Transcription Activator-Like Effector Proteins Induce the Expression of the Frataxin Gene

Abstract

Genes encoding transcription activator-like effector (TALE) proteins may be engineered to target specific DNA sequences. TALEs fused with a transcription activator can be used to specifically induce the expression of a gene. This could lead to completely new therapies for several diseases. We have applied this potential therapeutic approach to Friedreich ataxia (FRDA), as an example. FRDA is due to reduced expression of frataxin because of elongation of a trinucleotide (GAA) repeat in intron 1. Our aim was to develop a potential treatment for FRDA by increasing the expression of the frataxin gene. We engineered 12 TALE genes (TALE_Frat) encoding TALE_Frat proteins, each specifically targeting different 14-bp DNA sequences within the proximal region of the human frataxin promoter. When the genes encoding these TALE_Frat proteins were fused with a transcription activator, that is, four VP16 peptides (i.e., VP64), the resulting TALE_Frat-VP64 proteins induced the expression of an mCherry reporter gene fused to a mini-cytomegalovirus promoter able to be activated by the insertion of the frataxin proximal promoter upstream to the minipromoter. These TALE_Frat-VP64 proteins also increased, by 2- to 3-fold, frataxin gene expression (detected by qRT-PCR) in the cells. We conclude that TALE_Frat proteins targeting the frataxin promoter may be used to increase the expression of frataxin mRNA and potentially could alleviate the symptoms of Friedreich ataxia. TALE methodology opens a new field of research, which could be used to develop TALE proteins to treat other diseases by inducing the expression of specific genes.

Introduction

T ranscription Activator-Like Effector (TALE) proteins are normally produced by a plant pathogen Xanthomonas species (Boch and Bonas, 2009; Boch et al., 2009; Moscou and Bogdanove, 2009). TALEs have a highly conserved and repetitive region within the middle of the protein, consisting of tandem repeats of 33- or 34-amino acid segments. These repeat monomers differ from each other mainly in amino acid positions 12 and 13, and there is strong correlation between this pair of amino acids and the corresponding nucleotide in the TALE-binding site (e.g., NI to A, HD to C, NG to T, and NN to G or A). Publications on the engineering of TALEs and their applications have become numerous (Boch et al., 2009; Gu et al., 2009; Moscou and Bogdanove, 2009; Romer et al., 2009, 2010; Christian et al., 2010; T. Li et al., 2010, 2011; Scholze and Boch, 2010; Song and Yang, 2010; Cermak et al., 2011; Y.R. Li et al., 2011; Yu et al., 2011). TALE proteins can be fused with a transcription activator to induce expression of a gene located near the DNA attachment site. This could permit induction of the expression of a specific gene to treat some hereditary and nonhereditary diseases.

As an example of this therapeutic approach, we have applied this strategy to Friedreich ataxia (FRDA). FRDA is an autosomal recessive neurodegenerative and cardiac disease, caused by a trinucleotide (GAA) repeat expansion in the first intron of the frataxin gene located on chromosome 9 (Campuzano et al., 1996). The mutation leads to reduced expression of the frataxin gene without changing the protein. The pathological mechanisms have been reviewed by Pandolfo (2006, 2012). Frataxin is essential for proper functioning of mitochondria (Campuzano et al., 1997). It is involved in the removal of iron and when frataxin is reduced, the iron builds up and causes free radical damage. Neurons and cardiomyocytes are particularly sensitive to these deleterious effects (Wallis et al., 1989; Rotig et al., 1997; Becker and Richardson, 2001). In the classic form, FRDA symptoms appear in or before the second decade of life. It is characterized by ataxia, areflexia, loss of vibratory sense and proprioception, and dysarthria (Harding, 1981; Pandolfo, 1999; Lynch et al., 2002; Cooper and Schapira, 2003; Babady et al., 2007). Moreover, patients with FRDA often have systemic involvement, with cardiomyopathy, diabetes mellitus, and scoliosis. Early death can result from cardiomyopathy or associated arrhythmias (Harding, 1981; Singh et al., 2001).

