Antiproliferative and Proapoptotic Effects of Crocin Combined with Hyperthermia on Human Breast Cancer Cells

Abstract

We investigated the suppressive effects of crocin alone and in combination with hyperthermia (HT) on proliferation of breast cancer cells. Cell viability, colony formation ability, and apoptosis were assessed by 3-(4,5-dimetylthiazol-2-Yl)-2,5–diphenyltetrazolium bromide (MTT), soft agar, Hoechst 33258 staining, and percentage of lactate dehydrogenase (LDH) release methods, respectively. The mRNA levels Hsp27, Hsp70, Hsp90, Bax, and Bcl-2 were measured by quantitative real-time polymerase chain reaction (qRT-PCR). Hsp70 and Hsp90 proteins were determined using enzyme-linked immunosorbent assay (ELISA) technique. Crocin in combination with HT significantly inhibited the proliferation of cancer cells in a dose- and time-dependent manner. There was a degree of synergism in the combined treatment. However, crocin did not show the high cytotoxic effect on normal cells. This treatment decreased colony formation of cancer cells up to 94%. Changed nuclear morphology and increased LDH indicated that crocin combined with HT has a more apoptotic effect than crocin alone. Furthermore, in treated cells Bax/Bcl-2 ratio markedly increased, whereas expression of heat-induced genes decreased. Also, the Hsp70 and Hsp90 proteins decreased in the treated cells. Our study indicated that combination of crocin and HT has strong antiproliferative and apoptotic activities against breast cancer cells. Hence, it is suggested that more studies are warranted to apply crocin as a possible, safe, and promising anticancer agent in cancer.

Introduction

Cancer incidence is increasing in both developing and developed countries (Bhandari, 2015). Breast cancer is the most common cancer among women worldwide. Although a lot of progress is achieved in breast cancer diagnosis and treatment, around 40% of patients show recurrence or metastasis (Xu et al., 2014). Therefore, developing more effective therapies with fewer side effects has been essentially demanded to improve quality of life of patients and decrease possible cancer recurrence (Wang et al., 2015). In this context, combination therapy is more successful than sequential treatment (Hu et al., 2010). This type of therapy not only leads to using a lower dose of drugs or radiation, but also reduces drug resistance (Ahmed and Zaidi, 2013). In recent years, combination therapy with hyperthermia (HT) and medicinal plants has been considered as a potential treatment for cancer (Li et al., 2013).

It has been reported that a temperature between 41°C and 44°C does not affect normal cells while significantly inhibiting cancer cell growth (Ahmed and Zaidi, 2013). Heat therapy induces various physiological changes in cells, such as alteration in membrane permeability, modification of cytoskeletal system, changes in macromolecule synthesis, intracellular signal transduction, and inhibition of DNA repair (Ahmed and Zaidi, 2013). Interestingly, many clinical trials have shown that combining HT with other cancer therapies can yield durable complete responses (Jones et al., 2005). However, HT is inevitably associated with heat shock proteins (HSPs). Importantly, increased expression of HSPs such as Hsp70 and Hsp90 in cancer cells has been reported (Gress et al., 1994). Reducing HSP levels in tumor cells induces cell death and/or sensitizes them to cytotoxic agents without deleterious effects on normal cells (Powers et al., 2008).

On the other hand, medicinal plants play an important role in cancer prevention and treatment (Bhandari, 2015; Hoshyar et al., 2015a). Among various herbs, the anticancer effects of saffron (Crocus sativus L.) and its secondary metabolites were shown in both in vitro and in vivo models (Bathaie et al., 2007, 2013; Hoshyar et al., 2013; Amin et al., 2016). Crocin is the main water-soluble carotenoid of saffron stigma that effectively suppresses the proliferation of cancer cells through apoptosis induction without affecting normal cells (Hoshyar et al., 2013). Recently, crocin has been used in combination with lower doses of other modern or conventional anticancer agents to inhibit cell proliferation (Li et al., 2013).

