A Ramie bZIP Transcription Factor BnbZIP2 Is Involved in Drought,Salt,and Heavy Metal Stress Response

Abstract

bZIP transcription factors play key roles in plant growth, development, and stress signaling. A bZIP gene BnbZIP2 (GenBank accession number: KP642148) was cloned from ramie. BnbZIP2 has a 1416 base pair open reading frame, encoding a 471 amino acid protein containing a characteristic bZIP domain and a leucine zipper. BnbZIP2 shares high sequence similarity with bZIP factors from other plants. The BnbZIP2 protein is localized to both nuclei and cytoplasm. Transcripts of BnbZIP2 were found in various tissues in ramie, with significantly higher levels in female and male flowers. Its expression was induced by drought, high salinity, and abscisic acid treatments. Analysis of the cis-elements in promoters of BnbZIP2 identified cis-acting elements involved in growth, developmental processes, and a variety of stress responses. Transgenic Arabidopsis plants’ overexpression of BnbZIP2 exhibited more sensitivity to drought and heavy metal Cd stress during seed germination, whereas more tolerance to high-salinity stress than the wild type during both seed germination and plant development. Thus, BnbZIP2 may act as a positive regulator in plants’ response to high-salinity stress and be an important candidate gene for molecular breeding of salt-tolerant plants.

Introduction

Plant growth, development, productivity, and quality are severely affected by adverse environment conditions, including salinity, drought, cold/heat, heavy metal, etc. The endogenous abscisic acid (ABA) plays a crucial role to activate plant responses to various abiotic stresses. ABA induces the expression of a number of genes involved in the adaptation of plant to stress conditions (Verslues and Zhu, 2005). One of the important cis-elements in the promoter of ABA-inducible genes is the ACGT-core motif containing a 8–10 base pair (bp) long sequence (PYACGTGGC), and was named ABA responsive element (ABRE) (Fujita et al., 2005). The ABRE-binding (AREB) proteins or ABRE-binding factors (ABFs) contain basic-domain leucine zipper (bZIP) structure (Choi et al., 2000). The bZIP family was found in all eukaryotes and is one of the largest families of transcription factors in the plant kingdom. The bZIP transcription factors play important regulatory roles in almost every aspect of a plant's life, such as growth, developmental process, metabolism regulation, and biotic and abiotic stress signaling (Jakoby et al., 2002; Muñiz García et al., 2012; Alves et al., 2013; Fukumoto et al., 2013; Yin et al., 2013).

The induction of ABA/stress-inducible genes can be directly correlated with the presence of stress-related cis-acting elements in the promoter region. As specific motifs, cis-elements in the promoter region mediate the expression of gene in response to various biotic and abiotic stresses. These cis-acting regulatory elements include ABA-responsive elements ABRE and MYB element (Tak and Mhatre, 2013), dehydration-responsive elements (DRE) (van den Dries et al., 2011), salt-responsive elements GT-1 cis-element (Tak and Mhatre, 2013), ethylene-responsive element ERE (Castrillón-Arbeláez et al., 2012), and so on, which are involved in the regulation of dehydration, drought, salt, and signaling responsive gene expression (Liu et al., 2012; Tak and Mhatre, 2013).

Although bZIP genes are strongly induced by biotic and abiotic stress conditions, they are differentially regulated by various stresses and have been suggested to play diverse roles in stress response. Expression of SlAREB1 is induced by drought and salinity. The SlAREB1 overexpressing transgenic tomato plants show increased tolerance to salt and water stress (Orellana et al., 2010). Expression of Poncirus trifoliate PtrABF gene is induced by dehydration, low temperature, and ABA. Overexpression of PtrABF gene in transgenic tobacco plants enhances tolerance to dehydration shock, long-term water stress, and low temperature treatment (Huang et al., 2010). OsABF1 expression in rice seedling shoots and roots is found to be induced by anoxia, salinity, drought, oxidative stress, cold, ABA, and D-allose treatment (Hossain et al., 2010; Fukumoto et al., 2013). OsABF1 mutants Osabf1-1 and Osabf1-2 are more susceptible to high salinity and dehydration than wild-type rice plants, and the upregulated expression of some ABA/stress-regulated genes in response to ABA treatment is suppressed in the Osabf1 mutants (Hossain et al., 2010). Overexpression of OsABF1 shows sensitivity to D-allose in rice and inhibits the shoot growth of rice (Fukumoto et al., 2013). Expression of ZmbZIP60 is strongly induced by a wide spectrum of stresses, including dehydration, high salinity, ABA, and tunicamycin treatments (Wang et al., 2012). Overexpression of maize ZmbZIP60 in wild-type Arabidopsis displays enhanced bolting trends when subjected to dithiothreitol stress, and affects the expression levels of several key genes in the floral transition control, but no morphological phenotypes in atbzip60 plants are observed under various stresses (Wang et al., 2012). Expression of Arabidopsis AtbZIP24 is specifically induced by salt and hyperosmotic stress, not by cold stress. Overexpression of AtbZIP24 is suppressed in the salt-tolerant close relative Lobularia maritima, indicating that the protein functions as a negative regulator in salt stress acclimation (Yang et al., 2009). Nonetheless, under nonstress growth conditions, transgenic Arabidopsis lines with decreased AtbZIP24 expression activate the expression of stress-inducible genes involved in cytoplasmic ion homeostasis and osmotic adjustment (Yang et al., 2009).

Despite a number of bZIP members have been identified and comprehensively studied in plants, such as Arabidopsis (Jakoby et al., 2002; Yang et al., 2009; Lee et al., 2010), rice (Chen et al., 2012; Fukumoto et al., 2013), maize (Wang et al., 2012), potato (Muñiz García et al., 2012), soybean (Liao et al., 2008a; 2008b), tomato (Hsieh et al., 2010; Orellana et al., 2010), Vitis vinifera (Tak and Mhatre, 2013), P. trifoliate (Huang et al., 2010), information concerning perennial herbaceous plants is limited. Ramie (Boehmeria nivea L.) is a perennial herbaceous plant of the Urticaceae family. It is widely cultivated in China, India, other Southeast Asian, and Pacific Rim countries. Ramie fiber is mainly used for textile materials due to its fine characteristics. In addition, ramie plants have been found to possess a certain degree of As, Cd, Pb, and Zn tolerance (Yang et al., 2010), as well as a certain extent of drought and salt tolerance (Huang et al., 2013, 2014). Thus, it can be a good candidate for both fiber production and phytoremediation of sites contaminated by multimetals (Yang et al., 2010; Zhou et al., 2010). bZIP genes are important regulators of many stress conditions, there is a need to further characterize such bZIP genes in other plant systems to gain a better understanding of stress resistance mechanisms. The present study reports the identification, expression profiles, subcellular localization, promoter analysis, and overexpression of a bZIP transcription factor BnbZIP2 from ramie.

