Ethanolic Extract of Vaccinium corymbosum Alleviates Muscle Fatigue in Mice

Abstract

The aim of this study was to evaluate the effects of ethanol extracts of Vaccinium corymbosum (VCE) on exercise-induced fatigue in mice. Mice were randomly divided into three groups; nonexercise control group (CON), exercise control group (Ex-CON), and exercise and VCE supplementation group (Ex-VCE). Compared with Ex-CON, Ex-VCE showed increased endurance exercise capacity on day 21. In Ex-VCE mice, the accumulation of lactate was inhibited and the consumption of fatty acids was enhanced, indicating the delay of muscle fatigue. In addition, VCE supplementation elevated mRNA expression levels of mitochondrial biogenesis-associated genes such as peroxisome proliferator-activated receptor-1γ coactivator 1α (PGC-1α), nuclear respiratory factor (NRF), and mitochondrial transcription factor A (Tfam) and fatty acid β-oxidation-associated genes such as carnitine palmitoyltransferase-1 (CPT-1), β-hydroxyacyl coenzyme A dehydrogenase (β-HAD), and peroxisome proliferator-activated receptor-δ (PPAR-δ). These results suggest that VCE can potentially prevent muscle fatigue by enhancing mitochondrial biogenesis and fatty acid β-oxidation.

Exercise is important for maintaining good health. Lack of exercise is one the causes of obesity and metabolic disease.¹ Exercise and the length of time taken for exercise are important, especially in the context of obesity. If the exercise time is short, weight loss will not occur. Therefore, it is important to delay muscle fatigue during exercise, and there are many ways to achieve this.² The first method inhibiting muscle fatigue is to suppress the production of fatigue components, leading to an increase in the exercise time.³ Moreover, increasing the consumption of fat can suppress the supply of glucose to the muscles. To increase fat consumption, gene expression in muscles must also be altered.⁴ Fatty acid β-oxidation is controlled by carnitine palmitoyltransferase-1 (CPT-1), β-hydroxyacyl coenzyme A dehydrogenase (β-HAD), and peroxisome proliferator-activated receptor-δ (PPAR-δ). In addition, increased mitochondrial biogenesis in muscle inhibits muscle fatigue.⁵ Mitochondrial biogenesis is controlled by peroxisome proliferator-activated receptor-1γ coactivator 1α (PGC-1α), nuclear respiratory factor-1 (NRF-1), and mitochondrial transcription factor A (Tfam).⁶

Vaccinium corymbosum, also known as blueberry, is an important crop in the United States, Mexico, France, Germany, and Spain. Several studies show the well-described antioxidant, anti-obesity, and anticancer activities of V. crymbosum.^7
–9 However, data supporting the effect of V. crymbosum on muscle fatigue and its underlying mechanisms are lacking. Therefore, this study aimed to investigate the anti-fatigue properties of V. corymbosum ethanol extract (VCE) on endurance exercise capacity in mice.

Vaccinium corymbosum fruit (50 g) powder was refluxed for 3 h at 250°C with 70% ethanol. The VCE was concentrated with a decompression rotary evaporator. The extract was then frozen, and dried into powder (30.5 g). All animal studies were approved by the Chonnam National University Institutional Animal Care and Use Committee (CNU IACUC-YB-2016-45). Four-week-old male ICR mice were obtained from Orient Bio (Seongnam, Korea). Mice were maintained under controlled environmental conditions (temperature 23 ± 2°C; humidity 50 ± 5%; and 12/12 h light/dark cycle). The mice were divided into three groups after an adaptation period of 1 week based on their mean body weights and exhaustive swimming times. Mice were then divided into the nonexercise control group (CON), the exercise control group (Ex-CON), and the exercise and VCE supplementation group (Ex-VCE). The CON and Ex-CON groups were given distilled water, and the Ex-VCE group was given 1 g/kg body weight/day of VCE. Mice were subjected to swimming exercise to evaluate exhaustive swimming exercise capacity. The swimming exercise was carried out in a transparent acrylic water tank (90 × 45 × 45 cm) filled with water up to a height of 35 cm, with the water temperature was maintained at 34°C, and equipped with a pump and flow meter of 8 L/min.¹⁰

We selected an exhaustive swimming test to assess the degree of physical fatigue, wherein the exhaustive swimming time indicated the degree of fatigue.¹¹ There was no difference between the Ex-CON and Ex-VCE groups in swimming time when VCE was not administered (0 day), but there was a significant difference in swimming time when VCE was administered for 21 days (Fig. 1). These results indicated that orally administered VCE increased the endurance exercise capacity of the mice. According to previous studies, phytochemicals and plant extracts can induce performance-enhancing capability.^3,12

FIG. 1.