Apoptosis or programmed cell death is one of the cellular responses to anticancer agents, induced by HT or herbs (Ahmed and Zaidi, 2013). So, targeted inhibition of the antiapoptotic pathway is an attractive approach for combination cancer therapies (Ahmed and Zaidi, 2013). The aim of the present study is to investigate the cytotoxic and apoptotic effects of crocin alone or its combination with HT on breast adenocarcinoma (MDA-MB-468) cells.

Materials and Methods

Crocin preparation

Crocin is isolated and purified from the Iranian saffron stigma according to the registered method in the previous report (Patent No. 020577; Bolhasani et al., 2005).

Cell culture

Human breast cancer (MDA-MB-468) and normal breast epithelial (MCF10-A) cell lines were provided from Iranian Biological Resource Center (IBRC). Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), phosphate buffered saline (PBS), trypsin/EDTA solution, 3-(4,5-dimetylthiazol-2-Yl)–2,5–diphenyltetrazolium bromide (MTT), and dimethyl sulfoxide (DMSO) were purchased from Gibco BRL and Sigma, respectively. The cells were cultured in DMEM supplemented with 10% FBS, 100 units/mL penicillin, and 100 mg/mL streptomycin. Both cell lines were grown at 37°C in humidified atmosphere containing 5% CO₂. For combined treatment, first MDA-MB-468 cells were incubated at 43°C for 2 h in a CO₂ incubator with a humid atmosphere; second, cells were exposed to various concentrations of crocin (0–5 mg/mL) at different time intervals (0–72 h). Cells treated with crocin (3 and 4 mg/mL after 24 and 48 h) were washed with PBS. Then, morphological changes were examined at indicated times using a regular phase-contrast microscope.

Cell viability assay

The cytotoxic effects of crocin alone and combined with HT on normal and cancer cells were determined with MTT assay. The absorbance was recorded at 570 nm with a plate reader (BioTek, Epoch). The IC₅₀ values (its minimum concentration to reduce cell viability to 50%) of crocin alone and combined with HT, were calculated using the dose- and time-dependent curves by linear interpolation (Hoshyar et al., 2015b).

The synergy index (q) was measured according to the following formula: \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document} \begin{align*}q = { \frac { E ( A + B ) } { ( EA + EB - EA \times EB ) } } \end{align*} \end{document}

E(A + B) represented the inhibitory rate of crocin combined with HT, EA and EB were inhibitory rates of crocin and HT alone, respectively (Li et al., 2013).

Soft agar colony formation assay

Anchorage-independent growth was evaluated through the soft agar growth assay. In 6-cm Petri dishes, MDA-MB-468 cells (1800 cell/dish) were seeded in the top layer containing 0.35% agar, DMEM, and 10% FBS in the absence and presence of different concentrations of crocin (1.5 and 3 mg/mL). The bottom layer contained 0.5% agar, DMEM, and 10% FBS. The Petri dishes were covered with 1.5 mL of covering medium (DMEM, 10% FBS with or without crocin) and were maintained overnight at 37°C. Then, these Petri dishes were incubated at 43°C for 2 h. This was continued for additional 16 days at 37°C. The colonies were stained with 1 mL of 0.005% Crystal Violet and counted under phase contrast microscopy with low magnification.

Lactate dehydrogenase leakage measurement

To evaluate cell death levels, supernatants were measured for lactate dehydrogenase (LDH) leakage. After HT, cells were treated with 1.5 and 3 mg/mL crocin for 24–48 h. The culture medium was aspirated and centrifuged at 2000 g for 10 min to obtain a cell-free supernatant. Percentage of LDH release was monitored with an LDH Leakage Detection Kit (Sigma).

Apoptosis analysis

Hoechst staining was used to determine the proapoptotic effect of crocin alone and in combination with HT. After 24 h, cells were spotted onto slides and examined by a fluorescence microscopy with DAPI filter (Abedini et al., 2004).

