Association of Foxp3 and TGF-β1 Polymorphisms with Pre-Eclampsia Risk in Chinese Women

Abstract

Purpose:

The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) in the genes that encode forkhead box p3 (Foxp3) (rs3761549 C>T, rs2280883T>C, rs2232365 A>G and rs3761548 C>A) and transforming growth factor (TGF)-β1 (rs11466359 C>T, rs11466345 A>G and rs1800469 T>C) are associated with pre-eclampsia (PE) risk in Chinese women.

Materials and Methods:

SNPs were identified by polymerase chain reaction and ligase detection reaction. Allelic variant and genotype frequencies for Foxp3 and TGF-β1 were compared between PE women (n = 203) and healthy pregnant (HP) controls (n = 243).

Results:

The TGF-β1 rs1800469 TT genotype was found more frequently in PE patients than in HP controls [CC vs. CT+TT: odds ratio (OR) = 1.71; 95% confidence interval (CI): 1.04-2.81; p = 0.033], indicating that the T allele of rs1800469 confers a risk for PE [OR = 1.46; 95% CI: 1.12-1.92; p = 0.006]. The Foxp3 rs2232365 A allele was associated with severe PE specifically [OR = 1.70; 95% CI: 1.12-2.58; p = 0.01], compared with mild PE. There were no haplotype associations with PE.

Conclusions:

These findings indicate that allelic variants of TGF-β1 rs1800469 T influence PE risk in Chinese women. Pregnant Han Chinese women carrying the rs1800469 TT genotype were at increased risk of PE.

Introduction

Pre-eclampsia (PE) is a severe complication of pregnancy characterized by hypertension and proteinuria with an estimated worldwide incidence of 4.6% of pregnancies (Abalos et al., 2013). It is associated with increased risks of maternal and perinatal morbidity and mortality (Abalos et al., 2013). Despite extensive research, the etiology and pathogenesis of PE are not completely understood. The current consensus view of the National Institute of Child Health and Human Development of the US National Institutes of Health is that PE is a multifactorial disease whose pathogenesis cannot be attributed solely to a vascular, genetic, immunological, or environmental cause, but rather was the product of a complex combination of factors (Ilekis et al., 2007). In PE, excessive peripheral blood leukocyte activation is associated with exaggerated innate and adaptive immune responses that may interfere with pregnancy progression (Lok et al., 2009).

Being a specialized T cell subpopulation with a unique ability to suppress inflammatory responses, CD4⁺CD25⁺ regulatory T cells (Tregs) play important roles in quelling autoimmune morbidity and preventing graft rejection (Sakaguchi et al., 1995). Likewise, Tregs have been shown to be critical for preventing maternal T cell activation against fetal cells in both mice and humans (Aluvihare et al., 2004; Heikkinen et al., 2004; Xiong et al., 2013). Maternal Treg insufficiency may leave the fetus at risk of maternal immunological intolerance and has been associated with obstetrical complications, including PE, preterm labor, and miscarriage (Zenclussen et al., 2005; Darmochwal-Kolarz et al., 2007; Sasaki et al., 2007; Xiong et al., 2010; Nakashima et al., 2012; Koucky et al., 2014). The maintenance of immune tolerance has been related to forkhead box p3 (Foxp3)-expressing Tregs that secrete interleukin (IL)-10) and transforming growth factor (TGF)-β1 (Dekker et al., 2011). Interestingly, a study of sibling pairs suggested that genetic factors account for more than half of PE risk, with maternal genes having a stronger association than fetal genes (Bernard and Giguere, 2003).

The genetic determinants of PE susceptibility are not well established (Sakaguchi et al., 2006), due in part to the complexity of the molecular processes underlying PE pathogenesis and the possible involvement of fetal, maternal, and paternal influences (Cnattingius et al., 2004).

Previously, several Foxp3 single nucleotide polymorphisms (SNPs), namely rs2232365, rs3761548, rs5902434, and rs2294021 have been associated with idiopathic recurrent miscarriage (Saxena et al., 2015). A study of the women of mulatto in the northeast of Brazil found that PE was associated with TGF-β1 SNPs (+869 T > C and +915 G>C), although neither SNP alone had an independent significant association with PE risk in this population (de Lima et al., 2009).

We hypothesize that Foxp3 and TGF-β1 SNPs may be related to the development of PE. To examine this hypothesis, we evaluated whether pregnant women in China with any of Foxp3 (rs3761549, rs2280883, rs2232365, and rs3761548) or TGF-β1 (rs11466359, rs11466345, and rs1800469) SNP alleles were at elevated risk of PE. Multiplex polymerase chain reaction (PCR) and ligase detection reaction (LDR) methods were used to identify potential interactions between variants found to be related to PE susceptibility.

Materials and Methods

Study patients

Foxp3 and TGF-β1 SNPs were analyzed in 203 PE patients and 243 healthy pregnant (HP) controls. All participants were recruited between July 2016 and March 2017 from the Shenzhen Maternal and Child Health Care Hospital affiliated with Southern Medical University and Shenzhen Longhua District Central Hospital of Obstetrics and Gynecology in China. The ethics committee of the hospital approved the study protocol, and all participants provided written informed consent before study enrollment. All participants were of Han ethnicity.