Materials and Methods

Plant materials, growth conditions, and stress treatments

The commercial ramie cultivar Xiangzhu-3 was planted in previous autumn as rhizomes in the Yunyuan experimental field, Hunan Agricultural University, Changsha, China. After a dormancy of 4 months, these rhizomes started regrowth in early March of 2011. Different tissues used in the study were collected from 30-day-old plants. Samples were harvested from the following tissues: leaves, roots, stems, and shoot tips, then mixed as a material pool, immediately frozen in liquid N₂, and stored at −80°C for RNA extraction.

For tissue-specific assays, leaves, roots, stems, and shoot tips were individually collected, immediately frozen in liquid N₂, and kept at −80°C until use for RNA isolation. Male and female flowers (1–3 mm) were individually sampled in autumn when ramie plants blossom, immediately frozen in liquid N₂, and stored at −80°C until use for RNA extraction.

Thirty-day-old (about 10 cm tall) seedlings were treated with abiotic stress. Chemical treatments consisted of 20% polyethylene glycol (PEG) 6000, 250 mM NaCl, and 200 μM ABA. Seedlings in the fields were transferred to beakers containing fresh distilled water and kept for 10 days until fine roots were formed. These plants were divided into three groups. Each group had a similar distribution of plant types. For each group, 60 shoots were used. For drought, salt, and ABA treatment, 20% PEG 6000, 250 mM NaCl, and 200 μM ABA were added to the beakers and kept for 0, 2, 4, 6, and 8 h, then roots, leaves, stems, and shoot tips were individually sampled at different time points, immediately frozen in liquid N₂, and stored at −80°C until RNA extraction.

Identification and bioinformatics analysis of BnbZIP2

Total RNA was extracted from mixed tissues of ramie using pBIOZOL Plant Total RNA Extraction Reagent (pBIOZOL reagent; Bio Flux Company) following the manufacturer's instruction, then was digested with DNase I (Fermentas). The quality of the isolated RNA was checked on 0.8% agarose gel and visualized under UV transillumination while the quantity of RNA was measured using a spectrophotometer. The DNase-treated RNA was reverse transcribed into cDNA using the First-Strand cDNA Synthesis Kit (Fermentas) according to the manufacturer's protocol. The newly synthesized cDNA was used as template for PCR amplification, with specific forward primer (5′ACGCGTCGACATGCAATCGTCATCTTCCTCTTC3′) and reverse primer (5′GGGGTACCTCATTGGTCCTGCCTAGGCCT3′) designed to amplify full-length open reading frame (ORF) of BnbZIP2. Primers for full-length cDNA were designed manually based on Unigene21903 identified in ramie transcriptome, using Primer Premier 5 (www.PremierBiosoft.com) software, and synthesized commercially at Huada Gene Corporation, Shenzhen, China. The PCR thermal cycling conditions used were: 94°C for 2 min for initial denaturation followed by 32 cycles of amplification with each cycle consisting of the following steps: 94°C for 30 s, 61°C for 30 s, and 72°C for 1 min, followed by a final extension of 7 min at 72°C. Real time (RT)-PCR was performed in an ABI 7300 Real Time System (PE Applied Biosystems). The quality of PCR products was assessed by electrophoresis in 1.2% agarose gel, then was purified using the Agarose Gel Electrophoresis DNA Kit (BioTeke Corporation), and cloned into pMD19-T vectors (TaKaRa) to get a fusion construct (pMD19-BnbZIP2). This construct was transformed into Trans-T1 Phage Resistant Chemically Competent Cell (TransGen Biotech Company) and sequenced at Huada Gene Corporation.

The cDNA and protein sequences were analyzed using the BLASTn and BLASTp algorithm at NCBI database, respectively. Multiple alignments of the deduced amino acid sequence were performed using the ClustalW program. Theoretical isoelectric point (pI) and molecular weight were identified by tools in an internet server, ExPASy (Expert Protein Analysis System; www.expasy.org/tools). A phylogenetic relationship tree was constructed by the neighbor-joining (NJ) method using MEGA (version 4.0).

Expression profiles of BnbZIP2 under stress and nonstress conditions using RT-PCR analysis

Total RNA was isolated from different tissues grown under normal growth conditions and under drought, salinity, or ABA stress conditions. cDNA synthesis was performed using the same way as mentioned above. RT-PCR was performed to examine the tissue-specific expression of BnbZIP2 using forward primer 5′ TAAGCCAAATAGAGCCATTGACGG 3′ and reverse primer 5′ GATTATCAGCCTGTCTAACG-AAACC 3′. The ramie actin gene was amplified as an internal control with forward primer 5′ GCTCCGTTGAACCCTAAG 3′ and reverse primer 5′ GCTCCGATTGTGATGATTT 3′. RT-PCR was performed in an ABI 7300 Real-Time System (PE Applied Biosystems) according to the following parameters: 50°C for 2 min, 95°C for 10 min, 95°C for 30 s, 60°C for 60 s, and by 40 cycles. Each sample was amplified in three independent replicates. The PCR products were confirmed by sequencing of plasmid DNA constructs as described above. The relative expression levels were determined using the method of 2^−ΔCT (Tak and Mhatre, 2013).