RNA isolation and real-time RT-PCR analysis

The cells were treated with the most effective dose of crocin (1.5 mg/mL) for 12–48 h. Total RNA was isolated using the GenMark Kit and the first-strand cDNA was synthesized according to the manufacturer's procedure of Thermo Scientific RevertAid First-Strand cDNA Synthesis Kit (Thermo, EU). Gene expression levels were determined by real-time RT-PCR by step one real-time PCR (Applied Biosystems) using SYBR Green Master Mix (Parstous). The forward and reverse PCR primers are listed in Table 1. To normalize relative levels of gene expression, β-actin was utilized as an internal reference control and the comparative threshold cycle (2^−ΔΔCT) method was applied to quantify the mRNA levels of interested genes (Hoshyar et al., 2015a).

Table 1.

Primer Sequences Were Used in qRT-PCR

Gene	Forward primer	Reverse primer
Hsp B1	5′-GTCAAGACCAAGGATGGCGT-3′	5′-AGGGAGGAGGAAACTTGGGT-3′
Hsp A4	5′-AGGAGGAAGAGAAGATGCAAGTG-3′	5′-TTCTCGATTGGCAGGTCCAC-3′
Hsp AA1	5′-AGGACAGACACAGGTGAAC-3′	5′-GCCTCATCATCGCTTACTTCT-3′
Bax	5′ TGGAGCTGCAGAGGATGATTG3′	5′GAAGTTGCCGTCAGAAAACATG3′
Bcl-2	5′CTGCACCTGACGCCCTTCACC3′	5′CACATGACCCCACCGAACTCAAAGA3′
β-actin	5′TGGCACCCAGCACAATGA3′	5′CTAAGTCATAGTCCGCCTAG3′

qRT-PCR, quantitative real-time polymerase chain reaction.

ELISA analysis

Cells were treated with crocin (1.5 mg/mL) for 24–72 h after HT. The cell supernatants were collected after 24, 48, and 72 h incubation and centrifuged at 3000 rpm for 20 min. Finally, the levels of Hsp70 and Hsp90 proteins in the cell culture supernatants were determined using the Sandwich Enzyme-Linked Immunosorbent Assay (ELISA) Kit (Chongqing Biospes Co., Ltd.).

Statistical analysis

Results are expressed as the mean ± SD of at least three independent experiments. Data were analyzed using one-way ANOVA and followed by Tukey's post hoc test to assess differences between experimental groups (PRISM 5.0; GraphPad Software, Inc.). Statistical significance was inferred at p < 0.05.

Results

Viability of MDA-MB-468 cells

HT significantly decreased proliferation of cancer cells in a time-dependent manner (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/dna). The treated MDA-MB-468 cells showed cell shrinkage, blebbing, pyknotic nuclei, and deformation of cell membrane in a time-dependent manner (Supplementary Fig. S2). Crocin (0–5 mg/mL) induced a significant decrease in proliferation of cancer cells (p < 0.001; Fig. 1A). Survival rate of treated cells with combination of crocin and HT was markedly inhibited in a dose- and time-dependent manner (p < 0.001; Fig. 1B). Cytotoxic data showed that combined use of crocin and HT had more inhibitory effects on cell growth than use of crocin alone. The synergistic index of combined treated cells was greater than 1.0 (q > 1.0), which indicated that there was a degree of synergism in the combined treatment. The IC₅₀ values of crocin alone and in combination with HT after 24, 48, and 72 h treatments are presented in Figure 1C. More importantly, the cytotoxic effect of crocin on cancerous cells is quite significant compared to normal cells and more concentration of crocin did not have an inhibitory effect on MCF-10A cell proliferation; however, the highest concentration of crocin (5 mg/mL) only decreased the viability of normal cells to 5–7% (Fig. 1D).

FIG. 1.

The effect of (A) crocin (0–5 mg/mL) and (B) with HT (43°C for 2 h) on MDA-MB-468 cell viability after 0–72 h. (C) The IC₅₀ values of crocin and in combination with HT on cells. (D) The effect of crocin (0–5 mg/mL) on MCF-10A cell viability after 0–72 h. The results are represented as the mean ± SD of triplicate (*p < 0.05, **p < 0.01, ***p < 0.001). HT, hyperthermia.

Colony formation of MDA-MB-468 cells

Treatment of MDA-MB-468 cells with crocin (1.5 and 3 mg/mL) combined with HT resulted in significant decreases (94% and 95%; p < 0.01) in the number of colonies when compared with the control nonheat cells, respectively (Table 2; Fig. 2).

