4 (Ho et al., 2006).

The level of saturation in the first, second, and third codon positions was separately analyzed using scatter plot graphics, comparing the uncorrected p-distances with the distances calculated by applying the best-fit evolutionary model (GTR+G+I) selected by the jModeltest2 (Posada, 2009). All distances were calculated with PAUP*4.0 b10 (Swofford, 2002).

Phylogenetic inference

The mitochondrial genome sequences used in this study were downloaded from GenBank. The classification of Lepidoptera was based on van Nieukerken et al., (2011). In total, 32 lepidopteran mitochondrial genomes, representing 32 species, 9 superfamilies, and 17 families, were used in our phylogenetic analysis. Two non-ditrysians species from the family of Hepialidae were used as outgroup taxa (Table 1).

Table 1.

Species Used in This Study

Species	Accession No.	Superfamily	Family	References
Thitarodes renzhiensis	NC_018094	Hepialoidea	Hepialidae	Cao et al. (2012)
Ahamus yunnanensis	NC_018095	Hepialoidea	Hepialidae	Cao et al. (2012)
Plutella xylostella	JF911819	Yponomeutoidea	Plutellidae	This study
Leucoptera malifoliella	JN790955	Yponomeutoidea	Lyonetiidae	Wu et al. (2012)
Bombyx mandarina	NC_003395	Bombycoidea	Bombycidae	Yukuhiro et al. (2002)
Bombyx mori	NC_002355	Bombycoidea	Bombycidae	Unpublished
Antheraea pernyi	NC_004622	Bombycoidea	Saturniidae	Hu et al. (2009)
Antheraea yamamai	NC_012739	Bombycoidea	Saturniidae	Kim et al. (2008)
Eriogyna pyretorum	NC_012727	Bombycoidea	Saturniidae	Jiang et al. (2009)
Saturnia boisduvalii	NC_010613	Bombycoidea	Saturniidae	Hong et al. (2008)
Manduca sexta	NC_010266	Bombycoidea	Sphingidae	Cameron and Whiting (2008)
Phthonandria atrilineata	NC_010522	Geometroidea	Geometridae	Yang et al. (2008)
Hyphantria cunea	NC_014058	Noctuoidea	Erebidae	Liao et al. (2010)
Lymantria dispar	NC_012893	Noctuoidea	Erebidae	Unpublished
Helicoverpa armigera	NC_014668	Noctuoidea	Noctuidae	Yin et al. (2010)
Ochrogaster lunifer	NC_011128	Noctuoidea	Notodontidae	Salvato et al. (2008)
Coreana raphaelis	NC_007976	Papilionoidea	Lycaenidae	Kim et al. (2006)
Acraea issoria	NC_013604	Papilionoidea	Nymphalidae	Hu et al. (2010)
Calinaga davidis	NC_015480	Papilionoidea	Nymphalidae	Unpublished
Hipparchia autonoe	NC_014587	Papilionoidea	Nymphalidae	Kim et al. (2010)
Sasakia charonda	NC_014224	Papilionoidea	Nymphalidae	Unpublished
Papilio maraho	NC_014055	Papilionoidea	Papilionidae	Feng et al. (2010)
Parnassius bremeri	NC_014053	Papilionoidea	Papilionidae	Kim et al. (2009b)
Teinopalpus aureus	NC_014398	Papilionoidea	Papilionidae	Unpublished
Pieris melete	NC_010568	Papilionoidea	Pieridae	Unpublished
Ctenoptilum vasava	NC_016704	Hesperioidea	Hesperiidae	Hao et al. (2012)
Diatraea saccharalis	NC_013274	Pyraloidea	Crambidae	Li et al. (2010)
Ostrinia furnacalis	NC_003368	Pyraloidea	Crambidae	Coates et al. (2005)
Ostrinia nubilalis	NC_003367	Pyraloidea	Crambidae	Coates et al. (2005)
Adoxophyes honmai	NC_008141	Tortricoidea	Tortricidae	Lee et al. (2006)
Grapholita molesta China	HQ116416	Tortricoidea	Tortricidae	Gong et al. (2011)
Spilonota lechriaspis	NC_014294	Tortricoidea	Tortricidae	Zhao et al. (2010)

The nucleotide sequence alignment of the protein-coding genes was inferred individually from amino acid alignment using MUSCLE with default parameters implemented in MEGA5 (Edgar, 2004; Tamura et al., 2011). Multiple alignment of each gene was analyzed with the Gblocks program (Castresana, 2000) to remove problematic regions under a relaxed approach (Talavera and Castresana, 2007) (Minimum number of sequences for a conserved position=17, minimum number of sequence for a flank position=27, maximum number of contiguous nonconserved positions=8, minimum number of a block=10, allowed gap positions=with half) and the kind of data by codon for DNA sequences. All of the protein-coding genes were concatenated following their ancestral order in the insect mitochondrial genomes.

Four datasets were employed in the phylogenetic analyses: the nucleotide sequences of the first and second codon positions (P12), all codon positions (P123), the first and second codon positions, and the RY-coded (purines coded by R and pyrimidines coded by Y) third codon position (P12RY3), and amino acid sequences (aa) of all protein-coding genes. The data of nucleotide sequences were partitioned based on the first, second, and third codon positions.

The phylogenetic analyses were performed using the Bayesian inference method implemented in MrBayes v3.2 (Ronquist et al., 2012). The models of DNA substitution were estimated in jModeltest2 (Posada, 2009). A general time-reversible model with gamma distribution plus a proportion of invariant sites (GTR+G+I) was used for the four-state nucleotide sequences, and a two-state substitution model with gamma distribution plus a proportion of invariant sites (I+G) was used for the RY-coded third codon position. The models of amino acid substitution were estimated in ProtTest v 2.4 (Abascal et al., 2005). The MtArt model was used for amino acid sequences with all parameters estimated. All Bayesian analyses were performed with four independent Markov chains run for 3,000,000 metropolis-coupled MCMC generations with tree sampling every 100 generations and a burn-in of 2500 trees. Convergence of independent runs was checked with the software Tracer v1.4. The phylogenetic trees were viewed and edited in the Figtree v1.4 (Rambaut, 2012).