A potential treatment of Friedreich ataxia is thus to increase the expression of frataxin, using TALE proteins coupled with a transcription activator, for example, four VP16 sequences (VP64) and specifically targeting the human frataxin promoter. In the present paper, we show that several plasmids encoding such TALE_Frat-VP64 proteins effectively increase the expression of a reporter gene placed under the control of the frataxin promoter and that some of them were able to increase transcription of the frataxin gene in human cells.

Materials and Methods

Construction of TALE_Frat genes targeting the frataxin promoter

We have engineered 12 TALE_Frat genes (Table 1) targeting the proximal region of the human frataxin promoter (Fig. 1), using a technique described by Zhang and colleagues (2011) and using reagents distributed by Addgene (Cambridge, MA). The final TALE expression vectors were the same as those originally used by Zhang and colleagues (2011), containing a nuclear localization signal (NLS), a transcriptional effector domain (VP64), and a 2A sequence followed by an enhanced green fluorescent protein (EGFP)-encoding gene (Paul et al., 1998; Furler et al., 2001). Thus the final vectors (pTALE_Frat-VP64-2A-EGFP) produced two separate proteins (TALE_Frat-VP64 and EGFP) from a single mRNA (Fig. 2A).

FIG. 1.

Sequence of the proximal region of the frataxin promoter. The sequence was obtained from GenBank NM_000144. The binding sites of TALE_Frat #8 and of three transcription factors, that is, serum response factor (SRF), transcription factor-activating enhancer-binding protein-2 (TFAP2), and specificity protein-1 (SP1), are indicated. Binding sites of the transcription factors were identified by K. Li and colleagues (2010). The sequence under the dark band has been introduced into the pCR3.1-promoter_Frat-miniCMV-mCherry reporter plasmid. Color images available online at www.liebertonline.com/hum

FIG. 2.

Schematic representation of (A) p.TALE_Frat-VP64-2A-EGFP and of (B) pCR3.1-promoter_Frat-miniCMV-mCherry. Color images available online at www.liebertonline.com/hum

Table 1.

Sequences Targeted by Transcription Activator-Like Effectors, and Results

TALE NO.	Position of target sequence	Targeted sequence	RVD	Fluo red Q2	Fluo green Q2	Ratio red/green
1	−216 to −203	tcccttgggtcagg	NG HD HD HD NG NG NN NN NN NG HD NI NG NN	5530	37,800	0.15
2	−200 to −187	tcctggttgcactc	NG HD HD NG NN NN NG NG NN HD NI HD NG HD	5489	20,404	0.27
3	−197 to −184	tggttgcactccgt	NG NN NN NG NG NN HD NI HD NG HD HD NN NG	6652	28,642	0.23
4	−184 to −171	tgctttgcacaaag	NG NN HD NG NG NG NN HD NI HD NI NI NI NN	7636	38,856	0.20
5	−148 to −135	tgcacgaatagtgc	NG NN HD NI HD NN NI NI NG NI NN NG NN HD	6923	62,983	0.11
6	−140 to −127	tagtgctaagctgg	NG NI NN NG NN HD NG NI NI NN HD NG NN NN	7663	19,852	0.39
7	−129 to −116	tgggaagttcttcc	NG NN HD NG HD HD HD HD HD NI HD NI NN NI	5509	10,237	0.54
8	−118 to −105	tcctgaggtctaac	NG HD HD NG NN NI NN NN NG HD NG NI NI HD	4909	16,621	0.30
9	−115 to −102	tgaggtctaacctc	NG NN NI NN NN NG HD NG NI NI HD HD NG HD	8159	38,178	0.21
10	−97 to −84	tgctcccccacaga	NG NN HD NG HD HD HD HD HD NI HD NI NN NI	4865	39,668	0.12
11	−66 to −53	tggccaccaggggt	NG NN NN HD HD NI HD HD NI NN NN NN NN NG	7150	70,769	0.10
12	−53 to −40	tcgccgcagcaccc	NG HD NN HD HD NN HD NI NN HD NI HD HD HD	4630	61,567	0.08

