Dissemination of Trimethoprim–Sulfamethoxazole Drug Resistance Genes Associated with Class 1 and Class 2 Integrons Among Gram-Negative Bacteria from HIV Patients in South India

Abstract

The antibiotic, trimethoprim–sulfamethoxazole (TMP-SMX), is generally used for prophylaxis in HIV individuals to protect them from Pneumocystis jiroveci infection. Long-term use of TMP-SMX develops drug resistance among bacteria in HIV patients. The study was aimed to detect the TMP-SMX resistance genes among gram-negative bacteria from HIV patients. TMP-SMX-resistant isolates were detected by the Kirby-Bauer disc diffusion method. While TMP resistance genes such as dfrA1, dfrA5, dfrA7, and dfrA17 and SMX resistance genes such as sul1 and sul2 were detected by multiplex PCR, class 1 and class 2 integrons were detected by standard monoplex PCR. Of the 151 TMP-SMX-resistant bacterial isolates, 3 were positive for sul1 alone, 48 for sul2 alone, 11 for dfrA7 alone, 21 for sul1 and sul2, 1 for sul1 and dfrA7, 23 for sul2 and dfrA7, 2 for sul2 and dfrA5, 41 for sul1, sul2, and dfrA7, and 1 for sul2, dfrA5, and dfrA7. Of 60 TMP-SMX-resistant isolates positive for integrons, 44 had class 1 and 16 had class 2 integrons. It was found that the prevalence of sul genes (n = 202; p < 0.001) was higher compared with dfr genes (n = 80; p < 0.001), and 87.4% (n = 132; p < 0.001) of TMP-SMX-resistant isolates also were positive for β-lactamase production. This type of study is reported for the first time from HIV patients in India. Therefore, this study indicates that dissemination of TMP-SMX resistance genes and class 1 and class 2 integrons along with β-lactamase production among gram-negative bacteria in HIV patients will certainly make their treatment to bacterial infections more complicated in clinical settings.

Introduction

Trimethoprim–sulfamethoxazole (TMP-SMX) is a low-cost broad-spectrum antibiotic used globally for several years for the treatment of community-acquired infections in HIV patients.¹ In particular, TMP-SMX is an active drug against Pneumocystis pneumonia (PCP) among HIV-infected patients and it also reduces the mortality rate due to opportunistic infections in children and adults when used as a prophylactic drug.^2,3 World Health Organization and Joined Nations Programme on HIV/AIDS have recommended TMP-SMX prophylaxis for immunosuppressed adults and children born to HIV-infected women.^4,5 Long-term receiving of TMP-SMX prophylaxis has lead to increase in development of TMP-SMX resistance in bacteria, which can be spread to the community at large level.⁶ In Enterobacteriaceae, sulfonamide drug resistance genes such as sul1, sul2, and sul3 are responsible for dihydropteroate synthases, and more than 20 dihydrofolate reductase (dfr) genes conferring resistance to trimethoprim have been reported. Moreover, integrons play a major role in capturing the multiple drug-resistant genes as cassettes and in localization on transposons and conjugative plasmids and also in the spread of drug resistance among gram-negative bacteria. The dfr genes have been reported most frequently as cassettes in class 1 integrons and in association with a wide range of other drug resistance genes and also very few dfr genes occurred within class 2 integrons.⁷ Bacterial drug resistance to TMP-SMX along with extended-spectrum β-lactamase (ESBL) production among Enterobacteriaceae makes it difficult to treat the bacterial infections in HIV patients.⁸ There are no reports on the genes responsible for TMP-SMX drug resistance among bacteria in HIV patients in India till date. Hence, this study was aimed to detect the TMP-SMX drug resistance genes along with class 1 and class 2 integrons among bacterial isolates from HIV patients.

Materials and Methods

Ethics

Ethical clearance for this study was obtained from the Institutional Review Board of YRG Centre for AIDS Research and Education (YRG CARE), VHS Hospital, India (IRB approval no. YRG 259 A).