Results and Discussion

Sequencing and structure of P. xylostella mitochondrial genome

In total, 16,079 bp of the P. xylostella mitochondrial genome sequence were determined, including all typical animal mitochondrial genes (13 protein-coding genes, two rRNA, and 22 tRNA genes) (GenBank accession No. JF911819). This is the first reported mitochondrial genome sequence from the family Plutellidae. However, we could not successfully sequence the complete A+T-rich region. Initially, a segment of approximately 3000 bp was amplified, including a partial region of the 5′ end of rrnS, an A+T-rich region, and a partial region of trnM. The sequencing reaction of this 3000-bp segment from the 3′ end succeeded, while it failed from the 5′ end after 340 bp because of a poly-T stretch. Further sequencing of this segment by primer walking from the sequenced region of the 5′ end could not be performed. Because of the high A+T content, there is no proper region that could be used for the design of a sequencing primer in this region. In total, 981 bp of the A+T-rich region was sequenced, leaving a 2000-bp A+T-rich region undetermined. Therefore, the A+T-rich region of the P. xylostella sequence is approximately 3000 bp long. The failure to sequence the entire A+T-rich region is a common issue occurring in the investigation of animal mitochondrial genomes because of their extremely high A+T content, stable stem-and-loop structures, and the presence of repeat sequences (Castro and Dowton, 2005; Castro et al., 2006; Cameron et al., 2008; Wei et al., 2010b).

All of the 37 genes and the A+T-rich region are arranged as in most previously reported lepidopteran mitochondrial genomes, in which trnM is shuffled from 3′ downstream of trnQ to 5′ upstream of trnI compared to the hypothesized ancestral arrangement pattern of insects (Fig. 1). The rearrangement of trnM was presumed to be a synapomorphic character in lepidopteran mitochondrial genomes (Kim et al., 2006; Liao et al., 2010). However, it should be noted that most of the previously sequenced mitochondrial genomes in Lepidoptera are restricted in to the clade of Ditrysia. A recent study on the ghost moths, from non-ditrysian lineage Hepialoidea, revealed the ancestral arrangement of trnI-trnQ-trnM in this group (Cao et al., 2012).

FIG. 1.

Gene arrangement pattern of the Plutella xylostella mitochondrial genome. The cox1, cox2, and cox3 labels refer to the cytochrome oxidase subunits, cob refers to cytochrome b, nad1-nad6 refer to NADH dehydrogenase components, and rrnL and rrnS refer to ribosomal RNAs. The transfer RNA genes are denoted by their one-letter symbol according to the IPUC-IUB single-letter amino acid codes. L1, L2, S1, and S2 denote tRNALeu^(CUN), tRNALeu^(UUR), tRNASer^(AGY), and tRNASer^(UCN), respectively. AT indicates the A+T-rich region. The gene names with lines indicate that the genes are coded on the minority strand, while those without lines are on the majority strand.

There are a total of 21 overlapping nucleotides, with the lengths of the overlapping sequences ranging from 1–8 bp, between neighboring genes in six locations, while there are a total of 296-bp intergenic nucleotides in 17 locations, with the length of the intergenic spacers ranging from 1–54 bp, excluding the A+T-rich region (Table 2).

Table 2.

Annotation of the Plutella xylostella Mitochondrial Genome

Gene	Strand	Position	Gene length (bp)	Anticodon/start codon	Stop codon	IN (bp)
trnM	+	1–68	68	CAT	—	2
trnI	+	71–135	65	GAT	—	−3
trnQ	−	133–201	69	TTG	—	50
nad2	+	252–1266	1015	ATT	T
trnW	+	1267–1331	65	TCA	—	−8
trnC	−	1324–1388	65	GCA	—	18
trnY	−	1407–1473	67	GTA	—	3
cox1	+	1477–3007	1531	CGA	T
trnL2	+	3008–3074	67	TAA	—
cox2	+	3075–3753	679	ATG	T
trnK	+	3754–3824	71	CTT	—	−1
trnD	+	3824–3889	66	GTC	—
atp8	+	3890–4057	168	ATC	TAA	−7
atp6	+	4051–4728	678	ATG	TAA	54
cox3	+	4783–5571	789	ATG	TAA	2
trnG	+	5574–5638	65	TCC	—
nad3	+	5639–5992	354	ATG	TAA	14
trnA	+	6007–6071	65	TGC	—	−1
trnR	+	6071–6135	65	TCG	—	8
trnN	+	6144–6211	68	GTT	—	−1
trnS1	+	6211–6278	68	GCT	—	6
trnE	+	6285–6350	66	TTC	—	47
trnF	−	6398–6465	68	GAA	—
nad5	−	6466–8186	1721	ATT	TA	12
trnH	−	8199–8265	67	GTG	—
nad4	−	8266–9604	1339	ATG	T
nad4l	−	9605–9895	291	ATG	TAA	16
trnT	+	9912–9977	66	TGT	—
trnP	−	9978–10042	65	TGG	—	2
nad6	+	10045–10578	534	ATT	TAA	41
cob	+	10620–11771	1152	ATG	TAA	3
trnS2	+	11775–11839	65	TGA	—	17
nad1	−	11857–12798	942	ATG	TAA	1
trnL1	−	12800–12869	70	TAG	—
rrnL	−	12870–14248	1379	—	—
trnV	−	14249–14315	67	TAC	—
rrnS	−	14316–15098	783	—	—
A+T-rich region		15099–16179	1081	—	—

IN, intergenic nucleotides; +, the gene coded on majority strand; −, the gene coded on minority strand.

rRNA genes

In the P. xylostella mitochondrial genome, rrnL is located between trnL1 and trnV, and rrnS is located between trnV and the A+T-rich region as in most insect mitochondrial genomes (Wolstenholme, 1992). The length of rrnL is 1379 bp, while the length of rrnS is 783 bp. Both rrnL and rrnS conform to the secondary structure models proposed for these genes from other insects (Cameron and Whiting, 2008; Wei et al., 2009; Wei et al., 2010c; Gong et al., 2011). Forty-nine helices belonging to six domains are present in the rrnL secondary structure of P. xylostella (Fig. 2), and a total of 29 helices belonging to three domains are present in rrnS, as in of other insects (Cameron and Whiting, 2008; Wei et al., 2009; Wei et al., 2010c; Gong et al., 2011) (Fig. 3).