Effect of VCE on endurance exercise capacity in mice. The Ex-CON group received water, whereas the Ex-VCE received VCE (1 g/kg body weight/day). The exhaustive swimming time was tested in a swimming pool at a flow rate of 8 L/min. Values are expressed as mean ± SE. * P < .05 compared with Ex-CON. Ex-CON, exercise control group; Ex-VCE, exercise and VCE supplementation group; SE, standard error; VCE, ethanol extract from Vaccinium corymbosum.

Lactate, a metabolite of glucose, is produced during anaerobic exercise in muscles. Accumulation of lactate induces muscle fatigue.¹³ Nonesterified fatty acid (NEFA) is a fatty acid that is degraded by lipoprotein lipase in adipocytes. When NEFA is used as an energy source, the consumption of glucose is reduced, and NEFA can produce a large amount of energy.¹⁴ Blood lactate and NEFA levels were measured before and after exercise by collecting blood from the mice. Blood lactate levels were measured using a commercial test strip. NEFA levels were measured using a commercial kit. On day 21 of the test, each group performed 25% of the exhaustive swimming time to check the accumulation of lactate. Lactate levels were increased in both Ex-CON and Ex-VCE groups after exercise, but were significantly lower in the Ex-VCE group than in the Ex-CON group (Fig. 2a). Skeletal muscle helps remove lactate from blood. However, when strenuous exercise is performed, muscle fatigue occurs owing to the elevated lactate production to a point that exceeds the rate of lactate removal.¹⁵ Our observations suggest that reduced lactate accumulation in the blood during exercise by the administration of VCE to mice leads to the alleviation of muscle fatigue, which results in the prolonged swimming time.

FIG. 2.

Effect of VCE on (a) blood lactate levels and (b) NEFA levels in mice. The Ex-CON group received water, whereas the Ex-VCE received VCE (1 g/kg body weight/day). Blood lactate and NEFA concentrations were measured before and 10 min after the swimming exercise. Values are expressed as mean ± SE. * P < .05 compared to Ex-CON. NEFA, nonesterified fatty acid.

NEFA levels were found to be significantly higher in the Ex-VCE group than those in the Ex-CON group (Fig. 2b), indicating the increased the consumption of free fatty acids by VCE supplementation. During intense exercise, efficient supply of an energy source postpones the appearance of fatigue. The increased availability of NEFA plays an important role in skeletal muscle metabolism, thereby delaying muscle fatigue.¹⁶

Glycogen depletion is also an indicator for determining muscle fatigue.¹⁷ To measure glycogen levels, muscle tissue was obtained by dissecting mice 4 h after the last exhaustive swimming training session. After homogenization of the tissue with liquid nitrogen, glycogen levels were measured by the anthrone method.¹⁵ Muscular glycogen is consumed during exercise; however, in the Ex-VCE group, glycogen levels were significantly higher than those in the Ex-CON group (Fig. 3). Ex-VCE mice was delayed the utilization of glycogen during exercise. Combined with our result of fatty acid availability as an energy source during the exercise, this finding suggests that VCE supplementation can effectively inhibit muscle fatigue in mice by facilitating fatty acid utilization with a reduced rate of muscle glycogen breakdown.

FIG. 3.

Effect of VCE on muscular glycogen levels in mice. The Ex-CON group received water, whereas the Ex-VCE group received VCE (1 g/kg body weight/day). Values are expressed as mean ± SE. Different letters indicate significant difference (P < .05) compared to CON.

Muscular mRNA expression levels of genes related to mitochondrial biogenesis and fatty acid β-oxidation were also measured. The mRNA of the target gene was reverse transcribed using total RNA (INtRON Biotechnology, Seongnam, Korea), and cDNA was synthesized. The gene involved in mitochondrial biogenesis and fatty acid β-oxidation was detected by qPCR using SYBR Green PCR Master Mix (Qiagen, Hilden, Germany). The primer sequences used in this experiment are given in Table 1. The factors involved in mitochondrial biogenesis include PGC-1α, NRF-1, and Tfam. Mitochondria play an essential role in generating energy, and are abundantly present in muscle cells. There are higher numbers of mitochondria in the muscle cell of marathon runners than those in the general population.¹⁸ An increase in mitochondrial biogenesis allows the generation of energy for a longer period of time.¹⁹ PGC-1α, a key regulator of mitochondrial biogenesis, activates NRF-1 expression.²⁰ NRF-1 is involved in cellular growth and mitochondrial DNA transcription and activates the expression of Tfam, which is a key activator of mitochondrial transcription and gene replication.²¹ The mRNA levels of mitochondrial biogenesis-related factors were found to be increased after VCE supplementation. As given in Figure 4a, the mRNA levels of factors associated with mitochondrial biogenesis were higher in the Ex-VCE group than that in the other groups. These results imply that VCE may lead to prolonged exercise and delay in muscle fatigue.