Bacterial isolates from HIV patients

The positivity of HIV patients attending YRG CARE was identified by standard combination rapid tests as per National AIDS Control Organization guidelines.⁹ Bacterial isolates from clinical specimens of HIV patients were characterized by standard biochemical procedures.

Detection of TMP-SMX resistance

TMP-SMX resistance was detected by the Kirby-Bauer disc diffusion method¹⁰ using trimethoprim–sulfamethoxazole disc (1.25/23.75 μg) (HiMedia Laboratories, Mumbai, India).

Detection of ESBL production

The combination disc method was carried out as per guidelines of Clinical and Laboratory Standards Institute¹⁰ using both cefotaxime and ceftazidime, alone and in combination with clavulanic acid. In this method, an overnight culture suspension of the test isolates was adjusted to 0.5 McFarland's standard. Lawn culture was made on the surface of Mueller-Hinton agar plate. The cefotaxime (30 μg) and cefotaxime–clavulanic acid (30/10 μg) discs were placed 20 mm apart on the agar surface. Similarly, the ceftazidime (30 μg) and ceftazidime–clavulanic acid (30/10 μg) (HiMedia Laboratories) discs were also placed. After incubation overnight at 37°C, a ≥5 mm increase in the zone diameter was interpreted as positive for ESBL production.

Detection of metallo-β-lactamase production

Metallo-β-lactamase (MBL) production was also detected by the combination disc method. Two imipenem (IPM) (10 μg) discs, one disc with anhydrous Ethylenediaminetetraacetic acid (EDTA) (750 μg) and another without anhydrous EDTA, were placed 25 mm apart on the agar surface. After incubation overnight at 37°C, a >4 mm increase in the zone diameter around the imipenem-EDTA disc compared with the imipenem alone was considered positive for MBL production.¹⁰

Detection of AmpC β-lactamase production

AmpC β-lactamase production was also checked by the combination disc method. The cefoxitin (30 μg) and cefoxitin–cloxacillin (30/200 μg) discs were placed 20 mm apart on the agar surface. After incubating overnight at 37°C, a ≥5 mm increase in the zone diameter was interpreted as positive for AmpC production.¹⁰

Antibiotic susceptibility test

Antibiotic susceptibility pattern of the bacterial isolates was detected by the Kirby-Bauer disc diffusion method¹⁰ using the antibiotics, namely amikacin (AMK; 30 μg), ampicillin (AMP; 10 μg), aztreonam (ATM; 30 μg), cefpodoxime (CPD; 30 μg), cefoperazone (CFD; 75 μg), erythromycin (ERY; 15 μg), doxycycline (DOX; 30 μg), chloramphenicol (CHL; 30 μg), ceftriaxone (CRO; 30 μg), cefotaxime (CTX; 30 μg), ceftazidime (CAZ; 30 μg), cefoxitin (FOX; 30 μg), ciprofloxacin (CIP; 5 μg), co-trimoxazole (COT; 25 μg), ertapenem (ETP; 10 μg), gentamicin (GEN; 10 μg), imipenem (IPM; 10 μg), piperacillin (PIP; 100 μg), piperacillin–tazobactam (TZP; 100/10 μg), nalidixic acid (NAL; 30 μg), tetracycline (TET; 30 μg), and trimethoprim (TMP; 5 μg) (HiMedia Laboratories).

Polymerase chain reaction

TMP-SMX resistance genes

The genes responsible for sulfamethoxazole (sul1 and sul2)¹¹ as well as trimethoprim (dfrA1, dfrA5, dfrA7, and dfrA17) drug resistance were detected by multiplex PCR described previously.^12,13 Primer sequences and thermal conditions used in this study are given in Table 1. A single colony of each bacterial organism was inoculated into 5 ml of nutrient broth (HiMedia Laboratories) and incubated for 16–18 h at 37°C. Bacterial cells from 1.5 ml of the overnight culture were harvested by centrifugation at 17,310g for 5 min. The supernatant was decanted and the pellet was resuspended in 500 μl of PCR water (Qiagen, USA). The cells were lysed by heating at 95°C for 10 min and cellular debris was removed by centrifugation. Supernatant was used as the DNA template for PCR amplification. Taq polymerase, deoxynucleotide triphosphates (dNTPs), and 10 × buffer (Eurofin, India) were added subsequently for PCR. After PCR completion, amplified genes were detected by 2% agarose gel electrophoresis. One hundred base pair DNA ladder was used as marker to detect the gene size.