FIG. 2.

Predicted rrnL secondary structure in the P. xylostella mitochondrial genome. Tertiary interactions and base triples are connected by continuous lines. Base pairing is indicated as follows: Watson–Crick pairs by lines, wobble GU pairs by dots, and other noncanonical pairs by circles. (A) 5′ half of rrnL; (B) 3′ half of rrnL.

FIG. 3.

Predicted rrnS secondary structure in the P. xylostella mitochondrial genome. Symbols are as in Fig. 2.

tRNA genes

The lengths of the tRNA genes range from 65 to 71 bp. All of the tRNA genes have a typical cloverleaf structure (Fig. 4). The trnL1 gene has a longer variable loop, 9 bp, compared to the other tRNAs, in which the length of the variable loop varies between 4 and 6 bp. Long variable loops in tRNA genes have been reported in Hymenoptera (Wei et al., 2009). D-stem pairings of trnS1 are frequently absent in many sequenced insect mitochondrial genomes (Feng et al., 2010; Wei et al., 2010c). Thus, the secondary structure of trnS1 usually cannot be identified and folded using conventional tRNA search methods such as tRNAscan-SE (Sheffield et al., 2008). In P. xylostella, trnS1 could be identified with tRNAscan-SE. The anticodons for all of the tRNA genes are identical to their counterparts in most other published insect mitochondrial genomes.

FIG. 4.

Predicted secondary structures for the 22 typical tRNA genes of the P. xylostella mitochondrial genome. Symbols are as in Fig. 2.

In the mitochondrial tRNA genes, noncanonical pairs were common in the secondary structures. There are 18 wobble G–U, five U–U, one A–G, and two A–C pairs present in the 22 tRNA secondary structures.

A+T-rich region

In insect mitochondrial genomes, the longest noncoding region is usually the A+T-rich region, located between rrnS and the trnI-trnQ-trnM cluster, though exceptions exist, such as in Hymenoptera (Wei et al., 2009; Wei et al., 2010b). This region is high in the A+T content and frequently contains repeat sequences. Because there are essential regulatory elements for transcription and replication in this area, it is also called the control region (Zhang and Hewitt, 1997). In the P. xylostella mitochondrial genome, the predicted A+T-rich region is approximately 3000 bp long, and is among the longest A+T-rich regions in insect mitochondrial genomes (Zhang and Hewitt, 1997; Wei et al., 2009). The presently determined A+T-rich region in the P. xylostella mitochondrial genome is 981 bp long; 88 bp are located adjacent to rrnS, and 893 bp are located adjacent to trnM. In total, 91.64% of the nucleotides are A and T. Seven repeat sequences of TTATGTAAATATTTAAATTA TATATAAAA and two long repeat sequences of 160 bp are present in the A+T-rich region. The latter is composed of three repeat sequences and a 73-bp sequence. Five conserved elements that might be involved in genome replication and transcription were found in the A+T-rich region: a poly-T stretch at the 5′ end of the A+T-rich region, which may be involved in the control of transcription and/or replication initiation; a [TA(A)]_n-like stretch following the poly-T stretch; a stem and loop structure, which may be associated with the second strand-replication origin; a TATA motif and a G (A)_nT motif flanking the stem and loop structure; and a G+A-rich sequence downstream of the stem and loop structure (Zhang and Hewitt, 1997) (Fig. 5).

FIG. 5.

Structural elements of the A+T-rich region of the P. xylostella mitochondrial genome.

Protein-coding genes

In the P. xylostella mitochondrial genome, 12 protein-coding genes start with ATN codons (four with ATT, one with ATC, and seven with ATG). The cox1 gene uses an unusual CGA start codon. The incomplete stop codon T was assigned for nad2, cox1, cox2, and nad4, and the incomplete stop codon TA was assigned for nad5. The other eight protein-coding genes use the typical stop codon TAA. These incomplete stop codons are common in metazoan mitochondrial genes (Wei et al., 2009; Liao et al., 2010). All of the protein-coding genes contain more T than A. Among the protein-coding genes, those coded on the majority strand contain more C than G, while those coded on the minority strand show less C than G (Table 3). This is congruent with the observation of skewed values in insect mitochondrial genomes (Hassanin, 2006; Wei et al., 2010a). The RSCU revealed a biased usage of A and T nucleotides (Table 4). UUA(Leu), AUU(Ile), UUU(Phe), and AUA(Met) are the most frequently used codons, as in other insects (Wei et al., 2009; Liao et al., 2010).

Table 3.