Exclusion criteria were multifetal gestation, essential hypertension, diabetes, autoimmune or vascular disease, kidney disease, confirmed infection with HIV, syphilis, or hepatitis B/C, and signs of any active infection (i.e., fever). None of the pregnant women were in labor, and none had ruptured amniotic membranes. Clinical diagnosis of PE was based on the development of hypertension [blood pressure (BP) ≥140/90 mmHg] and proteinuria (≥300 mg/24 h) in the 20th week of pregnancy (postlast menstrual period) or later. PE was regarded as severe if any of the following criteria were met: BP ≥160 mmHg systolic or ≥110 mmHg diastolic, or proteinuria ≥5 g/24 h (or ≥3+on the dipstick) (2000).

PE patients were divided into the following: mild PE (n = 72) and severe PE (n = 131); primiparas (n = 121, women who had only conceived once) and multiparas (n = 82, women who had conceived more than once). The clinical characteristics of the PE patients and HP controls are summarized in Table 1. The clinical characteristics of the severe PE patients and mild PE controls are summarized in Table 2.

Table 1.

Clinical Characteristics of Normal Pregnant Women and Pre-Eclamptic Patients

Characteristics	Pre-eclamptic patients (n = 203)	Normal pregnant women (n = 243)	Statics, p
Maternal age at delivery (years)	31.77 ± 0.35	29.56 ± 0.30	<0.0001^*
BMI at blood draw (kg/m²)	27.93 ± 0.19	25.49 ± 0.15	<0.0001^*
Gestational age at delivery (weeks)	36.20 ± 0.23	39.20 ± 0.08	<0.0001^*
Systolic BP (mmHg)	157.2 ± 1.21	116.5 ± 0.56	<0.0001^*
Diastolic BP (mmHg)	98.82 ± 0.71	76.21 ± 0.36	<0.0001^*
Fetal birth weight (g)	2694 ± 52.58	3317 ± 22.61	<0.0001^*
Primiparous	121 (59.6%)	144 (59.3%)	>0.05
Proteinuria (mg/24 h)	1333.42 ± 2123.69	<300	>0.05

Data are presented as the mean ± standard deviation for continuous variables and as number (percentage) for categorical variables. ^*p-values <0.05 are significant.

BMI, body mass index; BP, blood pressure.

Table 2.

Clinical Characteristics of Mild Pre-Eclampsia and Severe Pre-Eclamptic Patients

Characteristics	Mild PE (n = 72)	Severe PE (n = 131)	Statics, p
Maternal age at delivery (years)	32.46 ± 0.56	31.40 ± 0.45	>0.05
BMI at blood draw (kg/m²)	28.28 ± 0.36	27.74 ± 0.21	>0.05
Gestational age at delivery (weeks)	37.34 ± 0.27	35.57 ± 0.31	<0.0001^*
Systolic BP (mmHg)	147.1 ± 1.13	162.8 ± 1.57	<0.0001^*
Diastolic BP (mmHg)	92.10 ± 0.71	102.4 ± 0.88	<0.0001^*
Fetal birth weight (g)	2895 ± 77.74	2583 ± 67.65	<0.0043^*
Primiparous	42 (58.3%)	79 (60.3%)	>0.05
Proteinuria (mg/24 h)	576 ± 54.93	1750 ± 221	<0.0001^*

Data are presented as the mean ± standard deviation for continuous variables and as number (percentage) for categorical variables. ^*p-values <0.05 are significant.

PE, pre-eclampsia.

SNP selection

Seven candidate polymorphisms were selected for analysis based on the literature employing two criteria (Deepthi et al., 2015; Norouzian et al., 2016). First, we collated SNPs that had been associated with PE in a prior initial study with at least one independent replication study, irrespective of the ethnicity of the participants. Second, we selected SNPs within functional areas of the gene or in regions that may affect the gene's function. These criteria led to the selection of four Foxp3 SNPs (rs3761549 C>T, rs2280883T>C, rs2232365 A>G, and rs3761548 C>A) and three TGF-β1 SNPs (rs11466359 C>T, rs11466345 A>G, and rs1800469 T>C) from the SNP database (www.ncbi.nlm.nih.gov/projects/SNP). For the screen of the most common SNPs in Han Chinese PE patients, a minor allele frequencies (MAF) ≥0.01 was used as the cutoff. Based on these criteria, we then searched for all SNPs with MAF ≥0.01 of Foxp3 and TGF-β1 in the HapMap HCB database using Haploview (Barrett et al., 2005), which identified seven SNPs [(Foxp3) (rs3761549, rs2280883, rs2232365, and rs3761548) and (TGF)-β1 (rs11466359, rs11466345, and rs1800469)] (Supplementary Data).

Genotype determination

Peripheral venous whole blood samples were collected in ethylenediaminetetraacetic acid tubes and then held in a deep freezer (−80°C) until processing. Genomic DNA was extracted from peripheral blood cells with a Nucleon Bacc kit (TianGen Biotech Co., Ltd., Beijing, China). The extracted DNA samples were also stored in a deep freezer at −80°C.

Polymorphisms were identified by multiplex PCRs. Each participant's extracted DNA was amplified by PCR in a GeneAmp PCR System 9600 (Perkin Elmer, Waltham, MA) in a 20-μL reaction volume (2 μL of 1 × sample buffer, 0.2 μL of Taq polymerase, 2 μL of each primer, 2 μL of template DNA, and 12.2 μL of ddH₂O). Each PCR commenced with a 2-min period at 95°C followed by 40 of the following cycles: 94°C for 30 s, 62°C for 90 s, and 65°C for 10 min. After completion of the amplification, LDR was carried out in a final volume of 10 μL containing 4 μL of purified PCR product and 0.05 μL of DNase-free water. The single base extension program consisted of 40 of the following cycles: 95°C for 2 min, 94°C for 15 s, and 50°C for 25 s.