Summarized here are the results with various TALE_Frat-VP64 proteins, the positions of the sequences targeted (according to NCBI reference sequence NM_000144.4), and the corresponding repeat-variable diresidue (RVD). 293FT cells in 24-well plates were cotransfected with 1 of the 12 p. TALE_Frat-2A-EGFP plasmids and with pCR3.1-promoter_Frat-miniCMV-mCherry. Red and green fluorescence levels were determined by flow cytometric analysis for the various p. TALE_Frat-VP64 proteins as described by Zhang and colleagues (2011). Mean red fluorescence intensity is indicated in column 5 and mean green fluorescence intensity is shown in column 6 for cells located in quadrant 2, which express both red and green fluorescence. In column 7, the ratio of column 5 to column 6 data indicates how strongly TALE_Frat-VP64 induced expression of the reporter gene. It is interesting to note that TALE_Frat proteins 6 to 8, which induced the strongest mCherry expression, are targeting sequences found next to each other (indicated in boldface).

Construction of reporter vector

We have modified the TALE-VP64 transcription activator system reporter vector named TALE mini-CMV promoter mCherry provided by Addgene by replacing the original pAAV vector by pCR3.1 (Invitrogen Canada, Burlington, ON, Canada). The new reporter vector was named pCR3.1-promoter_Frat-miniCMV-mCherry (Fig. 2B). It contains the proximal region of the frataxin promoter (385 bp) (Fig. 1) and was constructed as follows. The miniCMV-mCherry sequence from the plasmid pAAV-minCMV-mCherry (Addgene) was cloned into the pCR3.1 vector from which the original long cytomegalovirus (CMV) promoter had been removed. The proximal region of the frataxin promoter was amplified by PCR with Taq DNA polymerase (New England BioLabs, Ipswich, MA) from the genomic DNA of normal human cells with primers containing an XbaI site at the 5′ end (5′-AGTCTAGAGGCAGAGTACAGATTTACACAAGGCA) and a BamHI site at the 3′ end (5′-GGATCCTCTGCCGCCCGCTCCGCCCTCCAGCGCTG-3′), producing a 380-bp fragment. This promoter amplicon was then digested with XbaI and BamHI and cloned between the XbaI and BamHI sites of the pCR3.1-miniCMV-mCherry vector, that is, before the miniCMV-mCherry nucleotide sequence.

Quantitative real-time PCR for frataxin mRNA

qRT-PCR was done according to a technique previously described by Luu-The and colleagues (2005). Briefly, total RNA was extracted with an RNeasy mini kit (Qiagen, Valencia, CA). RNA quality was assessed with an Agilent 2100 bioanalyzer (Agilent Technologies, Palo Alto, CA). First-strand cDNA synthesis was done with 5 μg of isolated RNA. Frataxin mRNA was amplified with primers designed from GenBank sequence NM_000144 (Fig. 1). Four reference RNAs were also amplified, that is, ribosomal RNA (18S), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase (HPRT), and glucose-6-phosphate dehydrogenase (G6PD) (see Table 2 for primer sequences). All experiments for qRT-PCR analysis were performed with total RNA extracted from cells cultured in 6-well plates.

Table 2.

Primers for qRT-PCR

Gene symbol	Description	GenBank	Size (bp)	Annealing temperature (°C)	Sequences (5′→3′;S/AS)
FXN	Homo sapiens frataxin, nuclear gene encoding mitochondrial protein, locus produces three transcript variants	NM_000144	106	57	AAGCCATACACGTTTGAGGACTA/TTGGCGTCTGCTTGTTGATCA
HPRT1	Homo sapiens hypoxanthine phosphoribosyltransferase-1	NM_000194	157	57	AGTTCTGTGGCCATCTGCTTAGTAG/AAACAACAATCCGCCCAAAGG
G6PD	Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), nuclear gene encoding mitochondrial protein	NM_000402	121	57	GATGTCCCCTGTCCCACCAACTCTG/GCAGGGCATTGAGGTTGGGAG
GAPDH	Homo sapiens glyceraldehyde-3-phosphate dehydrogenase	NM_002046	194	60	GGCTCTCCAGAACATCATCCCT/ACGCCTGCTTCACCACCTTCTT
18S	18S ribosomal RNA	NR_003286	226	57	ACGGACCAGAGCGAAAGCATT/TCCGTCAATTCCTTTAAGTTTCAGCT

S/AS, sense/antisense.