Base Composition of Protein-Coding and rRNA Genes in the Plutella xylostella Mitochondrial Genome

Gene	T%	C%	A%	G%	A+T%	AT skew	GC skew
atp6	44.7	12.5	34.5	8.3	79.2	−0.1288	−0.2019
atp8	42.9	6.5	48.2	2.4	91.1	0.0582	−0.4607
cox1	40.3	14.4	31.4	13.9	71.7	−0.1241	−0.0177
cox2	41.7	11.5	36.7	10.2	78.4	−0.0638	−0.0599
cox3	40.1	14.2	33.3	12.4	73.4	−0.0926	−0.0677
cob	42.4	12.5	34.8	10.3	77.2	−0.0984	−0.0965
nad1	49.5	8.1	29.7	12.7	79.2	−0.2500	0.2212
nad2	48.9	8.9	36.3	5.9	85.2	−0.1479	−0.2027
nad3	48.3	9.3	34.2	8.2	82.5	−0.1709	−0.0629
nad4	49.7	6.9	31.1	12.2	80.8	−0.2302	0.2775
nad4l	55.3	4.5	29.6	10.7	84.9	−0.3027	0.4079
nad5	48.5	7.2	33.3	11.0	81.8	−0.1858	0.2088
nad6	47.6	8.4	38.2	5.8	85.8	−0.1096	−0.1831
rrnL	41.8	5.1	43.2	9.9	85.0	0.0165	0.3200
rrnS	40.9	4.6	45.2	9.3	86.1	0.0499	0.3381

Table 4.

Codon Usage in the Plutella xylostella Mitochondrial Protein-Coding Genes

Amino acid	Codon	Number	RSCU	Amino acid	Codon	Number	RSCU
Phe	UUU	359	1.86	Cys	UAU	159	1.76
	UUC	26	0.14		UAC	22	0.24
Leu	UUA	485	5.31	His	CAU	60	1.79
	UUG	15	0.16		CAC	7	0.21
	CUU	29	0.32	Gln	CAA	59	1.90
	CUC	2	0.02		CAG	3	0.10
	CUA	16	0.18	Asn	AAU	233	1.86
	CUG	1	0.01		AAC	17	0.14
Ile	AUU	429	1.91	Lys	AAA	110	1.85
	AUC	20	0.09		AAG	9	0.15
Met	AUA	247	1.76	Asp	GAU	63	1.91
	AUG	33	0.24		GAC	3	0.09
Val	GUU	75	2.26	Glu	GAA	70	1.89
	GUC	3	0.09		GAG	4	0.11
	GUA	50	1.50	Cys	UGU	27	1.86
	GUG	5	0.15		UGC	2	0.14
Ser	UCU	130	3.21	Trp	UGA	92	1.96
	UCC	7	0.17		UGG	2	0.04
	UCA	74	1.83	Arg	CGU	20	1.54
	UCG	3	0.07		CGC	0	0.00
Pro	CCU	81	2.55		CGA	31	2.38
	CCC	15	0.47		CGG	1	0.08
	CCA	31	0.98	Ser	AGU	27	0.67
	CCG	0	0.00		AGC	1	0.02
Thr	ACU	94	2.34		AGA	82	2.02
	ACC	12	0.30		AGG	0	0.00
	ACA	53	1.32	Gly	GGU	53	1.07
	ACG	2	0.05		GGC	2	0.04
Ala	GCU	79	2.59		GGA	115	2.32
	GCC	5	0.16		GGG	28	0.57
	GCA	37	1.21
	GCG	1	0.03

RSCU, relative synonymous codon usage.

Comparative analysis of the protein-coding genes in Ditrysia

In the ditrysian mitochondrial genomes, the A+T content of all protein-coding regions ranged from 77.1% to 82.8%. The difference of A+T content among species is less than that in Hymenoptera (Wei et al., 2010c). However, the A+T content varied greatly among different genes. The atp8 and nad6 genes show a high A+T content, while cox1 and cox3 show a relatively low A+T content. All of the protein-coding genes have a negative AT skew. Genes coded on the majority strand have a negative GC skew, while genes coded on the minority strand have a positive GC skew (Table 5), as previously reported in insect mitochondrial genomes (Wei et al., 2010a).

Table 5.

Base Composition of the Protein-Coding Genes in the Lepidopteran Mitochondrial Genomes

Gene	T%	C%	A%	G%	A+T%	AT skew	GC skew
atp6	44.2	13.0	34.6	8.1	78.8	−0.1218	−0.2322
atp8	47.7	6.8	43.1	2.3	90.8	−0.0507	−0.4945
cox1	40.0	14.9	31.6	13.5	71.6	−0.1173	−0.0493
cox2	40.7	13.1	36.0	10.1	76.7	−0.0613	−0.1293
cox3	40.2	14.3	33.1	12.4	73.3	−0.0969	−0.0712
cob	42.3	13.9	33.8	10.1	76.1	−0.1117	−0.1583
nad1	48.0	7.4	30.0	14.5	78.0	−0.2308	0.3242
nad2	48.7	9.7	35.5	6.0	84.2	−0.1568	−0.2357
nad3	46.5	11.8	34.8	6.9	81.3	−0.1439	−0.2620
nad4	47.7	6.7	32.9	12.6	80.6	−0.1836	0.3057
nad4l	51.6	4.2	32.5	11.7	84.1	−0.2271	0.4717
nad5	48.5	6.4	33.2	12.0	81.7	−0.1873	0.3043
nad6	48.1	8.7	37.6	5.5	85.7	−0.1225	−0.2254

The RSCU values were usually calculated for all of the protein-coding genes of one mitochondrial genome. Here we compared the RSCU among 13 protein-coding genes calculated from the ditrysian mitochondrial genomes (Fig. 6). A/T-rich codons are preferred in all of the protein-coding genes. TTR codons (code for Leu2) are more frequently used than CTN codons (code for Leu1). TCN codons (code for Ser2) are more frequently used than AGN codons (code for Ser1). In nad1, nad4, nad4l, and nad5, GGG is more frequently present compared to other genes. In nad2 and nad3, C-rich codons are more frequent than in other genes.

FIG. 6.

Relative synonymous codon usage of individual protein-coding genes in all analyzed lepidopteran mitochondrial genomes.