Table 1.

Primer Sequences and Polymerase Chain Reaction Cycling Conditions of Trimethoprim–Sulfamethoxazole Drug-Resistant Genes and Integrons

Target gene	Primer sequence	References
sul 1
sul 1 F	CGGCGTGGGCTACCTGAACG	Kerrn et al.¹¹
sul 1 R	GCCGATCGCGTGAAGTTCCG
sul 2
sul 2 F	GCGCTCAAGGCAGATGGCATT	Kerrn et al.¹¹
sul 2 R	GCGTTTGATACCGGCACCCGT
dfrA1
dfrA1 F	GGAGTGCCAAAGGTGAACAGC	Toro et al.¹²
dfrA1 R	GAGGCGAAGTCTTGGGTAAAAAC
dfrA5
dfrA5 F	AGCTACTCTTTAAAGCCTTGACGTA	Grape et al.¹³
dfrA5 R	GTGTTGCTCAAAAACAACTTCG
dfrA7
dfrA7& 17 F	ACATTTGACTCTATGGGTGTTCTTC	Grape et al.¹³
dfrA7 R	ACCTCAACGTGAACAGTAGACAAAT
dfrA17
dfrA17 R	TCTCTGGCGGGGGTCAAATCTAT	Grape et al.¹³
Class 1 integron
intI1 F	GGTCAAGGATCTGGATTTGG	Machado et al.¹⁴
intI1 R	ACATGCGTGTAAATCATCGTC
Class 2 integron
intI2 F	CACGGATATGCGACAAAAAGGT	Machado et al.¹⁴
intI2 R	GTAGCAAACGAGTGACGAAATG

Integrase genes

Class 1 and class 2 integron positivity of TMP-SMX-resistant bacteria was detected by standard monoplex PCR.¹⁴ Primer sequences and conditions employed are given in Table 1.

ESBL, MBL, and AmpC-producing genes

ESBL-producing genes, TEM¹⁵ and CTX-M,¹⁶ AmpC genes, MOX, CIT, DHA, ACC, and FOX,¹⁷ MBL genes, IMP, VIM, GIM, SPM, and SIM,¹⁸ and OXA¹⁹ carbapenemase-producing genes among TMP-SMX-resistant isolates were detected using PCR.

DNA sequencing

The PCR products of TEM, CTX-M, CIT, DHA, sul1, sul2, dfrA5, dfrA7, class 1 integron, and class 2 integron genes were sent to Yaazh Genomics (India) for standard gene sequencing. The sequences of these genes were subjected to Basic Local Alignment Search Tool (BLAST) analysis and their sequences were deposited in National Centre for Biotechnology Information (NCBI).

Statistical analysis

Statistical analysis of the results of the study was done by SPSS software, version 10.0. Chi-square test was used for determination of significance of association. A p-value ≤0.05 was considered as significant.

Results

Distribution of bacterial isolates

A total of 151 TMP-SMX drug-resistant bacterial isolates from HIV patients were included in this study. Of these 151 isolates, 88 (58.3%) were collected from male and 63 (41.7%) from female HIV-positive patients, respectively. About 116 isolates were obtained from urine specimens, 20 from pus, 13 from sputum, and 2 from blood specimens (Table 2). Age-wise distribution of bacterial isolates indicated that 6 (4%), 72 (48%), 58 (38.4%), 13 (8.6%), and 2 (1.3%) isolates were between age groups 1–20 (median age 12 years), 21–40 (median age 35 years), 41–60 (median age 52 years), 61–80 (median age 61 years), and above 80 (median age 87 years), respectively. Among 151 bacterial isolates, 77 were Escherichia coli, 22 Klebsiella pneumoniae, 19 Klebsiella oxytoca, 17 Pseudomonas aeruginosa, 11 Proteus mirabilis, 4 Proteus vulgaris, and 1 Acinetobacter baumannii (Table 2 & Supplementary Table S1; Supplementary materials are available online at http://www.liebertpub.com/mdr).