FIG. 2.

Combination effects of crocin (0–3 mg/mL) and HT (43°C for 2 h) on colony formation of MDA-MB-468 cells in soft agar after 16 days.

Table 2.

Combination Effects of Crocin and HT on Colony Formation of MDA-MB-468 Cells

Treatment	Colonies/1800 cells
Non-HT
Crocin = 0	642
Crocin = 1.5 mg/mL	55^**
Crocin = 3 mg/mL	35^**
HT
Crocin = 0	298^**
Crocin = 1.5 mg/mL	34^**
Crocin = 3 mg/mL	30^**

The results are represented as the mean ± SD (^** p < 0.01).

HT, hyperthermia.

Apoptosis of MDA-MB-468 cells

Results of Hoechst staining indicated that HT increased the apoptotic impact of crocin in a dose-dependent manner (28.26% vs. 43.66% and 45.59% vs. 70.34% of apoptotic cells of total cells after 1.5 and 3 mg/mL crocin treatments, respectively). Percentage of LDH released in the treated cancer cells with crocin and HT significantly increased (67.5% at 48 h) over time compared with control nonheat cells (9% after 24 h incubation, Fig. 3).

FIG. 3.

Combination effects of crocin (0–3 mg/mL) and HT (43°C for 2 h) on percentage of LDH release from MDA-MB-468 cells after 24 and 48 h. The results are represented as the mean ± SD (*p < 0.05; ***p < 0.001). LDH, lactate dehydrogenase.

Expression of apoptosis-related genes

Quantitative real-time PCR results showed that HT significantly increased mRNA levels of Hsp27, Hsp70, and Hsp90 (1.8-, 2.5-, and 3.7-fold) than the levels in control nonheat cells, respectively. The most effective dose of crocin (1.5 mg/mL) reduced HT-induced HSPs expression in a time-dependent manner compared with control nonheat cells (p < 0.001; Fig. 4A–C). Additionally, data showed that combination of crocin and HT significantly increased (76.8%) the Bax/Bcl-2 ratio in comparison with crocin (Fig. 5).

FIG. 4.

Combination effects of crocin (1.5 mg/mL) and HT (43°C for 2 h) on mRNA expression of (A) Hsp27, (B) Hsp70, (C) Hsp90 after 12–48 h. Data represented relative gene expression (Target/β-actin) and mean ± SD of triplicate (*p < 0.05; ***p < 0.001).

FIG. 5.

Combination effects of crocin (1.5 mg/mL) and HT (43°C for 2 h) on Bax/Bcl-2 ratio in MDA-MB-468 cells. Data represented relative gene expression (Target/β-actin).

ELISA analysis

Cell culture supernatants assayed with sandwich ELISA for Hsp70 and Hsp90 proteins. Results were consistent with our quantitative real-time polymerase chain reaction (qRT-PCR) data. Hsp70 and Hsp90 proteins in supernatants of HT-treated cells increased more than 1.8-fold compared with control nonheat. Crocin (1.5 mg/mL) significantly decreased the level of these HSPs in a time-dependent manner in both heat and nonheat groups (p < 0.001; Fig. 6A, B).

FIG. 6.

Combination effects of crocin (1.5 mg/mL) and HT (43°C for 2 h) on (A) Hsp70 and (B) Hsp90 levels in the supernatant of MDA-MB-468 cells. Data represented mean ± SD of triplicate (*p < 0.05; **p < 0.01; ***p < 0.001).