FIG. 4.

Effect of VCE on mRNA expression levels of (a) mitochondrial biogenesis and (b) fatty acid β-oxidation-related factors in the muscles of mice. The Ex-CON group received water, whereas the Ex-VCE group received VCE (1 g/kg body weight/day). Values are expressed as mean ± SE. Different letters indicate significant differences (P < .05) compared with CON.

Table 1.

Real-Time Polymerase Chain Reaction Primer Sequences

Target	Primer sequence (5′→3′)
PGC-1α
Forward	CACGTTCAAGGTCACCCTACAG
Reverse	CTACCGACTTCAACCTGCTTC
NRF-1
Forward	GGCCAGCACCTTTGG
Reverse	GGTCTTCCAGGATCATGCTCTT
Tfam
Forward	GGATGATTCGGCTCAGGGAA
Reverse	CTACCGACTTCAACCTGCTTC
CPT-1
Forward	GTGACTGGTGGGAGGAATAC
Reverse	GAGCATCTCCATGGCGTAG
β-HAD
Forward	GACAGGGTCATGCTATGATTGTG
Reverse	TCGGTCGCCTCCTTCTAGAG
PPAR-δ
Forward	CGCAAGCCCTTCAGTGACAT
Reverse	CGCATTGAACTTGACAGCAAA

CPT-1, carnitine palmitoyltransferase 1; β-HAD, β-hydroxyacyl coenzymes A dehydrogenase; NRF-1, nuclear respiratory factor-1; PGC-1α, peroxisome proliferator-activated receptor-γ coactivator-1α; PPAR-δ, peroxisome proliferator-activated receptor-δ; Tfam, mitochondrial transcription factor A.

Fatty acid β-oxidation is one of the energy-generating metabolic pathways and utilizes fatty acids as energy source. The factors involved in fatty acid β-oxidation include CPT-1, β-HAD, and PPAR-δ. CPT-1 is an enzyme present in the outer mitochondrial membrane, which allows fatty acids to enter the mitochondria.²² Fatty acids that enter the mitochondria are used as energy sources. β-HAD, is an oxidoreductase, catalyzes the third step of fatty acid β-oxidation that is involved in the oxidation of L-3-hydroxyacyl CoA by NAD⁺.²³ The levels of muscle PPAR-δ, a nuclear hormone receptor, increased in response to exercise, which in turn increases fatty acid β-oxidation.²⁴ Compared with the expressions in Ex-CON mice, EX-VCE mice had significantly upregulated mRNA expressions of CPT-1, β-HAD, and PPAR-δ (Fig. 4b). The mRNA expressions of factors associated with fatty acid β-oxidation showed expression profiles similar to those shown by the mitochondrial biogenesis-related genes. From these observations, we speculated that VCE improves metabolic efficiency, and related molecules may alleviate muscle fatigue.

In conclusion, our results indicated that VCE supplementation to mice significantly increased exercise endurance capacity by inhibiting muscle fatigue. It is presumed that the mechanism of antimuscle fatigue may be to enhance the utilization of energy substrates and activate energy-generating metabolic pathways by VCE. The knowledge gained from this study could aid in the development of effective therapeutics to suppress the development of muscle fatigue.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This study was financially supported by Chonnam National University (grant no. 2016-2797).

References

Fock

, Khoo

: Diet and exercise in management of obesity and overweight. J Gastroenterol Hepatol, 2013; 28:59–63.

Slentz

, Duscha

, Johnson

, et al.: Effects of the amount of exercise on body weight, body composition, and measures of central obesity. Arch Intern Med, 2004; 164:31–39.

, Huang

, Liao

, et al.: Resveratrol protects against physical fatigue and improves exercise performance in mice. Molecules, 2013; 18:4689–4702.