Table 2.

Distribution of Bacterial Isolates in Clinical Samples from HIV Patients

		Clinical samples
S. No.	Organisms	Urine	Pus	Sputum	Blood	Skin scraping	Total	%	p
1	Escherichia coli	69	5	1	2	0	77	51	<0.001^S
2	Klebsiella pneumoniae	14	4	3	0	1	22	14.6	<0.001^S
3	Klebsiella oxytoca	16	0	3	0	0	19	12.6	<0.001^S
4	Pseudomonas aeruginosa	7	5	5	0	0	17	11.2	0.790^NS
5	Proteus mirabilis	8	2	1	0	0	11	7.3	020^S
6	Proteus vulgaris	2	2	0	0	0	4	2.6	0.564^NS
7	Acinetobacter baumannii	0	1	0	0	0	1	0.7	0.999^NS
Total		116	19	13	2	1	151	100	<0.001^S

NS, nonsignificant; S, significant.

CD4 cell count of HIV patients

The median CD4 cell count of the HIV patients included in this study was 296 cells/mm³ (ranged from 5 to 929 cells/mm³).

Antibiogram of TMP-SMX-resistant bacteria

All the 151 TMP-SMX drug-resistant isolates were multidrug resistant, demonstrating resistance to more than 7 antibiotics used and they showed highest resistance to erythromycin (98%), followed by ampicillin (94.1%), cefpodoxime (91.5%), aztreonam (90.8%), cefoperazone (90.2%), cefoxitin (89%), trimethoprim (87%), cefotaxime (87.6%), and ceftazidime (84.3%), and they showed highest sensitivity to ertapenem (85%), followed by amikacin (81%) (Table 3).

Table 3.

Number of Bacterial Isolates from HIV Patients Who Exhibited Resistance to Antibiotics

		Bacterial organisms
S. No.	Antibiotics	E. coli	K. pneumoniae	K. oxytoca	P. aeruginosa	P. vulgaris	P. mirabilis	A. baumannii	Total	%	p
1	AMK	10	2	5	4	1	4	1	27	17.9	0.018^S
2	AMP	75	21	19	16	3	7	1	142	94	<0.001^S
3	ATM	71	21	17	14	3	9	1	136	90	<0.001^S
4	CPD	71	21	18	17	2	7	1	137	91	<0.001^S
5	CFP	70	17	17	16	4	10	1	135	89.4	<0.001^S
6	ERY	76	22	18	17	4	11	1	149	99	<0.001^S
7	DOX	47	12	8	11	4	6	-	88	58.2	<0.001^S
8	CHL	10	5	3	9	2	4	1	34	22.5	0.024^S
9	CRO	66	12	16	11	3	3	1	112	74.2	<0.001^S
10	CIP	57	12	13	11	2	4	1	100	66.2	<0.001^S
11	ETP	8	6	3	1	2	1	1	22	14.6	0.021^S
12	GEN	25	9	6	9	2	4	-	55	36.4	<0.001^S
13	IPM	52	16	15	15	4	8	1	111	73.5	<0.001^S
14	PIP	70	19	17	15	2	5	1	129	85.4	<0.001^S
15	TZP	61	16	13	10	3	6	1	110	72.4	<0.001^S
16	NAL	71	15	19	14	4	10	1	134	88.7	<0.001^S
17	TET	52	13	9	14	4	9	-	101	66.9	<0.001^S
18	CTX	69	19	18	15	3	7	1	132	87.4	<0.001^S
19	CAZ	71	16	16	14	2	8	1	128	84.8	<0.001^S
20	FOX	69	18	18	14	4	11	1	135	89.4	<0.001^S

S, significant.