Biases in nucleotide composition across species were analyzed based on self-organizing clustering and analysis of heterogeneity. The nucleotide composition is homogeneous across the species for 13 concatenated protein-coding genes as well as for the first and second codon positions. The second codon position is the most homogeneous, while the third codon position is the most divergent. Sequences from Ochrogaster lunifer and Hipparchia autonoe are the most divergent species in the first, third, and all codon positions, although the differences are not statistically significant.

The nucleotide diversity (Pi) and Jukes and Cantor-corrected nucleotide diversity [Pi(JC)] were calculated for each protein-coding gene using the gene sequences of all presently sequenced lepidopteran mitochondrial genomes (Fig. 7).The cox1 and cox2 have low nucleotide diversities, while the nad6, nad2, and nad3 genes are highly variable. This is congruent with the analysis of size, proportion of variable, and phylogenetically informative sites among eight lepidopteran species (Cameron and Whiting, 2008).

FIG. 7.

Nucleotide diversity of each protein-coding gene in Lepidoptera. Pi, nucleotide diversity; Pi(JC), Jukes and Cantor-corrected nucleotide diversity.

In the absence of saturation in the nucleotide substitution process, GTR+G+I distances coincide with p-distances; conversely, GTR+G+I distances are larger than p-distances when the level of saturation increases. Our analysis indicated the multiple substitutions in the third codon position of the lepidopteran mitochondrial protein-coding genes (Fig. 8).

FIG. 8.

Scatter plot graphics performed to test the saturation of the nucleotide substitution process in the first, second, and third codon positions of the 13 mitochondrial protein-coding genes in Lepidoptera.

Phylogeny of Lepidoptera using mitochondrial genome sequences

Previous studies showed that the Bayesian inference method always generates a reliable tree topology when 13 mitochondrial protein-coding genes are used (Dowton et al., 2009a; Gotzek et al., 2010). Therefore, in our analysis, Bayesian inference was used with different data partitions of 13 concatenated protein-coding gene sequences to test the utility of the mitochondrial genome sequences in describing the high-level phylogeny of Lepidoptera. Among the four different data matrixes, the amino acid sequences outperformed nucleotide sequences, as demonstrated in other studies of higher level phylogeny of insects (Talavera and Vila, 2011).

The clades of Ditrysia (including Yponomeutoidea, Tortricoidea, Papilionoidea, Pyraloidea, Noctuoidea, Geometroidea, and Bombycoidea here), Apoditrysia (including Tortricoidea, Papilionoidea, Pyraloidea, Noctuoidea, Geometroidea, and Bombycoidea here), Obtectomera (including Papilionoidea, Pyraloidea, Noctuoidea, Geometroidea, and Bombycoidea here), and Macroheterocera (including Noctuoidea, Geometroidea, and Bombycoidea here) were all recovered in our analysis (Fig. 9), as in the recent comprehensive study of the Lepidoptera classification (van Nieukerken et al., 2011).

FIG. 9.

Bayesian phylogenetic tree of Lepidoptera based on the amino acid sequences of 13 mitochondrial protein-coding genes. The numbers near the nodes are posterior probabilities inferred from amino acid sequences of the 13 protein-coding genes by the Bayesian inference method.

Among the representative superfamilies of Ditrysia used in our analysis, four superfamilies, that is, Yponomeutoidea, Bombycoidea, Noctuoidea, and Papilionoidea, include more than one representative family. All of these superfamilies were shown to be monophyletic except for the Papilionoidea. Traditionally, Hesperiidae (skippers) are usually placed in their own super family Hesperioidea, while all other butterflies (Papilionidae, Pieridae, Lycaenidae, and Nymphalidae) are placed in Papilionoidea (Wahlberg et al., 2005). Our results suggest that Papilionidae is a sister group to Hesperioidea and all other butterflies ([Lycaenidae+Pieridae]+Nymphalidae). A similar result was reported in several studies based on morphological characters, nuclear genes, and mitochondrial genome sequences (Regier et al., 2009; Mutanen et al., 2010; Hao et al., 2012; Heikkilä et al., 2012).

The four superfamilies, that is, Papilionoidea, Noctuoidea, Bombycoidea, and Geometroidea, used in this study are traditionally considered to be a group of Macrolepidoptera (Minet, 1991). In our analysis, Macrolepidoptera was shown to be paraphyletic. Bombycoidea and Geometroidea are sister groups, and then sisters to Noctuoidea. However, Papilionoidea is sister to the clade of (Pyraloidea+[Noctuoidea+(Bombycoidea+Geometroidea)]). Our analysis is consistent with the present studies on the higher level phylogeny of Lepidoptera (Mutanen et al., 2010; van Nieukerken et al., 2011)

Most of the previously postulated phylogenetic relationships of the Ditrysia cladogram were based on morphology (Minet, 1991). However, morphological knowledge usually contains considerable homoplasic noise, which limits its value for making biological inferences (Kristensen et al., 2007). The phylogenetic relationships among the family and superfamily levels were studied using the period gene, and it was found that node support for some families and all larger taxonomic units was uniformly low, and the recovery of weakly supported groups proved sensitive to the analytical parameters used (Regier et al., 1998). Five protein-coding nuclear genes were used to resolve the relationships among the 27 superfamilies and 55 families of Ditrysia, which generated the same topology as our analysis (Regier et al., 2009). However, most of the relationships among superfamilies in Regier et al., (2009) are weakly supported. Our analysis indicates that the complete mitochondrial genome sequence could robustly resolve the relationships at the family and superfamily level of Ditrysia, suggesting that the complete mitochondrial genome is a promising molecular tool for constructing the tree of Lepidoptera.

Conclusions

In this study, we reported the first representative mitochondrial genome sequence of the family Plutellidae. The general features of this mitochondrial genome are similar to those in previous reports of other ditrysian lepidopteran species. A comparative analysis of the protein-coding genes within Ditrysia indicated that cox1 and cox2 have low nucleotide diversities, while the nad6, nad2, and nad3 genes are highly variable. The demonstrated utility of complete mitochondrial genome sequences in phylogenetic analysis generates robust relationships among major lineages of Ditrysia, suggesting that mitochondrial genomes are likely to be a promising tool for systematics in Lepidoptera.