Results

Expression of TALE_Frat-VP64 proteins

Table 1 summarizes the nucleotide sequences, in the proximal region of the human frataxin promoter, that have been targeted by TALE_Frat proteins and correspond to 14 repeat-variable di-residues (RVD) (Cermak et al., 2011). When a p.TALE_Frat-VP64-2A-EGFP expression plasmid was transfected alone into human cells (293FT cells), only green fluorescence was detected (Fig. 3A). The presence of green fluorescence confirmed the expression of EGFP protein, thus indirectly confirming the expression of TALE_Frat-VP64 protein.

FIG. 3.

Activation of the pCR3.1-promoter_Frat-miniCMV-mCherry reporter in 293FT cells by pTALE_Frat #8. Analysis was done by flow cytometry (B–D) and fluorescence microscopy (A–D). (A) Transfection with p.TALE_Frat#8-VP64-EGFP alone. When p.TALE_Frat#8-VP64-2A-EGFP expression plasmid was transfected into 293FT cells alone, only green fluorescence was detected in the cells. (B) Transfection with pCR3.1-promoter_Frat-miniCMV-mCherry plasmid with a GFP vector. Only a few red fluorescent cells were detected in quadrant 1 (Q1), but abundant green fluorescence (Q4) was detected. (C) Transfection with pCR3.1-promoter_Frat-miniCMV-mCherry plasmid alone. Only a few red fluorescent cells were detected in Q1. (D) Cotransfection of p.TALE_Frat#8-2A-EGFP and pCR3.1-promoter_Frat-miniCMV-mCherry in 293FT cells. Abundant green (EGFP) and red (mCherry) fluorescent cells (Q2) were detected. For each experimental condition, cell fluorescence was also observed with a fluorescence microscope equipped with a green fluorescence filter and a red fluorescence filter. A phase-contrast picture of the cells is also presented. Fluorescence was visualized with a Zeiss Axiovert 100 inverted microscope (original magnification,×100; Carl Zeiss, Germany). Transfection of 293FT cells was done in 24-well plates.

TALE_Frat-VP64 proteins induce expression of a reporter gene under the control of the frataxin promoter

The pCR3.1-promoter_Frat-miniCMV-mCherry reporter plasmid was initially transfected at 30 ng/ml with 2 μl of Lipofectamine 2000 into human cells in 24-well plates (i.e., 293FT cells) with a GFP vector (500 ng) (Fig. 3B) or alone (Fig 3C). In both cases, few cells expressed red fluorescence. However, when this reporter plasmid was cotransfected into human cells with one of the p.TALE_Frat-VP64-2A-EGFP expression plasmids (500 ng), green fluorescence was detected, confirming expression of the TALE_Frat-VP64 protein. Moreover, a much higher number of cells also expressing mCherry (red fluorescence) were also detected (Fig. 3D). This indicated that TALE_Frat-VP64 was attaching to the frataxin promoter sequence, inducing expression of the mCherry gene. Table 1 summarizes the results. The intensity of red fluorescence was normalized by dividing it by the green fluorescence intensity to compensate for variations in the efficacy of transfection. TALE_Frat #6, #7, and #8 induced the strongest expression of mCherry. The best TALE_Frat proteins were targeting the frataxin proximal promoter sequences close to each other between the binding sequences of the serum response factor (SRF) and transcription factor-activating enhancer-binding protein-2 (TFAP2) transcriptional factors identified by K. Li and colleagues (2010a).