β-Lactamase production of TMP-SMX-resistant bacteria

A total of 132 (87.4%) TMP-SMX-resistant isolates showed positivity for β-lactamase production and, among them, 19 were positive for ESBLs, 21 for MBL, 10 for AmpC, 16 for ESBLs and MBL, 12 for ESBLs and AmpC, 23 for MBL and AmpC, and 31 for ESBLs, MBL, and AmpC. However, β-lactamase production was not detected in 19 isolates (Supplementary Table S1).

sul and dfr genes among TMP-SMX-resistant isolates

Molecular studies of the 151 TMP-SMX-resistant isolates revealed that 66 isolates were positive for sul1, 136 for sul2, 3 for dfrA5, and 77 for dfrA7 genes. Various combinations of TMP and SMX genes were also obtained and about 3 bacterial isolates were positive for the sul1gene alone, 48 for sul2 alone, 11 for dfrA7 alone, 21 for sul1 and sul2, 1 for sul1 and dfrA7, 23 for sul2 and dfrA7, 2 for sul2 and dfrA5, 41 for sul1, sul2, and dfrA7, and 1 for sul2, dfrA5, and dfrA7 genes. The dfrA5 gene was found to be associated with the sul2 and not with sul1 gene and none of the isolates were positive for dfrA1 and dfrA17 genes (Table 4 & Supplementary Table S1).

Table 4.

Distribution of Trimethoprim–Sulfamethoxazole-Resistant Genes and Class 1 and Class 2 Integrons

			TMP-SMX genes and class 1 and class 2 integrons
S. No.	Organisms	CD4 cell count (cells/mm ³ )	Sul 1	Sul 2	DfrA1	DfrA5	DfrA7	DfrA17	Class 1 integron	Class 2 integron
1	E. coli	06–956	40 (26.5)	69 (45.7)	0	0	50 (33.1)	0	21 (14)	8 (5.3)
2	K. pneumoniae	72–929	8 (5.3)	20 (13.2)	0	1 (0.7)	7 (4.6)	0	9 (6)	2 (1.3)
3	K. oxytoca	05–775	12 (7.9)	19 (12.6)	0	1 (0.7)	9 (6)	0	11 (7.3)	3 (2)
4	P. aeruginosa	47–767	4 (2.6)	16 (10.6)	0	0	3 (2)	0	0	0
5	P. mirabilis	06–775	0	7 (4.6)	0	0	7 (4.6)	0	2 (1.3)	2 (1.3)
6	P. vulgaris	08–594	1 (0.7)	4 (2.6)	0	1 (0.7)	0	0	1 (0.7)	1 (0.7)
7	A. baumannii	19–453	1 (0.7)	1 (0.7)	0	0	1 (0.7)	0	0	0
Statistical analysis		p	<0.001^S	<0.001^S	—	0.999^NS	<0.001^S	—	<0.001^S	0.047^S

NS, nonsignificant; S, significant; TMP-SMX, trimethoprim–sulfamethoxazole.

Positivity of class 1 and class 2 integron genes

Among the 151 TMP-SMX-resistant isolates, 40 had class 1 integron 1, 12 class 2 integron, and 4 both class 1 and class 2 integron genes. Of the 40 integron 1-positive isolates, 11 were positive for sul 2, 10 for sul 2 and dfrA7, 6 for sul1 and sul2, 7 for sul1, sul2, and dfrA7, 4 for dfrA7, 1for sul2 and dfrA5, and 1 for sul2, dfrA5, and dfrA7 genes. Of 12 class 2 integron-positive isolates, 3 were positive for sul2 alone, 2 for sul1 and sul2 genes, 6 for sul1, sul2, and dfrA7, and 1 for sul2 and dfrA7 genes. Among the 4 isolates that were positive for both class 1 and class 2 integron genes, 1 isolate was positive for sul2, 1 for sul1 and sul2, and 2 for sul2 and dfrA7 (Table 4 & Supplementary Table S1). All the integron-positive isolates were also found to be copositive for any one of the sul or dfr genes. The TMP-SMX resistance genes, sul1 (GenBank accession number KX688608), sul2 (KX688609), dfrA5, and dfrA7 (KX688610), and class 1 integron (KX688606) and class 2 integron (KX688607) genes were sequenced and submitted in NCBI.