We analyzed the LDR fluorescent products in an ABI sequencer 377 (Applied Biosystems) and Genemapper software. In addition to conducting assay quality control assessments, we employed double positive controls (duplicated DNA samples) and negative controls (DNA-free blanks) in the SNP genotyping experiment. Bidirectional sequencing of 20 randomly selected individuals revealed no genotyping errors (genotyping success rate for nine SNPs = 99.7%).

Statistical analysis

Continuous variables are presented as means ± standard deviations and were compared with Student's t-tests. Categorical variables are presented as frequencies and were analyzed with chi-squared tests. Each polymorphism was tested for Hardy-Weinberg equilibrium with Pearson's chi-squared tests (p > 0.05). Odds ratios (ORs) were calculated for the minor allele at each SNP. Associations between each polymorphism and PE risk were determined based on ORs and 95% of confidence intervals (CIs). All of the aforementioned statistical tests were conducted in SPSS software (version 11.5; SPSS, Inc., Chicago, IL). A linkage disequilibrium (LD) map constructed in SHEsis software (Shi and He, 2005; Li et al., 2009). All tests were two-tailed. Genetic models were divided into dominance (+/+ plus +/− vs. −/−) groups.

Results

Patient characteristics

The clinical characteristics of the study participants analyzed (203 PE patients and 243 HP controls) are described in Table 1. Maternal age was significantly higher, whereas gestational age was significantly lower in the PE patient group than in the HP control group. Systolic BP and diastolic BP were significantly higher in PE patients than in HP women. Body mass index was significantly higher, whereas newborn weights were significantly lower in the PE patient group than in the HP control group (all p < 0.001). However, all of the other clinical features presented in Table 1 differed significantly between the two study groups. Moreover, the portion of women who were primiparous was similar for the two groups. The clinical characteristics of the study participants analyzed (131 severe PE and 72 mild PE patients controls) are described in Table 2.

Single-locus analysis

The sequences of the PCR primers used are listed in Table 3. The genotype and allele frequencies of PE patients and HP controls are reported in Tables 4 and 5. The genotype distributions of all seven examined were consistent with the Hardy-Weinberg equilibrium model in the HP control group (chi-squared, p > 0.05).

Table 3.

Polymerase Chain Reaction Primers Used for the Polymerase Chain Reaction/Ligase Detection Reaction Genotyping Assays

SNP ID	Forward primer (5′→ 3′)	Reverse primer (5′→ 3′)
Foxp3
rs3761549	CCTACCACATCCACCAGC	GGAGGAAGAGAAGAGGGC
rs2280883	GAGATGAAGGAGTTGGGATG	TGTCAATACACCCCCAACTG
rs2232365	GTAGAGAAGCTTCTACAGGC	AGGAGTGTGATCATGCACGG
rs3761548	AAGCCTAGATCTCAGGACTC	TGGGTGCTGAGGGGTAAACT
TGF-β1
rs11466359	GAGGGACAGAGACTGAGAAA	GTGTTGGTATTACCATCGTG
rs11466345	CATGTAGTTCAAACCCATGTC	AACTCCTGACCTCAAGTGATC
rs1800469	GAGGTGCTCAGTAAAGGAG	A AGGGTGTCAGTGGGAGGAG

Foxp3, forkhead box p3; SNP, single nucleotide polymorphism; TGF-β1, transforming growth factor-β1.

Table 4.

Genotyping Results of the Single Nucleotide Polymorphism in the Foxp3 Gene in Pre-Eclampsia Cases and Normal Pregnancy Controls

Gene and dbSNP ID	Genotype and allele	Control % (n = 243)	PE % (n = 203)	OR (95% CI)	p
Foxp3 rs3761549 (C>T)	C/C	59.7 (145)	65.5 (133)	1.00	0.42
	C/T	35 (85)	30.5 (62)	0.80 (0.53-1.19)
	T/T	5.3 (13)	3.9 (8)	0.67 (0.27-1.67)
	C/T−T/T	38.3 (98)	34.4 (70)	0.78 (0.53-1.15)	0.21
	Allele C	77.2 (375)	80.8 (328)
	Allele T	22.8 (111)	19.2 (78)	0.80 (0.58-1.11)	0.19
Foxp3 rs2280883 (T > C)	T/T/T	56.8 (138)	61.4 (124)	1.00	0.53
	T/C	39.5 (96)	36.1 (73)	0.85 (0.57-1.25)
	C/T C/C	3.7 (9)	2.5 (5)	0.62 (0.20-1.90)
	T/C−C/C	43.2 (105)	38.6 (78)	0.83 (0.57-1.21)	0.33
	Allele T	76.5 (372)	79.5 (321)
	Allele C	23.5 (114)	20.5 (83)	0.84 (0.61-1.16)	0.30
Foxp3 rs2232365 (A>G)	A/A	33.3 (81)	36.9 (75)	1.00	0.73
	A/G	51.9 (126)	48.8 (99)	0.85 (0.56-1.28)
	G/G	14.8 (36)	14.3 (29)	0.87 (0.49-1.56)
	A/G−G/G	66.7 (162)	63.1 (128)	0.85 (0.58-1.26)	0.43
	Allele A	59.3 (288)	61.3 (249)
	Allele G	40.7 (198)	38.7 (157)	0.92 (0.70-1.20)	0.53
Foxp3 rs3761548 (C>A)	C/C	58.8 (143)	55.2 (112)	1.00	0.73
	C/A	39.1 (95)	42.4 (86)	1.16 (0.79-1.69)
	A/A	2.1 (5)	2.5 (5)	1.28 (0.36-4.52)
	C/A−A/A	41.2 (100)	44.9 (91)	1.16 (0.80-1.69)	0.44
	Allele C	78.4 (381)	76.4 (310)
	Allele A	21.6 (105)	23.6 (96)	1.12 (0.82-1.54)	0.47

Pdom, p-value of dominant model [(homozygotes of risk allele+heterozygotes) vs. homozygotes of nonrisk allele].