Isolation of BnbZIP2 promoter

Genomic DNA was isolated from collected leaves using TransGen reagent (TransGen Biotech Company) following the instruction provided by the manufacturer. DNA quality was examined on 0.8% agarose gel for purity. Thermal asymmetric interlaced (Tail) PCR was performed according to the methods of Thanh et al. (2012), using the genomic DNA as template and specific degenerate primers in an ABI 7300 Real-Time System (PE Applied Biosystems). Tail-PCR primers were designed manually using Primer Premier 5 (www.PremierBiosoft.com) software, and synthesized commercially (Huada Gene Corporation). Initial Tail-PCR reactions were performed using ramie genomic DNA as template and the first pair of gene-specific primer as primers: AD: 5′ WGTGNAGWANCANAGA 3′ (W = A/T, N = A/C/G/T) and Tail 1: 5′ TTGGAGGCCTCATTCCAGAAG 3′. Tail-PCR conditions used were 94°C at 4 min, followed by 5 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min, followed by 1 cycle of 94°C for 30 s, 25°C for 3 min, 72°C for 2 min, followed by 13 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min, followed by 1 cycle of 94°C for 30 s, 46°C for 30 s, 72°C for 9 min. The second Tail-PCR was performed using the initial Tail-PCR products diluted 50 folds as template with the second primer pairs: AD: 5′ WGTGNAGWANCANAGA 3′ (W=A/T, N = A/C/G/T) and Tail 2: 5′ AGCTTGTTGGCCATCAAGGTATAG 3′. The third Tail-PCR performed using the second Tail-PCR products diluted 50 folds as template with the third primer pairs: AD: 5′ WGTGNAGWANCANAGA 3′ (W=A/T, N = A/C/G/T) and Tail 3: 5′ GGAAGAGGAAGATGACGATTGC 3′. Both the second and the third PCR conditions used were 94°C for 4 min, followed by 16 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 2 min, followed by 1 cycle of 94°C for 30 s, 46°C for 30 s, 72°C for 9 min. The quality of Tail-PCR products were checked by electrophoresis in 1.2% agarose gel after PCR amplification. Then the Tail-PCR products were purified using the Agarose Gel Electrophoresis DNA Kit (BioTeke Corporation) and cloned into the pMD19-T vectors (TaKaRa), and sequenced (HuadaGene). The analysis of putative cis-acting elements upstream to start codon of the BnbZIP2 cDNA was done using online available software PlantCare (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) and PLACE databases (www.dna.affrc.go.jp/PLACE/).

Subcellular localization of EGFP fusion proteins

For subcellular localization studies, the BnbZIP2 full-length cDNA clone was isolated by RT-PCR using total RNA extracts from drought-treated roots and shoot tips of ramie seedlings with the following primers (The underlined are restriction site): forward primer containing a sal I site 5′ acgcGTCGACATGCAATCGTCATCTTCCTCTTC 3′, reverse primer containing a Kpn I site 5′ ggGGTACCTTGGTCCTGCCTAGGCCTTG 3′. The pRI 101-EGFP vector contains the EGFP reporter gene (Enhanced Green Fluorescent Protein), constructed by MS Jinhua Zhou (Institute of Ramie, Hunan Agricultural University, Changsha, China). The PCR products were inserted into the sal I and Kpn I sites of the pRI 101-EGFP vector to produce a fusion construct (pRI 101-BnbZIP2-EGFP) under the control of the CaMV35S promoter. The pRI 101-BnbZIP2-EGFP was produced and sequenced (Huada Gene) to prove the presence of DNA insertion

The sequence-confirmed fusion construct (pRI 101-BnbZIP2-EGFP) and control vector (pRI 101-EGFP) were individually introduced into Agrobacterium tumefaciens strain EHA105 following the method of Li et al. (2009). Transformation of onion epidermal cells was done according to the method of Sun et al. (2007). The transformed onion epidermal cells were cultured on sterile Murashige and Skoog (MS) medium (Phyto Technology Laboratories Company) for 16 h with a 16-h light–8-h dark photoperiod at 25°C, then EGFP was detected using a universal fluorescence microscope (Olympus).

Transformation of Arabidopsis and overexpression of transgenic plants

Generation of transgenic Arabidopsis plants

The construction of the overexpression vector was the same as that of subcellular localization studies, except for the use of the pRI 101-AN vector (TaKaRa). After verification by sequencing, the overexpression vector (pRI 101-BnbZIP2) and control vector (pRI 101-AN vector) were individually ligated into A. tumefaciens strain EHA105 following the method of Li et al. (2009).

Seeds of Arabidopsis (provided by Dr. Ying Lu, Hunan Agricultural University, Changsha, China) were sterilized for 20 s in 70% (v/v) ethanol, followed by rinse with sterile distilled water four times. These seeds were planted in multiple containers filled with a 5:5:1 mixture of vermiculite, black soil, and perlite, and grown in a growth chamber with a 16-h light at 23°C–8-h dark photoperiod at 16°C and 75% relative humidity, watered with nutrition solution. Transgenic Arabidopsis plants were generated according to the A. tumefaciens floral dip method (Clough and Bent, 1998). T1 seeds of treated plants and seeds of control plants were individually harvested.

Selection for transgenic plants using kanamycin

T1 seeds of transgenic Arabidopsis and wild type were sterilized for 5 min in 75% (v/v) ethanol, and incubated in 0.1% (v/v) HgCl₂ for 5 min, followed by rinse with sterile distilled water five times. Afterward, the seeds were sown on MS agar plates. Kanamycin was used to screen for positive transgenic plants. Transgenic seeds were selected on selective MS medium (PhytoTechnology Laboratories Company) added with 30 μg/L kanamycin in a growth chamber with a 16-h light at 23°C–8-h dark photoperiod at 16°C. After selection for 14 days, the kanamycin-resistant shoots with green were transferred into the multiple containers, further screened for the transgene using PCR and specific primers. The seeds of these plants were collected and germinated to produce T2 seedlings.

Molecular analysis of the transgenic Arabidopsis plants

Genomic DNA was isolated from leaves of putative transgenic Arabidopsis lines and untransformed control Arabidopsis as described earlier. After examination on 0.8% agarose gel for purity, genomic DNA was used as template in the PCR reaction in an ABI 7300 Real-Time System (PE Applied Biosystems). Specific primers used for PCR amplification to CaMV35S, NOS, and BnbZIP2 were as follows: Arabidopsis-BnbZIP2 (forward primer: 5′ TAAGCCAAATAGAGCCATTGACGG 3′, reverse primer: 5′ AGCTTGTTGGCCATCAAGGTATAG 3′) and CaMV35S-BnbZIP2 (35S forward primer: 5′ GAAGGTGGCTCCTACAAATGC 3′, NOS reverse primer: 5′ CATCGCAAGACCGGCAAC 3′). The PCR conditions used were 94°C for 4 min, 94°C for 30 s, 60°C for 30 s, 72°C for 40 s by 32 cycles, and a final 7 min extension at 72°C. Each sample was amplified in three independent replicates. PCR products were analyzed on 1.2% (w/v) agarose gel and visualized under UV transillumination.