TALE_Frat-VP64 proteins increase expression of frataxin mRNA

Several plasmids encoding TALE_Frat-VP64 proteins were further investigated by qRT-PCR for induction of frataxin gene expression. 293FT cells were transfected with a plasmid encoding one of the p.TALE_Frat-VP64-2A-EGFP expression plasmids. The transfection was done in a 6-well plate with 4 μg of plasmid, using 10 μl of Lipofectamine 2000. mRNAs were extracted 48 to 55 hr later. Frataxin, HPRT, and GAPDH mRNAs, and ribosomal RNA, were quantified by qRT-PCR. Frataxin mRNA was amplified by qRT-PCR and normalized relative to three different housekeeping mRNAs (HPRT1, G6PD, and GAPDH) and the ribosomal RNA (18S) in the same sample. The results were then further normalized with those obtained from 293FT cells not transfected with a plasmid (Table 3). TALE_Frat #8 gave a consistent increase relative to all reference RNAs, ranging from 1.7- to 3.1-fold.

Table 3.

Increase in Frataxin mRNA Induced by Various TALE_Frat-VP64 in 293FT Cells ^a

TALE no.	HPRT1	G6PD	GAPDH	18S
1	1.0	1.0	1.7	0.9
3	1.6	1.3	1.1	1.4
4	1.4	1.3	1.6	1.0
5	1.3	1.3	2.0	1.1
6	1.1	1.2	1.4	1.3
8	1.8	1.9	3.1	1.7
9	1.3	1.3	1.5	1.1

18S, 18S ribosonal RNA; G6PD, glucose-6-phosphate dehydrogenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPRT1, hypoxanthine phosphoribosyl transfeiase-1; TALE_Frat, transcription activato-like effector targeting the frataxin prometer.

qRT-PCR results were normalized relative to different housekeeping genes in 293FT cells not transfected with a TALE_Frat plasmid. TALE_Frat #8 (boldface) produced the best increase in frataxin mRNA relative to the four housekeeping genes, the results varying between 1.7- and 3.1-fold increases.

Additional experiments were made with the three TALE_Frat plasmids that gave the best results in the induction of mCherry. In these experiments, 293FT cells were either not transfected, transfected with a control plasmid encoding only EGFP (pCR3.1-EGFP), or transfected with one of the p.TALE_Frat-VP64-2A-EGFP expression plasmids (#6, #7, and #8). Frataxin mRNA results were normalized with those of GAPDH mRNA, which was the most consistent under the various types of conditions. Two independent experiments were made for TALE_Frat #6 and #7, whereas three experiments were made for TALE_Frat #8. To compare the results from one experiment with those of another, the results were normalized either with nontransfected cells or with cells transfected with the EGFP plasmid (Fig. 4). Only TALE_Frat #8 produced a consistent increase in frataxin mRNA relative to nontransfected cells (i.e., 1.7- to 3.1-fold increases; Fig. 4, left) and relative to EGFP-transfected cells (1.9- to 2.1-fold increases; Fig. 4, right). Thus TALE_Frat #8 significantly increased expression of frataxin mRNA by roughly 2- to 3-fold above control values.

FIG. 4.

Induction of frataxin mRNA by p.TALE_Frat-VP64-EGFP in 293FT cells. Frataxin mRNA was quantified by qRT-PCR. Results were normalized with the GAPDH housekeeping gene. Control cells were either not transfected or transfected with pCR3.1-EGFP plasmid. Frataxin mRNA was normalized with both types of control cells. Two or three independent experiments were done for each condition. TALE_Frat #8 consistently increased frataxin mRNA up to 2- to 3-fold.

Discussion

Friedreich ataxia is due to reduced expression of frataxin following expansion of a trinucleotide (GAA) repeat in intron 1. Frataxin is a mitochondrial protein, and its reduction leads to a mitochondrial malfunction leading in turn to oxidative stress and accumulation of iron in the mitochondria. These changes, particularly the increased oxidative stress, lead to cell death, including that of neurons and cardiomyocytes. This progressive cell death results in several neurological and cardiac symptoms. Thus all the symptoms of Friedreich ataxia are due to the reduction of frataxin.