Discussion

Breast cancer is the most common cancer among women with nearly 1.7 million new cases in 2012 worldwide (World Cancer Research Fund International, 2015). The prevalence of breast cancer is rising among Iranian women (Sepandi et al., 2014). Combined treatments have been examined in clinical trials to show benefits of adjuvant and neoadjuvant therapy for breast cancer. These strategies may greatly delay cancer growth and improve the patient's survival (Block et al., 2015; Vinay et al., 2015)

Crocin alone or combined with other botanical formulations exert an inhibitory effect on the proliferation of various cancer cells, including gastric, breast, prostate, etc. (Hoshyar et al., 2013; Festuccia et al., 2014; Bhandari, 2015). The main mechanisms underlying anticancer activities of crocin involve (1) interaction with DNA, histone H1, and H1-DNA complex (Ashrafi et al., 2005; Bathaie et al., 2007); (2) downregulation of catalytic subunit of human telomerase, hTERT (Noureini and Wink, 2012); and (3) cell cycle arrest and induced apoptosis (Hoshyar et al., 2013; Rezaee et al., 2013; Amin et al., 2015). Apoptosis is regulated by several mediator genes such as proapoptotic Bax and antiapoptotic Bcl2 and HSPs genes, which are important targets for cancer therapy (Sreedhar and Csermely, 2004).

On the other hand, several studies have demonstrated the antitumor property of HT on breast cancer (Iemwananonthachai et al., 2003; Oldenborg et al., 2016). HT is introduced as the fifth effective method of cancer therapy after surgery, chemo, radiation, and biological therapies (Liang et al., 2007).

To our knowledge, the cytotoxic effects of crocin in combination with HT have not been shown yet. In this study, we demonstrated that HT enhanced the antitumor effect of crocin through growth inhibition and apoptosis induction in breast cancer cells (MDA-Mb-468), whereas these changes were not observed in normal human breast epithelial cells (MCF10-A). Crocin induced morphological changes related to apoptosis such as blebbing and pyknotic nuclei in MDA-MB-468 cells, which is in agreement with other studies (Sun et al., 2011). It has been previously demonstrated that crocin suppressed the proliferation of cancer cells, while it did not have such cytotoxic effect on normal cells (Hoshyar et al., 2013). Figure 1A indicated that crocin markedly reduced MDA-MB-468 cell viability in a dose- and time-dependent manner (IC50 = 3, 2.5, and 2.1 mg/mL at 24, 48, and 72 h, respectively; Fig. 1C; p < 0.001). In this context, our data indicated that various concentrations of crocin did not inhibit the growth of normal cells (Fig. 1D). Besides that, crocin combined with HT significantly decreased the number of alive cancer cells (Fig. 1B) (IC50 = 2.5, 1.5, and 1 mg/mL at 24, 48, and 72 h, respectively; Fig. 1C; p < 0.001).

Crocin and its combination with HT notably decreased anchorage-independent growth of MDA-MB-468 cells with an inhibition rate of about 91–94% versus 94–95% by crocin alone 1.5 and 3 mg/mL, respectively (Fig. 2 and Table 2; p < 0.01). Abdullaev et al. (2003) previously showed the inhibitory effect of crocin on colony formation of cancer cells.

Several studies have proposed crocin as a proapoptotic component that induced changes in nuclear morphology (Bakshi et al., 2010; Li et al., 2013). We confirmed both these previous findings and found that crocin and HT induced apoptosis as determined by Hoechst staining of cancerous cells. These data indicated that HT enhanced crocin-induced apoptosis in a dose-dependent manner. Generally, the release of cytosolic LDH enzyme from damaged cells was increased. Our results showed that the percentage of LDH leakage in cancer cells after combined treatment of crocin and HT was significantly more than crocin alone (Fig. 3; p < 0.001).