CI, confidence interval; dbSNP, database single nucleotide polymorphisms database; OR, odds ratio.

Table 5.

Genotyping Results of the Single Nucleotide Polymorphism in the Transforming Growth Factor-β1 Gene in Pre-Eclampsia Cases and Normal Pregnancy Controls

Gene and dbSNP ID	Genotype and allele	Control % (n = 243)	PE % (n = 203)	OR (95% CI)	p
TGF-β1 rs11466359 (C>T)	C/C	44.9 (109)	43.3 (88)	1.00	0.59
	C/T T/T	42.8 (104)	46.8 (95)	1.13 (0.76-1.68)
	C/T−T/T	12.3 (30)	9.9 (20)	1.83 (0.44-1.55)
	Allele C	55.1 (134)	56.7 (115)	1.06 (0.73-1.55)	0.75
	Allele T	66.3 (322)	66.7 (271)
	Allele T	33.7 (164)	33.3 (135)	0.99 (0.74-1.29)	0.88
TGF-β1 rs11466345 (A>G)	A/A	52.3 (127)	54.2 (110)	1.00	0.64
	A/G	41.6 (101)	37.9 (77)	1.11 (0.76-1.62)
	G/G	6.2 (15)	7.9 (16)	1.23 (0.58-2.60)
	A/G−G/G	47.8 (116)	45.8 (93)	0.93 (0.64-1.35)	0.69
	Allele A	73 (355)	73.2 (297)
	Allele G	27 (131)	26.8 (109)	1.00 (0.74-1.34)	0.97
TGF-β1 rs1800469 (C>T)	C/C	22.2 (54)	14.3 (29)	1.00	0.026
	C/T	47.3 (115)	44.8 (91)	1.47 (0.87-2.45)
	T/T	30.5 (74)	40.9 (83)	2.09 (1.21-3.62)
	C/T−T/T	77.8 (189)	85.7 (174)	1.71 (1.04-2.81)	0.033
	Allele C	45.9 (223)	36.7 (149)		0.006
	Allele T	54.1 (263)	63.3 (257)	1.46 (1.12-1.92)

Pdom, p-value of dominant model [(homozygotes of risk allele+heterozygotes) vs. homozygotes of nonrisk allele].

The rs1800469 TT genotype had a higher frequency in PE patients than in HP controls [CC vs. CT+TT: OR = 1.71; 95% CI: 1.04-2.81; p = 0.033; Table 5], indicating that the rs1800469 T allele confers a risk for PE [OR = 1.46; 95% CI: 1.12-1.92; p = 0.006; Table 5].

None of the other investigated SNP alleles or genotypes of Foxp3 (rs3761549, rs3761548, and rs2280883) or TGF-β1 (rs11466359 and rs11466345) showed a significant association with PE (Tables 4 and 5). These SNPs were not found to be associated with PE severity (Tables 6 and 7).

Table 6.

Genotyping Results of the Single Nucleotide Polymorphism in the Foxp3 Gene in Pre-Eclampsia with Severe Features Cases and Controls (Mild Pre-Eclampsia)

Gene and dbSNP ID	Genotype and allele	Mild PE control % (n = 72)	Severe PE % (n = 131)	OR (95% CI)	p
Foxp3 rs3761549 (C>T)	C/C	63.9 (46)	64.1 (84)	1.00	0.67
	C/T	30.6 (22)	32.8 (43)	1.07 (0.57-2.00)
	T/T	5.6 (4)	3.1 (4)	0.55 (0.13-2.29)
	C/T−T/T	36.2 (26)	35.9 (47)	0.99 (0.54-1.80)	0.97
	Allele C	79.2 (114)	80.5 (211)
	Allele T	20.8 (30)	19.5 (51)	0.92 (0.55-1.52)	0.74
Foxp3 rs2280883 (T > C)	T/T/T	52.8 (38)	68.7 (90)	1.00	0.035
	T/C	44.4 (32)	26.7 (35)	0.46 (0.25-0.85)
	C/T C/C	2.8 (2)	4.6 (6)	1.27 (0.25-6.56)
	T/C−C/C	47.2 (34)	31.3 (41)	0.510.28-0.92)	0.025
	Allele T	75 (108)	82.1 (215)
	Allele C	25 (36)	17.9 (47)	0.66 (0.40-1.07)	0.09
Foxp3 rs2232365 (A>G)	A/A	27.8 (20)	44.3 (58)	1.00	0.04
	A/G	52.8 (38)	45.0 (59)	0.53 (0.28-1.02)
	G/G	19.4 (14)	10.7 (14)	0.35 (0.14-0.85)
	A/G−G/G	72.2 (52)	55.7 (73)	0.48 (0.26-0.90)	0.02
	Allele A	54.2 (78)	66.8 (175)	1.70 (1.12-2.58)
	Allele G	45.8 (66)	33.2 (87)	0.59 (0.39-0.89)	0.01
Foxp3 rs3761548 (C>A)	C/C	51.4 (37)	57.3 (75)	1.00	0.13
	C/A	48.6 (35)	38.9 (51)	0.72 (0.40-1.23)
	A/A	NA	3.8 (5)	NA
	C/A−A/A	NA	NA	NA
	Allele C	75.7 (109)	76.7 (201)
	Allele A	24.3 (35)	23.3 (61)	0.95 (0.59-1.52)	0.82

NA, not applicable.