A new method to increase frataxin expression is to engineer genes encoding TALE proteins targeting specific sequences in the frataxin promoter coupled with a transcription activator. To identify the target sequence within the human frataxin promoter to which a TALE-VP64 could bind to produce the largest increase in frataxin transcription, we have targeted all possible sequences within the proximal promoter that start with a thymidine. We have, however, not targeted regions of the promoter to which transcription activators (SRF, TFAP2, and specificity protein-1 [SP1]) bind. Our results clearly demonstrate that several different TALE_Frat-VP64 proteins effectively increased expression of a reporter gene under the control of the human frataxin promoter. Moreover, TALE_Frat #8 increased expression of the frataxin gene by 2- to 3-fold in human cells. It is important to note that such an increase is significant. Indeed, depending on the length of the trinucleotide repeat, patients with Friedreich ataxia produce 5–30% of the normal frataxin level. However, heterozygous carriers of this disease produce roughly 50% of the normal frataxin level and are asymptomatic. Thus, for the majority of patients an increase of 2- to 3-fold in the production of frataxin would represent a level of production comparable to that of carriers.

Our results suggest that TALE_Frat-VP64 protein #8 should be able to increase expression of the frataxin gene in patient cells. Increased expression of frataxin may reduce or completely prevent the symptoms of Friedreich ataxia. However, for therapeutic applications TALE_Frat-VP64 will have to be expressed in most of the cells of patients with FRDA, especially the neurons and cardiomyocytes, to prevent the development of nervous system and cardiac symptoms. There are two potential methods by which to obtain such intracellular expression. The first is to deliver the TALE_Frat-VP64 gene systemically, using an adeno-associated viral (AAV) vector. However, immune response against AAV-infected cells has been reported (Herzog, 2007; Hauck et al., 2009; Ohshima et al., 2009) and large-scale production of AAV vector under Good Manufacturing Practice conditions is still problematic. A second solution would be to couple the TALE_Frat-VP64 with a cell-penetrating peptide (CPP) such as Tat or Pep-1 (Becker-Hapak et al., 2001; Morris et al., 2001; Vives et al., 2003; Tilstra et al., 2007). These fusion proteins could be delivered systemically; they would enter the cells and, it is hoped, drive the expression of frataxin. The fusion proteins would, however, have to be readministered on a regular basis.

The therapeutic approach that we are proposing for FRDA could also be used to treat any disease in which the mutation leads to a reduction of mRNA without changing the sequence encoding a protein. In addition, any hereditary and nonhereditary diseases, in which the increased expression of a compensatory gene would produce beneficial effects, could be a target for such a therapeutic approach. For example, the expression of utrophin could be induced with a TALE targeting its promoter to compensate for the absence of dystrophin in the muscle fibers of patients with Duchenne muscular dystrophy (Tinsley et al., 1996).

Footnotes

Acknowledgment

This work was supported by a grant from the Canadian Association of Familial Ataxia (CAFA).

Author Disclosure Statement

A patent has been applied for, for the treatment of FRDA with TALEs.

References

Babady

N.E.

, Carelle

, Wells

R.D.

et al. 2007. Advancements in the pathophysiology of Friedreich's ataxia and new prospects for treatments. Mol. Genet. Metab., 92:23–35.

Becker

, Richardson

D.R.

2001. Frataxin: Its role in iron metabolism and the pathogenesis of Friedreich's ataxia. Int. J. Biochem. Cell Biol., 33:1–10.

Becker-Hapak

, McAllister

S.S.

, Dowdy

S.F.

2001. TAT-mediated protein transduction into mammalian cells. Methods, 24:247–256.

Boch

, Bonas

2009. Xanthomonas AvrBs3 family-type III effectors: Discovery and function. Annu. Rev. Phytopathol., 48:419–436.

Boch

, Scholze

, Schornack

et al. 2009. Breaking the code of DNA binding specificity of TAL-type III effectors. Science, 326:1509–1512.

Campuzano

, Montermini

, Molto

M.D.

et al. 1996. Friedreich's ataxia: Autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science, 271:1423–1427.

Campuzano

, Montermini

, Lutz

et al. 1997. Frataxin is reduced in Friedreich ataxia patients and is associated with mitochondrial membranes. Hum. Mol. Genet., 6:1771–1780.

Cermak

, Doyle

E.L.

, Christian

et al. 2011. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res., 39:e82.