Germination test of the transgenic plants

For germination tests, T2 seeds of transgenic Arabidopsis and wild type were sterilized as mentioned above and germinated on plates containing MS medium (PhytoTechnology Laboratories Company). For drought stress evaluation, 0, 50, 100, 150, 200, or 250 mM Mannitol was added to the MS medium; for salt tolerance analysis, 0, 50, 100, 150, 200, or 250 mM NaCl was added to the MS medium; for heavy metal tolerance assay, 0, 50, 100, 150, 200, or 250 μM CdCl₂ was added to the MS medium. Next, the same number of the transgenic seeds and wild-type control were individually placed on the MS medium plates, kept in a plant growth chamber with a 16-h light at 23°C–8-h dark photoperiod at 16°C for 16 days. The number of germinated seeds was counted every 12 h until most of the seeds had germinated. When seedlings were grown for 16 days, the length of shoot and root was recorded. The drought, salt, and heavy metal tolerance experiments were repeated three times. The rate of seed germination was calculated as: germination rate = number of germinated seeds/total seeds × 100. The seedling length was calculated as: seedling length = shoot length + root length.

Statistical analysis

Drought, salt, and heavy metal treatment of the transgenic plants and wild type (WT) were repeated three times. The results are shown as mean ± SE. Data were processed by SPSS 16.0. Comparisons were tested after analysis of variance (one-way ANOVA) using Newman–Keuls test. Different letters indicate statistical difference at p < 0.05.

Results

BnbZIP2 contains a characteristic bZIP domain

The full-length cDNA of BnbZIP2 gene was isolated from ramie tissues by RT-PCR using the gene-specific primers. The GenBank accession number of BnbZIP2 gene is KP642148. Sequencing and bioinformatics analysis showed that the cDNA is 1587 bp in length, contains a 1416 bp ORF, encodes a predicted polypeptide of 471 amino acids with a predicted molecular weight of 52.19 kDa and a theoretical pI of 7.73. The putative BnbZIP2 showed 73% similarity with Nicotiana tabacum (GenBank: AAY15214), 60% similarity with Arabidopsis thaliana (GenBank: CAC40649), 74% similarity with V. vinifera (GenBank: XP_02275147), and 77% similarity with Ricinus communis (GenBank: XP_002532393) (Fig. 1). The BnbZIP2 protein contains a typical bZIP basic region domain (from position 183–200) and a leucine zipper containing three leucine repeats (at positions 206, 213, and 220) that were spaced from each other by seven amino acids.

FIG. 1.

Multiple alignments of the deduced amino acid sequence of BnbZIP2 and Ricinus communis (XP_002532393), Nicotiana tabacum (AAY15214), Vitis vinifera (XP_02275147), and Arabidopsis thaliana (CAC40649). Black shaded backgrounds indicated that the amino acids were identical or similar to BnbZIP2, respectively. The basic region and the three heptad leucine repeats are shown by double line and arrows, respectively.

To evaluate the divergence of BnbZIP2 from other bZIPs, a phylogenetic tree was constructed using DNAstar 5.0 with the known classified Arabidopsis bZIP transcription factors (Corrêa et al., 2008; Nijhawan et al., 2008). This analysis indicated that BnbZIP2 was most closely related to AtbZIP20 and AtbZIP45 that belong to Group D of the bZIP family in Arabidopsis (Fig. 2).

FIG. 2.

Phylogenetic tree of the bZIP subfamily members from Arabidopsis and ramie.

Subcellular localization of BnbZIP2

To determine the subcellular localization of the BnbZIP2 protein, the BnbZIP2 ORF was fused to EGFP in the pRI 101-EGFP vector. The fusion construct (pRI 101-BnbZIP2-EGFP) or the control (EGFP) was transiently expressed in onion epidermal cells through Agrobacterium infection. The EGFP fluorescence was observed in both nuclei and cytosol of pRI 101-BnbZIP2-EGFP-transformed onion epidermal cells (Fig. 3A, B), whereas in pRI 101-EGFP-transformed onion epidermal cells, the EGFP fluorescence was also seen throughout the whole cell (Fig. 3C, D), suggesting the protein is localized to nucleus and cytoplasm.

FIG. 3.

Nuclear localization of BnbZIP2 protein by EGFP fusion expression in onion epidermal cells through Agrobacterium infection. Fluorescence images (A, D) and bright-field images (B, C) of representative cells expressing EGFP (C, D) or BnbZIP2: EGFP fusion protein (A, B) are shown. Color images available online at www.liebertpub.com/dna

Expression of BnbZIP2 was detected under normal growth conditions and upregulated by drought, high salinity, and ABA treatment

Under normal growth conditions, the expression of BnbZIP2 was widely detected in different tissues like the root, leaf, stem, shoots tip, and female and male flower. The expression levels of BnbZIP2 greatly varied among tissues. The highest expression was observed in female flowers, which was more than 21 folds compared to that in root; followed by male flowers, which was more than 3 folds compared to that in root (Fig. 4A).

FIG. 4.

Expression profiles of the BnbZIP2 gene among ramie tissues under normal growth conditions (A) and in ramie root (B), shoot tip (D), and leaf (C) under different treatments with drought (20% PEG 6000), high salinity (250 mM), and ABA (200 μM). Expression of BnbZIP2 was measured in ramie tissues and detected by real-time PCR analysis. For each treatment, the expression level at time point 0 was defined as 1.0, and data presented as mean ± SE of three replicates. Different letters indicate significant differences at p < 0.05. ABA, abscisic acid; PEG, polyethylene glycol.

The expression pattern of the BnbZIP2 gene under various abiotic stresses was analyzed in root, shoot tip, and leaf tissues through RT-PCR (Fig. 4B–D). The transcription levels of BnbZIP2 in the roots was rapidly and strongly upregulated by ABA, high-salinity, and drought treatment (Fig. 4B). The expression of BnbZIP2 in the leaves was also noticeably enhanced in response to ABA, drought, and high-salinity treatment (Fig. 4C). The transcript levels of BnbZIP2 in the shoot tips significantly increased under high-salinity stress, whereas slightly changed under ABA and drought stress (Fig. 4D).