Table 7.

Genotyping Results of the Single Nucleotide Polymorphism in the Transforming Growth Factor-β1 Gene in Pre-Eclampsia with Severe Features Cases and Controls (Mild Pre-Eclampsia)

Gene and dbSNP ID	Genotype and allele	Mild PE control % (n = 72)	Severe PE % (n = 131)	OR (95% CI)	p
TGF-β1 rs11466359 (C>T)	C/C	45.8 (33)	41.2 (54)	1.00	0.81
	C/T	44.4 (32)	48.9 (64)	1.22 (0.67-2.24)
	T/T	9.7 (7)	9.9 (13)	1.14 (0.41-3.13)
	C/T−T/T	54.1 (39)	58.8 (77)	1.21 (0.68-2.15)	0.53
	Allele C	68.1 (98)	65.6 (172)
	Allele T	31.9 (46)	34.4 (90)	1.12 (0.72-1.72)	0.62
TGF-β1 rs11466345 (A>G)	A/A	52.8 (38)	55.0 (72)	1.00	0.64
	A/G	41.7 (30)	35.9 (47)	0.83 (0.45-1.51)
	G/G	5.6 (4)	9.2 (12)	1.58 (0.48-5.25)
	A/G−G/G	47.3 (34)	45.1 (59)	0.92 (0.51-1.63)	0.77
	Allele A	73.6 (106)	72.9 (191)
	Allele G	26.4 (38)	27.1 (71)	1.04 (0.66-1.64)	0.88
TGF-β1 rs1800469 (C>T)	C/C C/T	12.5 (9)	15.3 (20)	1.00	0.55
	T/T	51.4 (37)	43.5 (57)	0.69 (0.29-1.69)
	C/T−T/T	36.1 (26)	41.2 (54)	0.94 (0.37-2.33)
	Allele C	87.5 (63)	84.0 (111)	0.79 (0.34-1.85)	0.59
	Allele T	38.2 (55)	37.0 (97)
	Allele T	61.8 (89)	63.0 (165)	1.05 (0.69-1.60)	0.82

With respect to genotype frequencies, we found a significant difference between PE patients and HP controls in the dominant genetic model analysis of rs1800469 (p = 0.033, Table 5).

Foxp3 subgroup analysis showed that rs2232365 A allele frequencies in severe (OR = 1.70; 95% CI: 1.12-2.58; p = 0.01; Table 6) PE patients differed significantly from those in mild PE controls, with the A allele presenting as the risk-associated SNP, especially in severe PE patients. No significant differences in allele or genotype frequency were observed between PE patients and HP controls for rs2232365 (Table 4). TGF-β1 (rs11466359 C>T, rs11466345 A>G, and rs1800469 T>C) maintained its negative association with follow-up PE severity (Table 7) subgroup analysis.

Table 8 presents the results of LD tests (noted as D′ and r² between pairs of SNP markers within Foxp3 and TGF-β1 for the respective control groups. According to these results, LD (D′>0.8) was observed in the five-SNP linkage disequilibrium estimation. When combining the allele frequency data with the LD, the associated SNPs, TGF-β1 rs11466345 and rs11466359, were detected in the same LD block as Foxp3 rs2232365, rs3761548, and rs3761549 (D′>0.8 between each other, Table 9)

Table 8.

Estimation of Linkage Disequilibrium Between Each Pair of Loci Within Foxp3

	RS2280883	RS2232365	RS3761548	RS3761549
RS2280883	—	0.291	0.776	0.057
RS2232365	0.824	—	0.285	0.347
RS3761548	0.892	0.805	—	0.056
RS3761549	0.859	0.924	0.845	—

Table 9.

Estimation of Linkage Disequilibrium Between Each Pair of Loci Within TGF-β1

	RS11466359	RS11466345	RS1800469
RS11466359	—	0.524	0.021
RS11466345	0.847	—	0.011
RS1800469	0.241	0.201	—

The D′-value is displayed below the subtraction symbol and the r²-value is displayed above the subtraction symbol.

Haplotype analysis was performed based on the genotype data (Tables 10 and 11), excluding frequencies <0.03. Foxp3 haplotype (rs3761549 C>T, rs2280883T>C, rs2232365 A>G, and 3761548C>A) frequencies were similar between the PE patients and HP controls. TGF-β1 haplotype frequencies (rs11466359 C>T, rs11466345 A>G, and rs1800469 T>C) did not differ significantly between PE patients and HP controls. However, group-haplotype associations were found when the haplotypes were defined as Foxp3 (rs3761549 C>T, rs2280883T>C, and rs2232365 A>G; likelihood ratio χ² = 3.44, d.f. = 2, global p = 0.18) and TGF-β1 (rs11466359 C>T, rs11466345 A>G, and rs1800469 T>C; likelihood ratio χ² = 7.62, d.f. = 5 global p = 0.178). The results of a detailed haplotype analysis conducted with these seven SNPs are reported in Table 8. Rare haplotypes (frequency <5%) were excluded from the analysis.