Mayumi

, Tomoyuki

, JiroT, Kazunaga

: Effects of astaxanthin supplementation on exercise-induced fatigue in mice. Biol Pharm Bull, 2006; 29:2106–2110.

Cho

, Hazen

, Gandra

, et al.: Perm1 enhances mitochondrial biogenesis, oxidative capacity, and fatigue resistance in adult skeletal muscle. FASEB J, 2016; 30:674–687.

Hood

, Uguccioni

, Vainshtein

, D'souza

: Mechanisms of exercise-induced mitochondrial biogenesis in skeletal muscle: Implications for health and disease. Compr Physiol, 2011; 1:1119–1134.

Lee

, Kim

, Choi

: Antioxidative activity of blueberry leaf extract prevents high-fat diet-induced obesity in C57BL/6 mice. J Cancer Prev, 2014; 19:209–215.

Zafra-Stone

, Yasmin

, Bagchi

, et al.: Berry anthocyanins as novel antioxidants in human health and disease prevention. Mol Nutr Food Res, 2007; 51:675–683.

Çoban

, Betül-Kalaz

, Küçükgergin

, et al.: Blueberry treatment attenuates D-galactose-induced oxidative stress and tissue damage in rat liver. Geriatr Gerontol Int, 2014; 14:490–497.

10.

Kim

, Park

, Yoon

, et al.: Effect of ethanol extract of Canavalia gladiata on endurance swimming capacity in mice. J Med Food, 2016; 19:990–993.

11.

Kim

, Yu

, Kang

, Suh

: Anti-stress and anti-fatigue effect of fermented rice bran. Phyther Res, 2002; 16:700–702.

12.

Seo

, You

, Yoon

, et al.: Rosa rugosa aqueous extract alleviates endurance exercise-induced stress. J Med Food, 2015; 13:711–713.

13.

You

, Kim

, Heo

, et al.: Stimulatory effects of Pseudosasa japonica leaves on exercise performance. Biosci Biotechnol Biochem, 2006; 70:2532–2535.

14.

Jeong

, Kim

O-K

, Park

, et al.: Ethanol extract of Eriobotrya japonica leaves enhanced swimming capacity in mice. J Food Nutr Res, 2017; 5:413–417.

15.

You

, Kim

, Yoon

, et al.: Sasa Borealis extract efficiently enhanced swimming capacity by improving energy metabolism and the antioxidant defense system in mice. J Nutr Sci Vitaminol, 2015; 61:488–496.

16.

Ikeuchi

, Yamaguchi

, Koyama

, Sono

, Yazawa

: Effects of fenugreek seeds (Trigonella foenum greaecum) extract on endurance capacity in mice. J Nutr Sci Vitaminol, 2006; 52:287–292.

17.

Yuan

, Wu

, Sun

, et al.: Anti-fatigue activity of aqueous extracts of Sonchus arvensis L. in exercise trained mice. Molecules, 2019; 24:1168.

18.

Pogozelski

, Geng

, Li

, et al.: P38Γ mitogen-activated protein kinase is a key regulator in skeletal muscle metabolic adaptation in mice. PLoS One, 2009; 4:7934–7944.

19.

Chang

, Chen

, Cheng

, et al.: Effects of resveratrol, epigallocatechin gallate, and epicatechin on mitochondrial functions in C2C12 myotubes. J Funct Foods, 2017; 35:507–512.

20.

Sun

, Zemel

: Leucine modulation of mitochondrial mass and oxygen consumption in skeletal muscle cells and adipocytes. Nutr Metab, 2009; 6:26.

21.

Theilen

, Kunkel

, Tyagi

: The role of exercise and TFAM in preventing skeletal muscle atrophy. J Cell Physiol, 2017; 232:2348–2358.

22.

Tunstall

, Mehan

, Wadley

, et al.: Exercise training increases lipid metabolism gene expression in human skeletal muscle. Am J Physiol Endocrinol Metab, 2002; 283:72–78.

23.

Brito-Alves

, Toscano

, Costa-Silva

, et al.: Transcriptional response of skeletal muscle to a low protein perinatal diet in rat offspring at different ages: The role of key enzymes of glucose-fatty acid oxidation. J Nutr Biochem, 2017; 41:117–123.

24.

Dobrzyn

, Pykowska

, Jazurek

, et al.: Endurance training-induced accumulation of muscle triglycerides is coupled to upregulation of stearoyl-CoA desaturase 1. J Appl Physiol, 2010; 109:1653–1661.