HSPs are known as molecular chaperones that contribute to the folding of misfolded proteins. HSPs have cytoprotective effects that lead to cell survival under various stresses. They are related with key stress signaling and apoptotic molecules so that they inhibit apoptosis and promote cell survival, proliferation, or differentiation (Schwock et al., 2008). HT induces different changes in the cells; however, it is believed that protein denaturation and cell membrane injury are main effects of HT toxicity. The destabilized membrane may allow more drug uptake and chemosensitization. However, HT increases the expression of HSPs in cancer cells (Ahmed and Zaidi, 2013), and HSPs can repair denatured proteins and decrease hyperthermic apoptosis, developing thermotolerance of cells. Sekihara et al. (2013) showed that pifithrin increased sensitivity of prostate cancer cells to HT through inhibited Hsp70. Also, He et al. (2012) demonstrated that quercetin containing liposomes increased HT-induced apoptosis through downregulation of Hsp70 in colon cancer cells. Based on cell growth inhibitory activity (as shown in MTT results) and loss of membrane integrity (as shown in LDH release into the medium) of crocin and HT against MDA-MB-468 cells, we evaluated the effect of crocin on the expression of HSPs, which was significantly increased by HT. Our data showed that an effective dose of crocin (1.5 mg/mL) resulted in decreased levels of Hsp27, Hsp70, and Hsp90 mRNA (Fig. 4; p < 0.001) and supernatant Hsp70 and Hsp90 proteins (Fig. 6; p < 0.001). The levels of supernatant Hsp70 and Hsp90 were 0.75 ± 0.009 and 0.63 ± 0.03 nM in control cells, respectively. Crocin decreased the amount of these HSPs to 0.5 ± 0.02 and 0.4 ± 0.009 nM after 48 h treatment, respectively. Interestingly, both crocin and HT reduced the supernatant Hsp70 and Hsp90 in treated cancerous cells (from 1.87 ± 0.01 and 1.23 ± 0.01 to 1.31 ± 0.02 and 0.89 ± 0.01 at 48 h, respectively (p < 0.001).

The relative levels of Bcl-2 (antiapoptotic protein) and Bax (proapoptotic protein) modulate apoptosis in the cells. Liang et al. (2007) demonstrated that the HT downregulated the expression of Bcl-2 and upregulated the expression of Bax in colon cancer cell line. In addition, Hoshyar et al. (2013) revealed that crocin induced apoptosis in gastric cancer cells through high Bax/Bcl-2 ratio. Our data were not only in agreement with their results, but also illustrated that the combination of crocin and HT enhanced Bax/Bcl-2 mRNA ratio more than crocin in treated cells (Fig. 5).

Conclusion

In conclusion, we investigated the antitumor effects of crocin on HT-treated human breast cancer cells. Our findings suggested that HT may increase the uptake of crocin by breast cancer cells through altering membrane permeability. In addition, crocin increased the Bax/Bcl2 ratio and reduced the expression of antiapoptotic HSPs, which were induced by HT. Therefore, we found that crocin in combination with HT treatment effectively inhibited proliferation of human breast cancer. Future studies are needed to evaluate the molecular mechanisms of the anticancer effects of crocin alone or in combination with chemotherapy in both in vitro and in vivo mammary tumor models.

Footnotes

Acknowledgments

The authors would like to thank the personnel of Central Laboratory of Research and Technology at Birjand University of Medical Sciences. They would also like to thank Dr. Mohammad Reza Abedini (Birjand University of Medical Sciences, Birjand, Iran) for performing the Hoechst staining.

Disclosure Statement

No competing financial interests exist.

References

Abdullaev

, Riveron-Negrete

, Caballero-Ortega

, Hernández

J.M.

, Perez-Lopez

, Pereda-Miranda

, et al. (2003). Use of in vitro assays to assess the potential antigenotoxic and cytotoxic effects of saffron (Crocus sativus L.). Toxicol In Vitro, 17, 731–736.

Abedini

M.A.

, Qiu

, Yan

, and Tsang

B.K.

(2004). Possible role of FLICE-like inhibitory protein (FLIP) in chemoresistant ovarian cancer cells in vitro. Oncogene, 23, 6997–7004.

Ahmed

, and Zaidi

S.F.

(2013). Treating cancer with heat: hyperthermia as promising strategy to enhance apoptosis. J Pak Med Assoc, 63, 504–508.

Amin

, Bajbouj

, Koch

, Gandesiri

, and Schneider-Stock

(2015). Defective autophagosome formation in p53-null colorectal cancer reinforces crocin-induced apoptosis. Int J Mol Sci, 16, 1544–1561.

Amin

, Hamza

A.A.

, Daoud

, Khazanehdari

, Al Hrout

, Baig

, Chaiboonchoe

, Adrian

T.E.

, Zaki

, and Salehi-Ashtiani

(2016). Saffron-based crocin prevents early lesions of liver cancer: in vivo, in vitro & network analyses. Recent Pat Anticancer Drug Discov, 11, 121–133.