Christian

, Cermak

, Doyle

E.L.

et al. 2010. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics, 186:757–761.

10.

Cooper

J.M.

, Schapira

A.H.

2003. Friedreich's ataxia: Disease mechanisms, antioxidant and coenzyme Q10 therapy. Biofactors, 18:163–171.

11.

Furler

, Paterna

J.C.

, Weibel

, Bueler

2001. Recombinant AAV vectors containing the foot and mouth disease virus 2A sequence confer efficient bicistronic gene expression in cultured cells and rat substantia nigra neurons. Gene Ther., 8:864–873.

12.

, Tian

, Qiu

, Yin

2009. Transcription activator-like type III effector AvrXa27 depends on OsTFIIAγ5 for the activation of Xa27 transcription in rice that triggers disease resistance to Xanthomonas oryzae pv. oryzae. Mol. Plant Pathol., 10:829–835.

13.

Harding

A.E.

1981. Friedreich's ataxia: A clinical and genetic study of 90 families with an analysis of early diagnostic criteria and intrafamilial clustering of clinical features. Brain, 104:589–620.

14.

Hauck

, Murphy

S.L.

, Smith

P.H.

et al. 2009. Undetectable transcription of cap in a clinical AAV vector: Implications for preformed capsid in immune responses. Mol. Ther., 17:144–152.

15.

Herzog

R.W.

2007. Immune responses to AAV capsid: Are mice not humans after all? Mol. Ther., 15:649–650.

16.

, Singh

, Crooks

D.R.

et al. 2010. Expression of human frataxin is regulated by transcription factors SRF and TFAP2. PLoS One, 5:e12286.

17.

, Huang

, Jiang

W.Z.

et al. 2010. TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain. Nucleic Acids Res., 39:359–372.

18.

, Huang

, Zhao

et al. 2011. Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes. Nucleic Acids Res., 39:6315–6325.

19.

Y.R.

, Zou

H.S.

, Che

Y.Z.

et al. 2011. A novel regulatory role of HrpD6 in regulating hrp-hrc-hpa genes in Xanthomonas oryzae pv. oryzicola. Mol. Plant Microbe Interact., 24:1086–1101.

20.

Luu-The

, Paquet

, Calvo

, Cumps

2005. Improved real-time RT-PCR method for high-throughput measurements using second derivative calculation and double correction. Biotechniques, 38:287–293.

21.

Lynch

D.R.

, Farmer

J.M.

, Balcer

L.J.

, Wilson

R.B.

2002. Friedreich ataxia: Effects of genetic understanding on clinical evaluation and therapy. Arch. Neurol., 59:743–747.

22.

Morris

M.C.

, Depollier

, Mery

et al. 2001. A peptide carrier for the delivery of biologically active proteins into mammalian cells. Nat. Biotechnol., 19:1173–1176.

23.

Moscou

M.J.

, Bogdanove

A.J.

2009. A simple cipher governs DNA recognition by TAL effectors. Science, 326:1501.

24.

Ohshima

, Shin

J.H.

, Yuasa

et al. 2009. Transduction efficiency and immune response associated with the administration of AAV8 vector into dog skeletal muscle. Mol. Ther., 17:73–80.

25.

Pandolfo

1999. Molecular pathogenesis of Friedreich ataxia. Arch. Neurol., 56:1201–1208.

26.

Pandolfo

2006. Iron and Friedreich ataxia. J. Neural Transm. Suppl. Suppl. 2006:143–146.

27.

Pandolfo

2012. Friedreich ataxia. Handb. Clin. Neurol., 103:275–294.

28.

Paul

A.V.

, Mugavero

, Molla

, Wimmer

1998. Internal ribosomal entry site scanning of the poliovirus polyprotein: Implications for proteolytic processing. Virology, 250:241–253.

29.

Romer

, Recht

, Lahaye

2009. A single plant resistance gene promoter engineered to recognize multiple TAL effectors from disparate pathogens. Proc. Natl. Acad. Sci. U.S.A., 106:20526–20531.

30.