Footnotes

Acknowledgments

Funding for this study was provided jointly by the National Science Foundation of China (No. 31101661), National Basic Research Program of China (2013CB127600), Beijing New Star Program on Science and Technology (2010B027), Special Fund for the Promotion and Innovation of Beijing Academy of Agriculture and Forestry Sciences (KJCX201104009), and the Beijing Excellent Talents Program (2010D002020000010).

Disclosure Statement

No competing financial interests exist.

References

Abascal

, Zardoya

, Posada

2005. ProtTest: selection of best-fit models of protein evolution. Bioinformatics, 21:2104–2105.

Boore

J.L.

, Lavrov

D.V.

, Brown

W.M.

1998. Gene translocation links insects and crustaceans. Nature, 392:667–668.

Cameron

S.L.

, Dowton

, Castro

L.R.

, Ruberu

, Whiting

M.F.

, Austin

A.D.

et al. 2008. Mitochondrial genome organization and phylogeny of two vespid wasps. Genome, 51:800–808.

Cameron

S.L.

, Lambkin

C.L.

, Barker

S.C.

, Whiting

M.F.

2007. A mitochondrial genome phylogeny of Diptera: whole genome sequence data accurately resolve relationships over broad timescales with high precision. Syst Entomol, 32:40–59.

Cameron

S.L.

, Sullivan

, Song

, Miller

K.B.

, Whiting

M.F.

2009. A mitochondrial genome phylogeny of the Neuropterida (lace-wings, alderflies and snakeflies) and their relationship to the other holometabolous insect orders. Zool Scr, 38:575–590.

Cameron

S.L.

, Whiting

M.F.

2008. The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene, 408:112–123.

Cannone

J.J.

, Subramanian

, Schnare

M.N.

, Collett

J.R.

, D'Souza

L.M.

, Du

et al. 2002. The comparative RNA web (CRW) site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinform, 3:1471–2105.

Cao

Y.Q.

, Ma

, Chen

J.Y.

, Yang

D.R.

2012. The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera. BMC Genomics, 13:276.

Castresana

2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol, 17:540–552.

10.

Castro

, Dowton

2005. The position of the Hymenoptera within the Holometabola as inferred from the mitochondrial genome of Perga condei (Hymenoptera: Symphyta: Pergidae) Mol Phylogenet Evol, 34:469–479.

11.

Castro

L.R.

, Dowton

2007. Mitochondrial genomes in the Hymenoptera and their utility as phylogenetic markers. Syst Entomol, 32:60–69.

12.

Castro

L.R.

, Ruberu

, Dowton

2006. Mitochondrial genomes of Vanhornia eucnemidarum (Apocrita: Vanhorniidae) and Primeuchroeus spp. (Aculeata: Chrysididae): evidence of rearranged mitochondrial genomes within the Apocrita (Insecta: Hymenoptera) Genome, 49:752–766.

13.

Coates

B.S.

, Sumerford

D.V.

, Hellmich

R.L.

, Lewis

L.C.

2005. Partial mitochondrial genome sequences of Ostrinia nubilalis and Ostrinia furnicalis. Int J Biol Sci, 1:13–18.

14.

Dowton

, Cameron

S.L.

, Austin

A.D.

, Whiting

M.F.

2009a. Phylogenetic approaches for the analysis of mitochondrial genome sequence data in the Hymenoptera–A lineage with both rapidly and slowly evolving mitochondrial genomes. Mol Phylogenet Evol, 52:512–519.

15.

Dowton

, Cameron

S.L.

, Dowavic

J.I.

, Austin

A.D.

, Whiting

M.F.

2009b. Characterization of 67 mitochondrial tRNA gene rearrangements in the Hymenoptera suggests that mitochondrial tRNA gene position is selectively neutral. Mol Biol Evol, 26:1607–1617.

16.

Edgar

R.C.

2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res, 32:1792–1797.

17.

Feng

, Liu

D-F

, Wang

N-X

, Zhu

C-D

, Jiang

G-F

. 2010. The mitochondrial genome of the butterfly Papilio xuthus (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mol Biol Rep, 37:3877–3888.

18.

Gong

Y.J.

, Shi

B.C.

, Kang

Z.J.

, Zhang

, Wei

S.J.

2011. The complete mitochondrial genome of the oriental fruit moth Grapholita molesta (Busck) (Lepidoptera: Tortricidae) Mol Biol Rep, 39:2893–2900.

19.

Gotzek

, Clarke

, Shoemaker

2010. Mitochondrial genome evolution in fire ants (Hymenoptera: Formicidae) BMC Evol Biol, 10:300.

20.

Hao

, Sun

, Zhao

, Sun

, Gai

, Yang

2012. The complete mitochondrial genome of Ctenoptilum vasava (Lepidoptera: Hesperiidae: Pyrginae) and its phylogenetic implication. Comp Funct Genomics, 2012:328049.

21.

Hassanin

2006. Phylogeny of Arthropoda inferred from mitochondrial sequences: strategies for limiting the misleading effects of multiple changes in pattern and rates of substitution. Mol Phylogenet Evol, 38:100–116.

22.

Heikkilä

, Kaila

, Mutanen

, Peña

, Wahlberg

2012. Cretaceous origin and repeated tertiary diversification of the redefined butterflies. Proc R Soc B: Biol Sci, 279:1093–1099.

23.

J.W.K.

, Adams

C.E.

, Lew

J.B.

, Matthews

T.J.

, Ng

C.C.

, Shahabi-Sirjani

et al. 2006. SeqVis: visualization of compositional heterogeneity in large alignments of nucleotides. Bioinformatics, 22:2162.

24.

Hong

M.Y.

, Lee

E.M.