Positivity of ESBL, MBL, and AmpC-producing genes

Among 78 isolates that were phenotypically positive for ESBL production, all the 78 were positive for the TEM gene and 73 for the CTX-M gene. TEM and CTX-M genes were sequenced and identified as TEM-116 (KU991932) and CTX-M 15 (KF640079), respectively, using BLAST analysis. Only 2 MBL-positive isolates were positive for both OXA 23-like and OXA 51-like genes and 4 for OXA 23-like genes. None of the isolates were positive for IMP, VIM, SIM, SPM, and GIM genes. A total of 14 isolates were positive for the CIT gene and 3 for DHA genes and FOX, MOX, ACC, and EBC genes were not found. Both the CIT and DHA genes were sequenced and identified as CMY-30 (KU991933) and DHA-1 (KX033372), respectively.

Discussion

TMP-SMX prophylaxis is administered worldwide to HIV-infected patients to protect them from opportunistic infections. Nowadays, there are threats of development of TMP-SMX resistance and spreading in the bacterial community and also causing therapeutic problems among bacterial infections in HIV patients.

In this study, 77 E. coli from HIV patients were found to be TMP-SMX resistant and, among them, 69 were from urine, 5 from pus, 2 from blood, and 1 from sputum samples. Besides 77 E. coli, 22 K. pneumoniae, 19 K. oxytoca, 17 P. aeruginosa, 11 P. mirabilis, 4 P. vulgaris, and 1 A. baumannii were also found to be TMP-SMX resistant in our study. Ngwai et al.²⁰ found that of 132 E. coli isolates from stool samples from HIV patients, 119 exhibited resistance to TMP-SMX. Padmavathy et al.²¹ reported that of 26 uropathogenic E. coli from HIV patients, 25 showed TMP-SMX resistance. Martin et al.⁶ had carried out a cross-sectional study of resistance to TMP-SMX among 7 genera of Enterobacteriaceae and they found that TMP-SMX resistance among all isolates was less than 5.5% from 1979 to 1986, but notably increased to 20.4% in 1995. In HIV-infected patients, TMP-SMX resistance increased from 6.3% in 1988 to 74% in 1995 and they also reported that the rapid increase in the prophylactic usage of TMP-SMX in HIV patients was responsible for the increase in TMP-SMX resistance. As per the EAU guidelines (2010), cotrimoxazole 160/800 mg bid for 3 days is recommended (as empirical therapy) only in areas with resistance rate <20% for E. coli. However, if cotrimoxazole resistance >20%, 160/800 mg bid for 14 days is recommended if the susceptibility of the pathogen is known and not at all for empirical therapy.²²

TMP-SMX prophylaxis might lead to an increase in resistance to other drugs besides TMP-SMX among common microbial pathogens.^7,23,24 In this study, of 151 TMP-SMX-resistant bacterial isolates from HIV patients, 132 were copositive for β-lactamase production and this situation may cause the development of increased multidrug-resistant bacteria. Among these 151 TMP-SMX-resistant bacterial isolates, 78 exhibited ESBL production, 91 MBL production, and 76 AmpC production and therefore multiple β-lactamase production was observed in this study. All the 78 phenotypically positive ESBL isolates were positive for the TEM gene and only 73 of them positive for the CTX-M gene. It was observed that among MBL-positive isolates, 2 were positive for both OXA23-like and OXA 51-like genes and only 4 for the OXA 23-like gene. A total of 14 AmpC-positive isolates were positive for the CIT gene and 3 for DHA. Marwa et al.²³ in 2015 reported that of the 72 bacterial isolates from HIV patients, 54 demonstrated TMP-SMX drug resistance and, among these 54 isolates, 14 tested positive for ESBL production. Rameshkumar et al. in 2014⁸ reported that of 103 bacterial isolates from HIV patients, 65 were resistant to TMP-SMX and, among the 65 isolates, 29 showed ESBL production.