Putative cis-acting elements were found in the BnbZIP2 promoter

A 796 bp fragment upstream region of BnbZIP2 coding sequences was isolated using Tail-PCR and gene-specific primers from ramie genome sequence present in the public database NCBI. Computational analysis using PlantCare and PLACE databases revealed a number of putative cis-acting elements within the promoter region of BnbZIP2 (Fig. 5). Among them were three ATAT boxes at positions −499, −733, and −784 bp, four TATA boxes at positions −21, −535, −776, and −780 bp, whereas three CAAT boxes were located at positions −93, −109, and −607 bp. Other putative cis-acting elements were found within the promoter sequence, such as P-box at positions −366, −522, and −623, 5′-UTR Py-rich stretch at positions −276 and −469 bp, and TCA-element at position −391 bp (Fig. 5). The detailed function of putative cis-acting elements is in Table 1.

FIG. 5.

Nucleotide sequence of the BnbZIP2 promoter. Nucleotides were numbered on the left. The putative translation start sites, TATA box, CAAT box, and other important cis-regulatory elements are boxed and labeled. Color images available online at www.liebertpub.com/dna

Table 1.

Regulatory Elements Identified in the Promoter Regions of the Bnbzip2 Gene

Elements	Sequence	Function
MADS	TATA	MADS box protein that regulates many developmental processes, including flower, fruit, and root development.
OPAQ	ATAT	Opaque-2 like transcriptional activators. Cis-acting regulatory element involved in controlling the expression of distinct classes of endosperm genes.
SUC box	ATAT	Cis-acting regulatory element required for sugar-responsive gene expression.
MYB	ATAT	Cis-acting regulatory element involved in anthocyanin and flavonoid production, and in trichrome differentiation. These elements also regulate genes that are responsive to water stress, development, and seed germination.
CAAT box	CAAT	Cis-acting regulatory element generally exert a positive effect on transcription.
P-box	CCTTTTG, CAAAAGG	GA-responsive element.
5′-UTR Py-rich stretch motif	TCTCTCTCTCTCTCTC, TTTCTCTCTCTCTC	Cis-acting regulatory element involved in high transcription levels.
TCA-element	GAGAAGAAAA	A typical SA-responsive element.

The 5′ regulatory regions were analyzed using PlantCare and PLACE databases.

GA, gibberellins; SA, salicylic acid.

BnbZIP2 exhibits sensitivity to drought and metal stress, and tolerance to high-salinity stress

To examine the function of BnbZIP2 in plants, Agrobacterium-mediated transformation of transgenic Arabidopsis plants were generated using a binary vector containing BnbZIP2 under the control of CaMV 35S promoter. The kanamycin plate selection method was used to detect transformed progeny seedlings. Obvious differences in the phenotypes of the transgenic and WT seedlings were observed. The kanamycin-resistant transgenic plants were deep green and grew normally, whereas the kanamycin-sensitive wild seedlings exhibited a lack of greening, and the growth was inhibited (Supplementary Fig. S1; Supplementary Data are available online on www.liebertpub.com/dna). Presence of the transgene in the kanamycin-resistant seedlings was confirmed by PCR as described below.

To investigate the effects of the overexpression of BnbZIP2 on drought, salt, and heavy metal tolerance, seeds of the BnbZIP2-overexpressed plants (T2 progeny) and WT were subjected to germination tests. When exposed to 0 (CK), 50, 100, 150, 200, or 250 mM Mannitol, a continuous decline in seed germination in both the transgenic Arabidopsis and WT was observed with the increasing of Mannitol concentration (Fig. 6A). Although seed germination showed no difference between the WT and transgenic Arabidopsis under control (nonmannitol), it was significantly lower in the transgenic lines than in WT when subjected to the remaining five Mannitol levels (Fig. 6A). Similar trend was also observed when seeds of the BnbZIP2-overexpressed Arabidopsis (T2 progeny) and WT were grown on MS agar plate with 0 (CK), 50, 100, 150, 200, or 250 μM CdCl₂ (Fig. 6B). However, when subjected to 50, 100, 150, 200, or 250 mM NaCl, a considerable reduction in seed germination in the WT was observed at 50, 100, or 150 mM NaCl (Fig. 6C). When subjected to 200 mM NaCl, the WT did not germinate, whereas transgenic seed germination was 9.2%, respectively (Fig. 6C). When grown under 250 mM NaCl, neither the WT nor the transgenic seed germinated. With the increasing of NaCl levels, both the germination of the WT and transgenic seeds noticeably decreased, but the germination was always higher in the transgenic plants than in the WT (Fig. 6C).

FIG. 6.

Seed germination and seedling length of WT and 35S-BnbZIP2 were grown on MS agar plates containing 0, 50, 100, 150, 200, and 250 mM Mannitol (A, D) and NaCl (C, F), 0, 50, 100, 150, 200, and 250 μM CdCl₂ (B, E). Each value is the mean ± SE of three independent biological determinations and different letters indicate significant differences at p < 0.05. MS, Murashige and Skoog; WT, wild type.

With the increasing of Mannitol, CdCl₂, and NaCl levels, a continuous decrease in the length of seedlings was detected in both transgenic plants and wild type (Fig. 6D–F). There was no significant difference in the length of seedlings between transgenic plants and wild type under dehydration and heavy metal stress. Similar trend was also found when exposed to 50, 100, 150 mM NaCl, but the transgenic seeds could germinate and grow at 150 mM NaCl (Fig. 6C, F). Interestingly, both transgenic seedlings and wild type became yellow under CdCl₂ stress, whereas they were green under Mannitol or NaCl stress (Supplementary Fig. S2–S4). Shoots and roots appeared as same morphological phenotypes between transgenic plants and wild type under Mannitol, CdCl₂, or low NaCl stress (Supplementary Fig. S2–S4).

Discussion

In this study, ramie BnbZIP2 was isolated and characterized. The BnbZIP2 gene contains a characteristic bZIP basic region domain in its N-terminal end, which is a typical protein structure for the group member of bZIP family (Corrêa et al., 2008). Amino acid sequence alignment demonstrated that BnbZIP2 is similar to other bZIP proteins, including N. tabacum, A. thaliana, V. vinifera, and R. communis (Fig. 1). The phylogenetic analysis indicated that BnbZIP2 is closely related to AtbZIP20 and AtbZIP45, which are classified as Arabidopsis bZIP group D subfamily (Jakoby et al., 2002). These findings suggest the possibility of functional conservation among these transcription factors. Subcellular localization analysis revealed that the protein was localized to both nuclei and cytoplasm, which is in agreement with that reported on bZIP transcription factor SmJLB1 (Voigt et al., 2013).