, Jo

Y.H.

, Park

H.C.

, Kim

S.R.

, Hwang

J.S.

et al. 2008. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects. Gene, 413:49–57.

25.

, Zhang

, Hao

, Huang

, Cameron

, Zhu

2010. The complete mitochondrial genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini): sequence, gene organization and a unique tRNA translocation event. Mol Biol Rep, 37:3431–3438.

26.

X.L.

, Cao

G.L.

, Xue

R.Y.

, Zheng

X.J.

, Zhang

, Duan

H.R.

et al. 2009. The complete mitogenome and phylogenetic analysis of Bombyx mandarina strain Qingzhou. Mol Biol Rep, 37:2599–2608.

27.

Hua

J.M.

, Li

, Dong

P.Z.

, Cui

, Xie

, Bu

W.J.

2008. Comparative and phylogenomic studies on the mitochondrial genomes of Pentatomomorpha (Insecta: Hemiptera: Heteroptera) BMC Genomics, 9:610.

28.

Hua

J.M.

, Li

, Dong

P.Z.

, Cui

, Xie

, Bu

W.J.

2009. Phylogenetic analysis of the true water bugs (Insecta: Hemiptera: Heteroptera: Nepomorpha): evidence from mitochondrial genomes. BMC Evol Biol, 9:134.

29.

Jermiin

L.S.

, Ho

S.Y.W.

, Ababneh

, Robinson

, Larkum

A.W.D.

2004. The biasing effect of compositional heterogeneity on phylogenetic estimates may be underestimated. Syst Biol, 53:638–643.

30.

Jiang

S.T.

, Hong

G.Y.

, Yu

, Li

, Yang

, Liu

Y.Q.

et al. 2009. Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae) Int J Biol Sci, 5:351–365.

31.

Kim

, Lee

E.M.

, Seol

K.Y.

, Yun

E.Y.

, Lee

Y.B.

, Hwang

J.S.

et al. 2006. The mitochondrial genome of the Korean hairstreak, Coreana raphaelis (Lepidoptera: Lycaenidae) Insect Mol Biol, 15:217–225.

32.

Kim

K-G

, Hong

M.Y.

, Kim

M.J.

, Im

H.H.

, Kim

M.I.

, Bae

C.H.

et al. 2009a. Complete mitochondrial genome sequence of the yellow-spotted long-horned beetle Psacothea hilaris (Coleoptera: Cerambycidae) and phylogenetic analysis among coleopteran insects. Mol Cells, 27:429–441.

33.

Kim

M.I.

, Baek

J.Y.

, Kim

M.J.

, Jeong

H.C.

, Kim

K.G.

, Bae

C.H.

et al. 2009b. Complete nucleotide sequence and organization of the mitogenome of the red-spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Mol Cells, 28:347–363.

34.

Kim

M.J.

, Kang

A.R.

, Jeong

H.C.

, Kim

K.G.

, Kim

2011. Reconstructing intraordinal relationships in Lepidoptera using mitochondrial genome data with the description of two newly sequenced lycaenids, Spindasis takanonis and Protantigius superans (Lepidoptera: Lycaenidae) Mol Phylogenet Evol, 2:436–445.

35.

Kim

M.J.

, Wan

, Kim

K.G.

, Hwang

J.S.

, Kim

2010. Complete nucleotide sequence and organization of the mitogenome of endangered Eumenis autonoe (Lepidoptera: Nymphalidae) Afr J Biotechnol, 9:735–754.

36.

Kim

S.R.

, Kim

M.I.

, Hong

M.Y.

, Kim

K.Y.

, Kang

P.D.

, Hwang

J.S.

et al. 2008. The complete mitogenome sequence of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae) Mol Biol Rep, 36:1871–1880.

37.

Kristensen

N.P.

1984. Studies on the morphology and systematics of primitive Lepidoptera (Insecta) Steenstrupia, 10:141–191.

38.

Kristensen

N.P.

, Scoble

M.J.

, Karsholt

2007. Lepidoptera phylogeny and systematics: the state of inventorying moth and butterfly diversity. Zootaxa, 1668:699–747.

39.

Lee

, Shin

, Kim

, Park

, Cho

, Kim

2006. The mitochondrial genome of the smaller tea tortrix Adoxophyes honmai (Lepidoptera: Tortricidae) Gene, 373:52–57.

40.

, Zhang

, Fan

, Yue

, Huang

, King

et al. 2010. Structural characteristics and phylogenetic analysis of the mitochondrial genome of the sugarcane borer, Diatraea saccharalis (Lepidoptera: Crambidae) DNA and Cell Biology, 30:3–8.

41.

Liao

, Wang

, Wu

, Li

Y.P.

, Zhao

, Huang

G.M.

et al. 2010. The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae) Int J Biol Sci, 6:172–186.

42.

Lowe

T.M.

, Eddy

S.R.

1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res, 25:955–964.

43.

Minet

1991. Tentative reconstruction of the ditrysian phylogeny (Lepidoptera: Glossata) Insect Syst Evol, 22:69–95.

44.

Mutanen

, Wahlberg

, Kaila

2010. Comprehensive gene and taxon coverage elucidates radiation patterns in moths and butterflies. Proc R Soc B: Biol Sci, 277:2839–2848.

45.

Nielsen

E.S.

, Kristensen

N.P.

1996. The Australian moth family Lophocoronidae and the basal phylogeny of the Lepidoptera-Glossata. Invertebr Syst, 10:1199–1302.

46.

Posada

2009. Selection of models of DNA evolution with jModelTest. Methods Mol Biol, 537:93–112.

47.

Rambaut

2012. FigTree, a graphical viewer of phylogenetic trees. http://tree.bio.ed.ac.uk/software/figtree.

48.

Regier

J.C.

, Fang

Q.Q.

, Mitter

, Peigler

R.S.

, Friedlander

T.P.