Ashrafi

, Bathaie

, Taghikhani

, and Moosavi-Movahedi

(2005). The effect of carotenoids obtained from saffron on histone H1 structure and H1–DNA interaction. Int J Biol Macromol, 36, 246–252.

Bakshi

, Sam

, Rozati

, Sultan

, Islam

, Rathore

, et al. (2010). DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by crocin from kashmiri saffron in a human pancreatic cancer cell line. Asian Pac J Cancer Prev, 11, 675–679.

Bathaie

S.Z.

, Bolhasani

, Hoshyar

, Ranjbar

, Sabouni

, and Moosavi-Movahedi

A.A.

(2007). Interaction of saffron carotenoids as anticancer compounds with ctDNA, Oligo (dG. dC) 15, and Oligo (dA. dT) 15. DNA Cell Biol, 26, 533–540.

Bathaie

S.Z.

, Hoshyar

, Miri

, and Sadeghizadeh

(2013). Anticancer effects of crocetin in both human adenocarcinoma gastric cancer cells and rat model of gastric cancer. Biochem Cell Biol, 91, 397–403.

10.

Bhandari

P.R.

(2015). Crocus sativus L. (saffron) for cancer chemoprevention: a mini review. J Tradit Complement Med, 5, 81–87.

11.

Block

K.I.

, Gyllenhaal

, Lowe

, Amedei

, Amin

A.R.

, et al. (2015). Designing a broad-spectrum integrative approach for cancer prevention and treatment. Semin Cancer Biol, 35, S276–S304.

12.

Bolhasani

, Bathaie

, Yavari

, Moosavi-Movahedi

, and Ghaffari

(2005). Separation and purification of some components of Iranian saffron. Asian J Chem, 17, 725–729.

13.

Festuccia

, Mancini

, Gravina

G.L.

, Scarsella

, Llorens

, Alonso

G.L.

, et al. (2014). Antitumor effects of saffron-derived carotenoids in prostate cancer cell models. Biomed Res Int, 2014, 135048.

14.

Gress

T.M.

, Müller-Pillasch

, Weber

, Lerch

M.M.

, Friess

, Büchler

, et al. (1994). Differential expression of heat shock proteins in pancreatic carcinoma. Cancer Res, 54, 547–551.

15.

, Wang

, Shi

H.S.

, Xiao

W.J.

, Zhang

, Mu

, et al. (2012). Quercetin liposome sensitizes colon carcinoma to thermotherapy and thermochemotherapy in mice models. Integr Cancer Ther, 12, 264–270.

16.

Hoshyar

, Bathaie

S.Z.

, and Sadeghizadeh

(2013). Crocin triggers the apoptosis through increasing the Bax/Bcl-2 ratio and caspase activation in human gastric adenocarcinoma, AGS, cells. DNA Cell Biol, 32, 50–57.

17.

Hoshyar

, Jamali

, Fereidouni

, and Abedini

M.R.

(2015a). The cytotoxic activity of Ziziphuse Jujube on cervical cancer cells: in vitro study. Cell Mol Biol, 61, 128–130.

18.

Hoshyar

, Mahboob

, and Zarban

(2015b). The antioxidant and chemical properties of Berberis vulgaris and its cytotoxic effect on human breast carcinoma cells. Cytotechnology [Epub ahead of print]; DOI: 10.1007/s10616-015-9880-y.

19.

C.M.J.

, Aryal

, Zhang

(2010). Nanoparticle-assisted combination therapies for effective cancer treatment. Ther Deliv, 1, 323–334.

20.

Iemwananonthachai

, Pattaranutaporn

, Chansilpa

, and Sukkasem

(2003). Hyperthermia in combination with radiation therapy for treatment of advanced inoperable breast cancer. J Med Assoc Thai, 86, 715–721.

21.

Jones

E.L.

, Oleson

J.R.

, Prosnitz

L.R.

, Samulski

T.V.

, Vujaskovic

, Yu

, et al. (2005). Randomized trial of hyperthermia and radiation for superficial tumors. J Clin Oncol, 23, 3079–3085.

22.