Table 10.

Haplotype Analysis Results for the Association of Haplotypes Defined by Foxp3 (rs3761549 C>T, rs2280883T>C, rs2232365 A>G, and 3761548C>A) with Pre-Eclampsia

3761549C>T	2280883T>C	2232365A>G	3761548C>A	Cases d.f.	Controls d.f.	OR (95% CI)	p
C	C	G	A	0.19	0.19	1.031 (0.733-1.449)	0.86
T	T	G	C	0.58	0.53	1.214 (0.919-1.604)	0.17
T	T	G	C	0.17	0.22	0.727 (0.517-1.024)	0.07

Includes three more haplotypes that had frequencies of <0.05. They were dropped from hypothesis testing. Likelihood ratio χ² = 3.44 d.f. = 2 global p-value = 0.18.

Table 11.

Haplotype Analysis Results for the Association of Haplotypes Defined by Transforming Growth Factor-β1 (rs11466359 C>T, rs11466345 A>G, and rs1800469 T>C) with Pre-Eclampsia

11466359 C > T	11466345A>G	1800469T>C	Cases d.f.	Controls d.f.	OR (95% CI)	p
C	A	C	0.28	0.32	0.807 (0.604-1.078)	0.15
T	A	C	0.021	0.03	0.663 (0.281-1.565)	0.35
C	A	T	0.37	0.31	1.284 (0.969-1.701)	0.08
T	G	T	0.18	0.14	1.284 (0.895-1.841)	0.17

Includes three more haplotypes that had frequencies of <0.05. They were dropped from hypothesis testing. Likelihood ratio χ² = 7.62 d.f. = 5 global p-value = 0.178.

Discussion and Conclusions

PE is a multifactorial vascular disorder of pregnancy characterized by hypertension, proteinuria, and CD4⁺CD25⁺ Treg insufficiency in peripheral blood (Redman et al., 1999). Foxp3 is involved in CD4⁺CD25⁺ Treg cell activation and has been correlated to functions related to human cellular development and maintenance of cells (Walker et al., 2003). Foxp3 is expressed exclusively by CD4⁺CD25⁺Treg cells, which produce specific anti-inflammatory cytokines, such as IL-10, that dampen excessive effector immune responses (Jianjun et al., 2010; Saito et al., 2010). Meanwhile, TGF-β1 signaling has been shown to be involved in the induction of Foxp3, as well as in the generation of peripheral T cells and thymocytes. In the absence of an inflammatory insult, TGF-β1 suppresses effector T cell production, whereas induces Foxp3⁺ Treg cells to prevent autoimmunity. However, when the innate immune system is activated, IL-6 suppresses the generation of TGF-β-induced Treg cells while inducing a proinflammatory T cell response (predominately TH17 cells) (Bettelli et al., 2006). Although Foxp3's involvement in Treg biology is well established, the potential influence of Foxp3 variants on PE has not been established. Liu et al. (2017) reported angiopoietin-like protein 4 (ANGPTL4) gene is a potential target for peroxisome proliferator-activated receptor γ (PPARγ) and mediated protection for PPARγ activators in PE. Existing data support the direct correlation between high/low expression of selective miRNA in placenta and maternal serum, and future studies should focus on identifying a set of robust miRNA markers to predict the occurrence and development of PE (Lagana et al., 2018). Serum neurokinin-B level in pregnant women with normal BP is higher than that in women with PE, and Serum neurokinin-B plays no role in the pathophysiology of PE (Salman et al., 2018).

Although Foxp3's involvement in Treg development and function is well known, the possible influence of variances in the Foxp3 sequence (locus, Xp11; 11 exons and 10 introns) on PE has not been established.

In a study examining Foxp3 variants (SNPs and microsatellites) in a U.S. population sample, Metz et al. (2012) found no differences in genotype or allele frequencies for rs6609857, rs2294020, rs2280883, rs2232367, rs3761547, and rs4824747 between PE patients and controls, but did find differences in the frequencies of the Foxp3-6054 and -3279 microsatellites. Our negative allele frequency findings for rs3761549 and rs2280883 are consistent with Metz et al.'s negative findings for these SNPs.

Likewise, it remains to be determined whether PE risk is related to variant alleles of TGF-β1 (locus, 19q13; seven exons and six introns) the gene that encodes TGF-β1 (Clark and Coker, 1998; Kim et al., 2010). A recent study in South Indian women demonstrated a significant protective influence of the CT genotype of TGF-β1 C-509T (rs1800469) and T869C (rs1982073) polymorphisms on PE with a concomitant predisposing influence of dual homozygosity TGF-β1 C-C and T-T haplotypes (Deepthi et al., 2015). A study in northern México found that PE was not associated with -800G/A, -509C/T, and 869T/C polymorphisms of TGF-β1, or their haplotypes (Aguilar-Duran et al., 2014).

This is the first study to evaluate the relationship between Foxp3 and TGF-β1 polymorphisms in pre-eclamptic and healthy women without an obstetric or systemic disease. In this study, we found that of the seven allelic variants examined, only the TGF-β1 rs1800469 T allele was associated with PE (OR = 1.46; 95% CI: 1.12-1.92; p = 0.006). In addition, the rs1800469 TT genotype had a higher frequency in PE patients than in HP controls. Foxp3 rs2232365 frequency did not differ between PE patients and HP controls overall, but was associated with severe PE specifically (OR = 1.70; 95% CI: 1.12-2.58; p = 0.01). Differing findings across studies could be due to differences in study design, PE diagnostic criteria, SNP selection, population diversity, and sample size.