The expression of BnbZIP2 was widely detected in ramie tissues, with remarkably higher levels in flowers than in other tissues. The expression was more than sevenfold in female flowers in comparison with that in male flowers, suggesting that BnbZIP2 gene may participate in plant growth, flower development, or sexual development. Consistent with this, four TATA boxes that regulate many developmental processes, including flower, fruit, and root development (Castrillón-Arbeláez et al., 2012) were predicted in the promoter sequence of BnbZIP2 gene (Fig. 5). This is also supported by the existence of three P-boxes for gibberellin (GA)-responsive elements (Li et al., 2012). It is well known that the plant hormone GA regulates major aspects of plant growth and development. In addition, BnbZIP2 is strongly induced by drought and ABA, which is recognized by the presence of MYB cis-element (ATAT) for drought and ABA responsiveness (Fig. 5) (Abe et al., 2003; Castrillón-Arbeláez et al., 2012; Tak and Mhatre, 2013). ATAT element also acts as Opaque-2-like transcriptional activators that are involved in controlling the expression of distinct classes of endosperm genes, and SUC box that is required for sugar responsive gene. ATAT box is essential for anthocyanin and flavonoid production, and trichrome differentiation. It also regulates genes that are responsive to development and seed germination (Castrillón-Arbeláez et al., 2012).

Moreover, a typical salicylic acid (SA)-responsive element (TCA-element) (Pandey et al., 2012) was found in the promoter sequence of BnbZIP2 gene. SA-mediated signaling pathways are in response to various biotropic agents and leads to the establishment of systemic acquired resistance (Shah, 2003). When suffered from pathogen attack, SA induces the expression of pathogenesis-related genes throughout the plant (Jakoby et al., 2002). Furthermore, the promoter fragment harbors three CAAT boxes that generally exert a positive effect on transcription, and two 5′-UTR Py-rich stretch motifs that confer high transcription levels (Pandey et al., 2012). Whereas, analysis of the cis-elements in the promoter region of BnbZIP2 identified no salt stress cis-element, which showed that it needed other elements to respond to salt inducement. All of the above showed that BnbZIP2 gene was involved in plant development and biotic and abiotic stress responses. The Arabidopsis bZIP Group D, consisting of 10 bZIP members, plays important roles in plant defense against pathogens and development. Among them, two members are involved in developmental processes, and one of them, AtbZIP46/Perianthia, controls floral organ number in Arabidopsis (Chuang et al., 1999). Thus, BnbZIP2 may function in the same way as members of Arabidopsis bZIP Group D.

bZIP transcription factors play important regulatory roles in plant growth, development, and responses to abiotic and biotic stresses. Some of them, such as ABF2, AREB1, VvbZIP23, and PtrABF, etc., act as a positive regulator (Kim et al., 2004; Fujita et al., 2005; Huang et al., 2010; Tak and Mhatre, 2013), whereas others, including OsbZIP52/RISBZ5, OsbZIP79, and Foatf1, etc. function as a negative regulator (Liu et al., 2012; Qi et al., 2013; Miyamoto et al., 2015). In this study, overexpression of BnbZIP2 suppressed seed germination of transgenic Arabidopsis plants, whereas there was no evident morphological difference between the transgenic and WT lines in terms of their seedling length and plant development at various levels of Mannitol or CdCl₂, indicated that overexpression of BnbZIP2 just affected seed germination, but did not affected the growing of plants under Mannitol or CdCl₂ stress condition (Supplementary Figs. S2 and S3).

On the other hand, overexpression of BnbZIP2 improved seed germination and development of transgenic Arabidopsis plants under high-salinity stress (Supplementary Fig. S4). The BnbZIP2 overexpression lines displayed altered stress response. They exhibited increased sensitivity to dehydration and Cd stress, whereas enhanced tolerance to high salinity. These results suggested that BnbZIP2 plays a positive regulatory role in plants response to high-salinity stress, whereas a negative regulatory role in plants response to drought and heavy metal Cd stress. Such results are also found in other bZIP transcription factors. The Arabidopsis ABF3 and ABF4 transgenic plants exhibit salt hypersensitivity, but drought tolerance (Kang et al., 2002). The Arabidopsis DREB2C overexpression plants are dehydration sensitive, whereas freezing and heat tolerant (Lee et al., 2010). Transgenic rice plants overexpressing OsbZIP16 has stronger resistance to drought, but more sensitive to ABA than wild type plants (Chen et al., 2012). Transgenic Arabidopsis plants overexpressing GmbZIP132 reduce ABA sensitivity, increase water loss rate, whereas enhance tolerance to salt treatment during germination (Liao et al., 2008). These findings suggest that members of the bZIP family regulate complex transcriptional networks in mediating plant abiotic stresses.

In fact, negative regulators of abiotic stress are relatively rare. As a negative regulator of drought and heavy metal Cd stress, BnbZIP2 might have a value for research in the abiotic stress pathways. On the other hand, most bZIP genes are induced by salt stress, but only a few bZIP genes such as Arabidopsis ABF2, rice OsbZIP23, soybean GmbZIP44, GmbZIP62, GmbZIP78, GmbZIP132, and tomato SlAREB have been reported to positively regulate salt stress tolerance (Kim et al., 2004; Liao et al., 2008a, 2008b; Xiang et al., 2008; Hsieh et al., 2010; Orellana et al., 2010). Soil salinity severely affects plant growth and agricultural productivity. As a positive regulator of high-salinity stress, BnbZIP2 may be involved in the physiological pathways that aid ramie in adapting to salt-affected soil. This meets the essential condition for utilization in salinity-prone environments. Thus, BnbZIP2 has high potential usefulness in genetic improvement of salt stress tolerance.