, Solis

M.A.

1998. Evolution and phylogenetic utility of the period gene in Lepidoptera. Mol Biol Evol, 15:1172–1182.

49.

Regier

J.C.

, Zwick

, Cummings

M.P.

, Kawahara

A.Y.

, Cho

, Weller

et al. 2009. Toward reconstructing the evolution of advanced moths and butterflies (Lepidoptera: Ditrysia): an initial molecular study. BMC Evol Biol, 9:280.

50.

Ronquist

, Teslenko

, van der Mark

, Ayres

D.L.

, Darling

, Höhna

et al. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol, 61:539–542.

51.

Rozas

, Sanchez-DelBarrio

J.C.

, Messeguer

, Rozas

2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics, 19:2496–2497.

52.

Salvato

, Simonato

, Battisti

, Negrisolo

2008. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae) BMC Genomics, 9:331.

53.

Sheffield

N.C.

, Song

, Cameron

S.L.

, Whiting

M.F.

2008. A comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles. Mol Biol Evol, 25:2499–2509.

54.

Simon

, Buckley

T.R.

, Frati

, Stewart

J.B.

, Beckenbach

A.T.

2006. Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annu Rev Ecol Syst, 37:545–579.

55.

Simon

, Frati

, Beckenbach

, Crespi

, Liu

, Flook

1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am, 87:651–701.

56.

Swofford

D.L.

2002. PAUP*: Phylogenetic Analysis Using Parsimonyversion 4.0 b10Sinauer Associates: Sunderland, Massachusetts.

57.

Talavera

, Castresana

2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst Biol, 56:564–577.

58.

Talavera

, Vila

2011. What is the phylogenetic signal limit from mitogenomes? The reconciliation between mitochondrial and nuclear data in the Insecta class phylogeny. BMC Evol Biol, 11:315.

59.

Tamura

, Peterson

, Stecher

, Nei

, Kumar

2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 28:2731–2739.

60.

van Nieukerken

E.J.

, Kaila

, Kitching

I.J.

, Kristensen

N.P.

, Lees

D.C.

, Minet

et al. 2011. Order Lepidoptera. Animal Biodiversity: An Outline of Higher-Level Classification and Survey of Taxonomic Richness. Zhang

Z.Q.

Magnolia Press: St. Lukes, NZ, 212–221.

61.

Wahlberg

, Braby

M.F.

, Brower

A.V.Z.

, De Jong

, Lee

M.M.

, Nylin

et al. 2005. Synergistic effects of combining morphological and molecular data in resolving the phylogeny of butterflies and skippers. Proc R Soc B: Biol Sci, 272:1577–1586.

62.

Wei

S.J.

, Shi

, Chen

X.X.

, Sharkey

M.J.

, van Achterberg

, Ye

G.Y.

et al. 2010a. New views on strand asymmetry in insect mitochondrial genomes. PLoS One, 5:1767–1780.

63.

Wei

S.J.

, Shi

, He

J.H.

, Sharkey

M.J.

, Chen

X.X.

2009. The complete mitochondrial genome of Diadegma semiclausum (Hymenoptera: Ichneumonidae) indicates extensive independent evolutionary events. Genome, 52:308–319.

64.

Wei

S.J.

, Shi

, Sharkey

M.J.

, van Achterberg

, Chen

X.X.

2010b. Comparative mitogenomics of Braconidae (Insecta: Hymenoptera) and the phylogenetic utility of mitochondrial genomes with special reference to Holometabolous insects. BMC Genomics, 11:371.

65.

Wei

S.J.

, Tang

, Zheng

L.H.

, Shi

, Chen

X.X.

2010c. The complete mitochondrial genome of Evania appendigaster (Hymenoptera: Evaniidae) has low A+ T content and a long intergenic spacer between atp8 and atp6. Mol Biol Rep, 37:1931–1942.

66.

Wolstenholme

D.R.

1992. Animal mitochondrial DNA: structure and evolution. Int Rev Cytol, 141:173–216.

67.

Y.P.

, Zhao

J.L.

, Su

T.J.

, Li

, Yu

, Chesters

et al. 2012. The complete mitochondrial genome of Leucoptera malifoliella Costa (Lepidoptera: Lyonetiidae) DNA Cell Biol, 31:1508–1522.

68.

Yang

, Wei

Z.J.

, Hong

G.Y.

, Jiang

S.T.

, Wen

L.P.

2008. The complete nucleotide sequence of the mitochondrial genome of Phthonandria atrilineata (Lepidoptera: Geometridae) Mol Biol Rep, 36:1441–1449.

69.

Yin

, Hong

G.Y.

, Wang

A.M.

, Cao

Y.Z.

, Wei

Z.J.

2010. Mitochondrial genome of the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) and comparison with other Lepidopterans. Mitochondrial DNA, 21:160–169.

70.

Yukuhiro

, Sezutsu

, Itoh

, Shimizu

, Banno

2002. Significant levels of sequence divergence and gene rearrangements have occurred between the mitochondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close relative, the domesticated silkmoth, Bombyx mori. Mol Biol Evol, 19:1385–1389.

71.

Zhang

D.X.

, Hewitt

G.M.

1997. Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies. Biochem Syst Ecol, 25:99–120.

72.

Zhao

J.L.

, Zhang

Y.Y.

, Luo

A.R.

, Jiang

G.F.

, Cameron

S.L.

, Zhu

C.D.

2010. The complete mitochondrial genome of Spilonota lechriaspis Meyrick (Lepidoptera: Tortricidae) Mol Biol Rep, 38:3757–3764.

73.

Zhou

Z.J.

, Ye

H.Y.

, Huang

, Shi

F.M.

2010. The phylogeny of Orthoptera inferred from mtDNA and description of Elimaea cheni (Tettigoniidae: Phaneropterinae) mitogenome. J Genet Genomics, 37:315–324.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.03 MB