It should be noted that it is difficult to account for intergenic interactions and environmental factors in an individual's disease risk (Engel et al., 2005; Hoffjan et al., 2005; Kerk et al., 2006; Guzman et al., 2008). Indeed, such interactions can obscure polymorphism-disease associations, leading to discordant results across studies of the same condition. In addition, this study had the limitation of a relatively small sample size. Notwithstanding, prior studies have indicated that the sample size employed was sufficient to detect (with 80% power) associations between cytokine gene polymorphisms and PE (Kaiser et al., 2004; Saarela et al., 2005; Molvarec et al., 2008). Second, because this study included only Han Chinese women, it is not known whether the findings would be similar in other populations. Conversely, limiting our study to Chinese women residing in a single geographic location enabled us to avoid potential interference related to cohort heterogeneity.

In conclusion, in this study we report the first findings showing that SNPs in rs1800469 are associated with PE in pregnant Han Chinese women. This study supports the hypothesis that TGF-β1 rs1800469 T allelic variants may be particularly important factors in PE etiology, at least in Han Chinese women, and further suggests that women who carry the rs1800469 TT genotype are at an elevated risk of developing PE. On completion of replication studies, the roles of TGF-β1 T allelic variants in PE should be further investigated to establish how they may be involved functionally with PE susceptibility and etiology.

Footnotes

Acknowledgments

This research was supported by grants from 2016 Shenzhen Science and Technology R&D Fundamental Research: Medical and Health Free Exploration (JCYJ20160428140315277) and was supported by grants from 2017 Special Fund key Laboratory of Science and Technology Innovation in Longhua District of Shenzhen City (0410028).

Authors' Contributions

J.C. designed the experiments and wrote the initial draft of the manuscript. L.Z., D.W., N.Z., H.G. and W.T. conducted the experiments and analyzed the data. C.W. analyzed and interpreted the data, and drafted the manuscript.

Declaration Statement

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work.

Author Disclosure Statement

No competing financial interests exist.

Supplementary Material

References

(2000) Report of the national high blood pressure education program working group on high blood pressure in pregnancy. Am J Obstet Gynecol, 183:S1-S22.

Abalos

, Cuesta

, Grosso

, et al. (2013) Global and regional estimates of preeclampsia and eclampsia: a systematic review. Eur J Obstet Gynecol Reprod Biol, 170:1-7.

Aguilar-Duran

, Salvador-Moysen

, Galaviz-Hernandez

, et al. (2014) Haplotype analysis of TGF-beta1 gene in a preeclamptic population of northern Mexico. Pregnancy Hypertens, 4:14-18.

Aluvihare

, Kallikourdis

, Betz

(2004) Regulatory T cells mediate maternal tolerance to the fetus. Nat Immunol, 5:266-271.

Barrett

, Fry

, Maller

, Daly

(2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics, 21:263-265.

Bernard

, Giguere

(2003) Genetics of preeclampsia: what are the challenges?. J Obstet Gynaecol Can, 25:578-585.

Bettelli

, Carrier

, Gao

, et al. (2006) Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature, 441:235-238.

Clark

, Coker

(1998) Transforming growth factor-beta (TGF-beta). Int J Biochem Cell Biol, 30:293-298.

Cnattingius

, Reilly

, Pawitan

, Lichtenstein

(2004) Maternal and fetal genetic factors account for most of familial aggregation of preeclampsia: a population-based Swedish cohort study. Am J Med Genet A, 130a:365-371.

10.

Darmochwal-Kolarz

, Saito

, Rolinski

, et al. (2007) Activated T lymphocytes in pre-eclampsia. Am J Reprod Immunol, 58:39-45.

11.

de Lima

, Sass

, Mattar

, et al. (2009) Cytokine gene polymorphisms in preeclampsia and eclampsia. Hypertens Res, 32:565-569.

12.

Deepthi

, Chaithri

, Latha

, et al. (2015) TGFB1 Functional gene polymorphisms (C-509T and T869C) in the maternal susceptibility to pre-eclampsia in South Indian women. Scand J Immunol, 82:390-397.

13.

Dekker

, Robillard

, Roberts

(2011) The etiology of preeclampsia: the role of the father. J Reprod Immunol, 89:126-132.

14.

Engel

, Erichsen

, Savitz

, et al. (2005) Risk of spontaneous preterm birth is associated with common proinflammatory cytokine polymorphisms. Epidemiology, 16:469-477.

15.

Guzman

, Yambartsev

, Goncalves-Primo

, et al. (2008) New approach reveals CD28 and IFNG gene interaction in the susceptibility to cervical cancer. Hum Mol Genet, 17:1838-1844.

16.

Heikkinen

, Mottonen

, Alanen

, Lassila

(2004) Phenotypic characterization of regulatory T cells in the human decidua. Clin Exp Immunol, 136:373-378.

17.

Hoffjan

, Nicolae

, Ostrovnaya

, et al. (2005) Gene-environment interaction effects on the development of immune responses in the 1st year of life. Am J Hum Genet, 76:696-704.

18.

Ilekis

, Reddy

, Roberts

(2007) Preeclampsia—a pressing problem: an executive summary of a National Institute of Child Health and Human Development workshop. Reprod Sci, 14:508-523.

19.