, Huang

, Jiang

, Gong

, Qian

, and Zou

(2013). Synergistic apoptotic effect of crocin and cisplatin on osteosarcoma cells via caspase induced apoptosis. Toxicol Lett, 221, 197–204.

23.

Liang

, Zhan

H.J.

, Wang

B.G.

, Pan

, and Hao

X.S.

(2007). Change in expression of apoptosis genes after hyperthermia, chemotherapy and radiotherapy in human colon cancer transplanted into nude mice. World J Gastroenterol, 13, 4365–4371.

24.

Noureini

S.K.

, and Wink

(2012). Antiproliferative effects of crocin in HepG2 cells by telomerase inhibition and hTERT down-regulation. Asian Pac J Cancer Prev, 13, 2305–2309.

25.

Oldenborg

, Valk

, van

O.R.

, Oei

, Venselaar

, Vörding

P.Z.

, Randen

, Crezee

, Tienhoven

, and Rasch

(2016). Rib fractures after reirradiation plus hyperthermia for recurrent breast cancer: predictive factors. Strahlenther Onkol [Epub ahead of print]; DOI: 10.1007/s00066-016-0946-3.

26.

Powers

M.V.

, Clarke

P.A.

, and Workman

(2008). Dual targeting of HSC70 and HSP72 inhibits HSP90 function and induces tumor-specific apoptosis. Cancer Cell, 14, 250–262.

27.

Rezaee

, Mahmoudi

, Abnous

, Zamani-Taghizadeh-Rabe

, Tabasi

, Hashemzaei

, et al. (2013). Cytotoxic effects of crocin on MOLT-4 human leukemia cells. J Complement Integr Med, 10, 105–112.

28.

Schwock

, Pham

N.A.

, Cao

M.P.

, and Hedley

D.W.

(2008). Efficacy of Hsp90 inhibition for induction of apoptosis and inhibition of growth in cervical carcinoma cells in vitro and in vivo. Cancer Chemother Pharmacol, 61, 669–681.

29.

Sekihara

, Harashima

, Tongu

, Tamaki

, Uchida

, Inomata

, et al. (2013). Pifithrin-μ, an inhibitor of heat-shock protein 70, can increase the antitumor effects of hyperthermia against human prostate cancer cells. PLoS One, 8, e78772.

30.

Sepandi

, Akrami

, Tabatabaee

, Rajaeefard

, Tahmasebi

, Angali

K.A.

, Rezaianzadeh

, and Talei

(2014). Breast cancer risk factors in women participating in a breast screening program: a study on 11,850 Iranian females. Asian Pac J Cancer Prev, 15, 8499–8502.

31.

Sreedhar

A.S.

, and Csermely

(2004). Heat shock proteins in the regulation of apoptosis: new strategies in tumor therapy: a comprehensive review. Pharmacol Ther, 101, 227–257.

32.

Sun

, Xu

, Ni

, Zhang

, Li

, Zhang

, et al. (2011). Crocin inhibits proliferation and nucleic acid synthesis and induces apoptosis in the human tongue squamous cell carcinoma cell line Tca8113. Asian Pac J Cancer Prev, 12, 2679–2683.

33.

Vinay

D.S.

, Ryan

E.P.

, Pawelec

, Talib

W.H.

, Stagg

, et al. (2015). Immune evasion in cancer: mechanistic basis and therapeutic strategies. Semin Cancer Biol, 35, S185–S198.

34.

Wang

, Dabrosin

, Yin

, Fuster

M. M.

, Arreola

, et al. (2015). Broad targeting of angiogenesis for cancer prevention and therapy. Semin Cancer Biol, 35, S224–S243.

35.

World Cancer Research Fund International (2015). Breast Cancer Statistics. Available at www.wcrf.org/int/cancer-facts-figures/data-specific-cancers/breast-cancer-statistics. Last accessed May 29, 2015 .

36.

, Wang

, Li

, Liu

, Dai

, Wu

, et al. (2014). Selective inhibition of breast cancer stem cells by gold nanorods mediated plasmonic hyperthermia. Biomaterials, 35, 4667–4677.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.04 MB

0.14 MB