Conclusion

This study showed that ramie BnbZIP2 gene belongs to a group of bZIP transcription factors. Expression of BnbZIP2 is induced by drought, high salinity, and ABA. Analysis of the cis-elements in promoters of BnbZIP2 identified cis-acting elements involved in growth, developmental processes, and a variety of stress responses. Overexpression of BnbZIP2 in Arabidopsis displayed complex expression patterns involved in plant abiotic stresses. Nonetheless, BnbZIP2 acts as a positive regulator in plants response to high-salinity stress and may be an important candidate gene for molecular breeding of salt-tolerant plants.

Footnotes

Acknowledgments

This research was supported by the project of National Natural Science Fund (31 371 704), the National “Twelfth 5-Year” Scientific and Technological Support project (2012BAD20B05-04), and Scientific and Technological project of Hunan (2010TP4004-1, 2010FJ2013, and 2012FJ4063).

Disclosure Statement

No competing financial interests exist.

References

Abe

, Urao.

, Ito

, Seki

, Shinozaki

, and Yamaguchi-Shinozaki

(2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell, 15, 63–78.

Alves

M.S.

, Dadalto

S.P.

, Gonçalves

A.B.

, De Souza

G.B.

, Barros

V.A.

, and Fietto

L.G.

(2013). Plant bZIP transcription factors responsive to pathogens: a review. Int J Mol Sci, 14, 7815–7828.

Castrillón-Arbeláez

P.A.

, Martínez-Gallardo

, Arnaut

H.A.

, Tiessen

, and Délano-Frier

J.P.

(2012). Metabolic and enzymatic changes associated with carbon mobilization, utilization and replenishment triggered in grain amaranth (Amaranthus cruentus) in response to partial defoliation by mechanical injury or insect herbivory. BMC Plant Biol, 12, 163.

Chen

, Chen

, Zhou

J.L.

, He

, Chen

L.B.

, Chen

H.D.

, and Deng

X.W.

(2012). Basic leucine zipper transcription factor OsbZIP16 positively regulates drought resistance in rice. Plant Sci, 193–194, 8–17.

Choi

, Hong

, Ha

, Kang

, and Kim

S.Y.

(2000). ABFs, a family of ABA-responsive element binding factors. J Biol Chem, 275, 1723–1730.

Chuang

C.F.

, Running

M.P.

, Williams

R.W.

, and Meyerowitz

E.M.

(1999). The PERIANTHIA gene encodes a bZIP protein involved in the determination of floral organ number in Arabidopsis thaliana . Genes Dev, 13, 334–344.

Clough

S.J.

, and Bent

A.F.

(1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana . Plant J, 16, 735–743.

Corrêa

L.G.G.

, Riaño-Pachón

D.M.

, Schrago

C.G.

, Vicentini dos Santos

, Mueller-Roeber

, and Vincentz

(2008). The role of bZIP transcription factors in green plant evolution: adaptive features emerging from four founder genes. PLoS One 3, e2944.

Fujita

, Fujita

, Satoh

, Maruyama

, Parvez

M.M.

, Seki

, Hiratsu

, Ohme-Takagi

, Shinozaki

, and Yamaguchi-Shinozaki

(2005). AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis . Plant Cell, 17, 3470–3488.

10.

Fukumoto

, Kano

, Ohtani

, Inoue

, Yoshihara

, Izumori

, Tajima

, Shigematsu

, Tanaka

, Ohkouchi

, Tada

, Ichimura

, Gomi

, and Akimitsu

(2013). Phosphorylation of D-allose by hexokinase involved in regulation of OsABF1 expression for growth inhibition in Oryza sativa L. Planta, 237, 1379–1391.

11.

Hossain

M.A.

, Lee

, Cho

J.I.

, Ahn

C.H.

, Lee

S.K.

, Jeon

J.S.

, Kang

, Lee

C.H.

, An

, and Park

P.B.

(2010). The bZIP transcription factor OsABF1 is an ABA responsive element binding factor that enhances abiotic stress signaling in rice. Plant Mol Biol, 72, 557–566.

12.

Hsieh

T.H.

, Li

C.W.

, Su

R.C.

, Cheng

C.P.

, Sanjaya Tsai

Y.C.

, and Chan

M.T.

(2010). A tomato bZIP transcription factor, SlAREB, is involved in water deficit and salt stress response. Planta, 231, 1459–1473.

13.

Huang

C.J.

, Zhao

S.Y.

, Wang

L.C.

, Anjum

S.A.

, Zhang

, Chen

, Wang

, and Yang

(2013). Alteration in yield, gas exchange and chlorophyll synthesis of ramie to progressive drought stress. J Food Agri Environ, 11, 302–305.

14.

Huang

C.J.

, Wei

, Jie

Y.C.

, Wang

L.C.

, Zhou

H.F.

, Ran

C.Y.

, Huang

Z.C.

, Jia

H.J.

, and Anjum

S.A.

(2014). Effects of concentrations of sodium chloride on photosynthesis, antioxidative enzymes, growth and fiber yield of hybrid ramie. Plant Physiol Biochem, 76, 86–93.

15.

Huang

X.S.

, Liu

J.H.

, and Chen

X.J.

(2010). Overexpression of PtrABF gene, a bZIP transcription factor isolated from Ponciru strifoliata, enhances dehydration and drought tolerance in tobacco via scavenging ROS and modulating expression of stress-responsive genes. BMC Plant Biol, 10, 230.

16.

Jakoby

, et al. (2002). bZIP transcription factors in Arabidopsis . Trends Plant Sci, 7, 106–111.

17.

Kang

J.Y.

, Choi

H.I.

, Im

M.Y.

, and Kim

S.Y.

(2002) Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell, 14, 343–357.

18.

Kim

, Kang

J.Y.

, Cho

D.I.

, Park

J.H.

, and Kim

S.Y.

(2004). ABF2 an ABRE-binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance. Plant J, 40, 75–87.

19.

Lee

S.J.

, Kang

J.Y.

, Park

H.J.

, Kim

M.D.

, Bae

M.S.

, Choi

H.I.

, and Kim

S.Y.

(2010). DREB2C interacts with ABF2 a bZIP protein regulating abscisic acid-responsive gene expression, and its overexpression affects abscisic acid sensitivity. Plant Physiol, 153, 716–727.

20.

, Park

, Von Arnim

, and Nebenführ

(2009). The FAST technique: a simplified Agrobacterium-based transformation method for transient gene expression analysis in seedlings of Arabidopsis and other plant species. Plant Methods, 20, 5–6.