Jianjun

, Yali

, Zhiqun

, et al. (2010) Imbalance of T-cell transcription factors contributes to the Th1 type immunity predominant in pre-eclampsia. Am J Reprod Immunol, 63:38-45.

20.

Kaiser

, Grehan

, Brennecke

, Moses

(2004) Association of the TNF2 allele with eclampsia. Gynecol Obstet Invest, 57:204-209.

21.

Kerk

, Dordelmann

, Bartels

, Brinkhaus

, et al. (2006) Multiplex measurement of cytokine/receptor gene polymorphisms and interaction between interleukin-10 (-1082) genotype and chorioamnionitis in extreme preterm delivery. J Soc Gynecol Investig, 13:350-356.

22.

Kim

, Lim

, Park

, et al. (2010) Transforming growth factor-beta 1 gene polymorphisms in Korean patients with pre-eclampsia. Am J Reprod Immunol, 63:291-298.

23.

Koucky

, Malickova

, Cindrova-Davies

, et al. (2014) Low levels of circulating T-regulatory lymphocytes and short cervical length are associated with preterm labor. J Reprod Immunol, 106:110-117.

24.

Lagana

, Vitale

, Sapia

, et al. (2018) miRNA expression for early diagnosis of preeclampsia onset: hope or hype?. J Matern Fetal Neonatal Med, 31:817-821.

25.

, Zhang

, He

, et al. (2009) A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: update of the SHEsis (http://analysis.bio-x.cn). Cell Res, 19:519-523.

26.

Liu

, Zhuang

, Jiang

, et al. (2017) ANGPTL4 mediates the protective role of PPARgamma activators in the pathogenesis of preeclampsia. Cell Death Dis, 8:e3054.

27.

Lok

, Jebbink

, Nieuwland

, et al. (2009) Leukocyte activation and circulating leukocyte-derived microparticles in preeclampsia. Am J Reprod Immunol, 61:346-359.

28.

Metz

, Nelson

, Stoddard

, Silver

(2012) FOXP3 gene polymorphisms in preeclampsia. Am J Obstet Gynecol, 206:165.e161-e166.

29.

Molvarec

, Jermendy

, Nagy

, et al. (2008) Association between tumor necrosis factor (TNF)-alpha G-308A gene polymorphism and preeclampsia complicated by severe fetal growth restriction. Clin Chim Acta, 392:52-57.

30.

Nakashima

, Shima

, Inada

, et al. (2012) The balance of the immune system between T cells and NK cells in miscarriage. Am J Reprod Immunol, 67:304-310.

31.

Norouzian

, Rahimzadeh

, Rajaee

, et al. (2016) FoxP3 gene promoter polymorphism affects susceptibility to preeclampsia. Hum Immunol, 77:1232-1238.

32.

Redman

, Sacks

, Sargent

(1999) Preeclampsia: an excessive maternal inflammatory response to pregnancy. Am J Obstet Gynecol, 180:499-506.

33.

Saarela

, Hiltunen

, Helisalmi

, et al. (2005) Tumour necrosis factor-alpha gene haplotype is associated with pre-eclampsia. Mol Hum Reprod, 11:437-440.

34.

Saito

, Nakashima

, Shima

, Ito

(2010) Th1/Th2/Th17 and regulatory T-cell paradigm in pregnancy. Am J Reprod Immunol, 63:601-610.

35.

Sakaguchi

, Ono

, Setoguchi

, et al. (2006) Foxp3+ CD25+ CD4+ natural regulatory T cells in dominant self-tolerance and autoimmune disease. Immunol Rev, 212:8-27.

36.

Sakaguchi

, Sakaguchi

, Asano

, et al. (1995) Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol, 155:1151-1164.

37.

Salman

, Shah

, Ali

, et al. (2018) Assessment of relationship of serum neurokinin-B level in the pathophysiology of pre-eclampsia: a case-control study. Adv Ther [Epub ahead of print]; DOI: 10.1007/s12325-018-0723-z.

38.

Sasaki

, Darmochwal-Kolarz

, Suzuki

, et al. (2007) Proportion of peripheral blood and decidual CD4(+) CD25(bright) regulatory T cells in pre-eclampsia. Clin Exp Immunol, 149:139-145.

39.

Saxena

, Misra

, Parveen

, et al. (2015) The transcription factor Forkhead Box P3 gene variants affect idiopathic recurrent pregnancy loss. Placenta, 36:226-231.

40.

Shi

, He

(2005) SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res, 15:97-98.

41.

Walker

, Kasprowicz

, Gersuk

, et al. (2003) Induction of FoxP3 and acquisition of T regulatory activity by stimulated human CD4+CD25- T cells. J Clin Invest, 112:1437-1443.

42.

Xiong

, Zhou

, Qi

(2010) Proportional changes of CD4+CD25+Foxp3+ regulatory T cells in maternal peripheral blood during pregnancy and labor at term and preterm. Clin Invest Med, 33:E422.

43.

Xiong

, Yuan

, He

(2013) Effects of estrogen on CD4(+) CD25(+) regulatory T cell in peripheral blood during pregnancy. Asian Pac J Trop Med, 6:748-752.

44.

Zenclussen

, Gerlof

, Zenclussen

, et al. (2005) Abnormal T-cell reactivity against paternal antigens in spontaneous abortion: adoptive transfer of pregnancy-induced CD4⁺CD25⁺ T regulatory cells prevents fetal rejection in a murine abortion model. Am J Pathol, 166:811-822.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.02 MB