Romer

, Recht

, Strauss

et al. 2010. Promoter elements of rice susceptibility genes are bound and activated by specific TAL effectors from the bacterial blight pathogen, Xanthomonas oryzae pv. oryzae. New Phytol., 187:1048–1057.

31.

Rotig

, de Lonlay

, Chretien

et al. 1997. Aconitase and mitochondrial iron–sulphur protein deficiency in Friedreich ataxia. Nat. Genet., 17:215–217.

32.

Scholze

, Boch

2010. TAL effector–DNA specificity. Virulence, 1:428–432.

33.

Singh

, Binstadt

B.A.

, Black

D.F.

et al. 2001. Electroconvulsive therapy and Friedreich's ataxia. J. ECT, 17:53–54.

34.

Song

, Yang

2010. Mutagenesis of 18 type III effectors reveals virulence function of XopZ_PXO99 in Xanthomonas oryzae pv. oryzae. Mol. Plant Microbe Interact., 23:893–902.

35.

Tilstra

, Rehman

K.K.

, Hennon

et al. 2007. Protein transduction: Identification, characterization and optimization. Biochem. Soc. Trans., 35:811–85.

36.

Tinsley

J.M.

, Potter

A.C.

, Phelps

S.R.

et al. 1996. Amelioration of the dystrophic phenotype of mdx mice using a truncated utrophin transgene [see comments] Nature, 384:349–353.

37.

Vives

, Richard

J.P.

, Rispal

, Lebleu

2003. TAT peptide internalization: Seeking the mechanism of entry. Curr. Protein Pept. Sci., 4:125–132.

38.

Wallis

, Shaw

, Wilkes

et al. 1989. Prenatal diagnosis of Friedreich ataxia. Am. J. Med. Genet., 34:458–461.

39.

, Streubel

, Balzergue

et al. 2011. Colonization of rice leaf blades by an African strain of Xanthomonas oryzae pv. oryzae depends on a new TAL effector that induces the rice nodulin-3 Os11N3 gene. Mol. Plant Microbe Interact., 24:1102–1113.

40.

Zhang

, Cong

, Lodato

et al. 2011. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat. Biotechnol., 29:149–154.

TALE no.	HPRT1	G6PD	GAPDH	18S
1	1.0	1.0	1.7	0.9
3	1.6	1.3	1.1	1.4
4	1.4	1.3	1.6	1.0
5	1.3	1.3	2.0	1.1
6	1.1	1.2	1.4	1.3
8	1.8	1.9	3.1	1.7
9	1.3	1.3	1.5	1.1

TALE no.	HPRT1	G6PD	GAPDH	18S
1	1.0	1.0	1.7	0.9
3	1.6	1.3	1.1	1.4
4	1.4	1.3	1.6	1.0
5	1.3	1.3	2.0	1.1
6	1.1	1.2	1.4	1.3
8	1.8	1.9	3.1	1.7
9	1.3	1.3	1.5	1.1

Transcription Activator-Like Effector Proteins Induce the Expression of the Frataxin Gene

Abstract

Introduction

Materials and Methods

Construction of TALEFrat genes targeting the frataxin promoter

Construction of reporter vector

Quantitative real-time PCR for frataxin mRNA

Results

Expression of TALEFrat-VP64 proteins

TALEFrat-VP64 proteins induce expression of a reporter gene under the control of the frataxin promoter

TALEFrat-VP64 proteins increase expression of frataxin mRNA

Discussion

Footnotes

Acknowledgment

Author Disclosure Statement

References

Construction of TALE_Frat genes targeting the frataxin promoter

Expression of TALE_Frat-VP64 proteins

TALE_Frat-VP64 proteins induce expression of a reporter gene under the control of the frataxin promoter

TALE_Frat-VP64 proteins increase expression of frataxin mRNA

TALE no.	HPRT1	G6PD	GAPDH	18S
1	1.0	1.0	1.7	0.9
3	1.6	1.3	1.1	1.4
4	1.4	1.3	1.6	1.0
5	1.3	1.3	2.0	1.1
6	1.1	1.2	1.4	1.3
8	1.8	1.9	3.1	1.7
9	1.3	1.3	1.5	1.1