21.

, Sun

, Yang

Q.C.

, Kang

J.M.

, Zhang

T.J.

, Gruber

M.Y.

, and Fang

(2012). Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP . Mol Biol Rep, 39, 8559–8569.

22.

Liao

, Zhang

J.S.

, Chen

S.Y.

, and Zhang

W.K.

(2008a). Role of soybean GmbZIP132 under abscisic acid and salt stresses. J Integr Plant Biol, 50, 221–230.

23.

Liao

, Zou

H.F.

, Wei

, Hao

Y.J.

, Tian

A.G.

, Huang

, Liu

Y.F.

, Zhang

J.S.

, Chen

S.Y.

, and (2008b). Soybean GmbZIP44, GmbZIP62 and GmbZIP78 genes function as negative regulator of ABA signaling and confer salt and freezing tolerance in transgenic Arabidopsis . Planta, 228, 225–240.

24.

Liu

C.T.

, Wu

Y.B.

, and Wang

X.P.

(2012). bZIP transcription factor OsbZIP52/RISBZ5 a potential negative regulator of cold and drought stress response in rice. Planta, 235, 1157–1169.

25.

Miyamoto

, Nishizawa

, Minami

, Nojiri

, Yamanea

, and Okadab

(2015). Overexpression of the bZIP transcription factor OsbZIP79 suppresses the production of diterpenoid phytoalexin in rice cells. J Plant Physiol, 173, 19–27.

26.

Muñiz García

M.N.

, Giammaria

, Grandellis

, Téllez-Iñón

M.T.

, Ulloa

R.M.

, and Capiati

D.A.

(2012). Characterization of StABF1 a stress-responsive bZIP transcription factor from Solanum tuberosum L. that is phosphorylated by StCDPK2 in vitro. Planta, 235, 761–778.

27.

Orellana

, Yañez

, Espinoza

, Verdugo

, González

, Ruiz-Lara

, and Casaretto

J.A.

(2010). The transcription factor SlAREB1 confers drought, salt stress tolerance and regulates biotic and abiotic stress-related genes in tomato. Plant Cell Environ, 33, 2191–2208.

28.

Pandey

, Sharma

, Pandey

D.M.

, Varshney

, Sheoran

, Singh

, Sharma

, and Chatrath

(2012). Comprehensive computational analysis of different classes of Glutathione S-transferases in Triticum aestivum L. POJ, 5, 518–531.

29.

Tak

, and Mhatre

(2013). Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera . Protoplasma, 250, 333–334.

30.

Thanh

, Chi

V.T.Q.

, Abdullah

M.P.

, Omar

, and Napis

(2012). Efficiency of ligation-mediated PCR and TAIL-PCR methods for isolation of RbcS promoter sequences from green microalga Ankistrodesmus convolutes . Mol Biol, 46, 58–64.

31.

X.Z.

, Guo

L.J.

, Yang

L.Y.

, and Huang

J.S.

(2013). Foatf1 a bZIP transcription factor of Fusarium oxysporum f. sp. cubense, is involved in pathogenesis by regulating the oxidative stress responses of Cavendish banana (Musa spp.). Physiol Mol Plant Pathol, 84, 76–85.

32.

Shah

(2003). The salicylic acid loop in plant defense. Curr Opin Plant Biol, 6, 365–371.

33.

Sun

, Cao

Z.Y.

, Li

, Zhao

Y.X.

, and Zhang

(2007). A simple and effective method for protein subcellular localization using Agrobacterium-mediated transformation of onion epidermal cells. Biologia, 62, 529–532.

34.

van den Dries

, Facchinelli

, Giarola

, Phillips

J.R.

, and Bartels

(2011). Comparative analysis of LEA-like 11–24 gene expression and regulation in related plant species within the Linderniaceae that differ in desiccation tolerance. New Phytol, 190, 75–88.

35.

Verslues

P.E.

, and Zhu

J.K.

(2005). Before and beyond ABA: upstream sensing and internal signals that determine ABA accumulation and response under abiotic stress. Biochem Soc Trans, 33, 375–379.

36.

Voigt

, Herzog

, Jakobshagen

, Pöggeler

(2013). bZIP transcription factor SmJLB1 regulates autophagy-related genes Smatg8 and Smatg4 and is required for fruiting-body development and vegetative growth in Sordaria macrospore. Fungal Genet Biol, 61, 50–60.

37.

Wang

, Zheng

, Liu

Y.J.

, Wang

J.H.

, and Wang

G.Y.

(2012). Cloning and characterization of the stress-induced bZIP gene ZmbZIP60 from maize. Mol Biol Rep, 39, 6319–6327.

38.

Xiang

, Tang

, Du

, Ye

, and Xiong

(2008). Characterization of OsbZIP23 as a key player of basic leucine zipper transcription factor family for conferring abscisic acid sensitivity and salinity and drought tolerance in rice. Plant Physiol, 148, 1938–1952.

39.

Yang

, Zhou

, Shu

W.S.

, Lan

C.Y.

, Ye

Z.H.

, Qiu

R.L.

, Jie

Y.C.

, Cui

G.X.

, and Wong

M.H.

(2010). Constitutional tolerance to heavy metals of a fiber crop, ramie (Boehmeria nivea), and its potential usage. Environ Pollut, 158, 551–558.

40.

Yang

, Popova

V.O.

, Süthoff

, Lüking

, Dietz

K.J.

, and Golldack

(2009). The Arabidopsis basic leucine zipper transcription factor AtbZIP24 regulates complex transcriptional networks involved in abiotic stress resistance. Gene, 436, 45–55.

41.

Yin

W.B.

, Reinke

A.W.

, Szilagyi

, Emri

, Chiang

Y.M.

, Keating

A.E.

, Pócsi

, Wang

C.C.C.

, and Keller

N.P.

(2013). bZIP transcription factors affecting secondary metabolism, sexual development and stress responses in Aspergillus nidulans . Microbiology, 159, 77–88.

42.

Zhou

J.H.

, Yang

Q.W.

, Lan

C.Y.

, and Ye

Z.H.

(2010). Heavy metal uptake and extraction potential of two Bechmeria nivea (L.) Gaud. (ramie) varieties associated with chemical reagents. Water Air Soil Pollut, 211, 359–366.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.08 MB

0.17 MB

0.08 MB

0.31 MB