Molecular studies on TMP-SMX resistance in bacteria from HIV patients have not been reported till date in India. Therefore, the genes responsible for TMP-SMX resistance in bacteria from HIV patients of this study were compared with that from non-HIV patients of other studies. In this study, among the 151 TMP-SMX-resistant isolates from HIV patients, 66 isolates were positive for sul1 and 136 for sul2 genes. Positivity of the sul2 gene is higher compared with sul1. The results of this study did not correlate with Dahmen et al.²⁴ who reported that positivity of the sul1 gene is higher compared with the sul2 gene. In their study, they found that of 80 TMP-SMX-resistant isolates from non-HIV patients, 71 isolates were positive for the sul1 gene, 54 for the sul2 gene, and 49 carried both sul1 and sul2 genes, and of 200 sulfonamide-resistant isolates, 118 were positive for sul1, 44 for sul2, 4 for sul3, 24 for sul1 and sul2, 4 for sul1 and sul3, and 6 for sul1, sul2, and sul3 and they also reported that the integrons are associated with sul gene positivity.²⁵

In this study, 80 TMP-SMX-resistant isolates had dfr genes and, among them, 77 had dfrA7 and 3 dfrA5 and none of them had shown dfrA1 and dfrA17 genes. In our study, sul genes were found to be higher when compared with dfr genes and also that 39.1% of the TMP-SMX-resistant isolates showed positivity for sul genes associated with dfr genes. The more prevalent dfr gene in this study is dfrA7. Our results did not agree with that of Grape et al.¹³ who reported highest positivity of dfr genes in dfrA1, followed by dfrA17. They also found that among 71 trimethoprim-resistant isolates, 53 showed positivity to dfr genes and, among them, 19 were dfrA1, 7 dfrA5, 5 dfrA7, 7 dfrA12, and 15 dfrA17.

In one study, of 80 Enterobacteriaceae isolates, 68 were positive for the class 1 integron gene and, among them, 27.5% were positive for sul1, 6.2% for sul2, and 61.2% for both sul1 and sul2 genes and also that 40% were positive for dfrA7 and 37% for dfrA17.²⁴ Class 1 integrons were found to be an important genetic element of resistance to TMP-SMX among the clinical isolates of Enterobacteriaceae.²⁶ In our study, among 44 class 1 integron-positive isolates, 61.3% were positive for sul2, 31.8% for both sul1 and sul 2, and 77.2% for dfrA7 genes. Our results differ from previous studies by showing that class 1 integron-positive isolates exhibited high positivity to the sul2 gene when compared with sul1 and a total of 2 isolates were positive for dfrA5 and also indicated that dfrA17 was not found. Interestingly, in this study, all class 1 and class 2 integron-positive isolates also showed β-lactamase production and they were found to be positive for any one of the TMP-SMX resistance genes. This could play a role in spreading of drug resistance genes among bacteria in the community.

Conclusions

This is the first report of dissemination of TMP-SMX resistance genes along with class 1 and class 2 integrons among gram-negative bacteria from HIV patients in India. This study revealed the evidence of impact of TMP-SMX prophylaxis in HIV patients because of development of TMP-SMX resistance genes among gram-negative bacteria. More careful clinical studies are required to monitor the duration of exposure of TMP-SMX in prophylaxis in HIV patients in the development of multidrug resistance among gram-negative bacteria to TMP-SMX and other groups of antibiotics.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Jones

J.L.

, Hanson

D.L.

, Dworkin

M.S.

, Aldeston

D.L.

, Fleming

P.L.

, Kaplan

J.E.

, and Ward

. 1999. Surveillance for AIDS-defining opportunistic illnesses, 1992–1997. MMWR CDC Surveill. Summ., 48:1–22.

Hardy

W.D.

, Feinberg

, Finkelstein

D.M.

, Power

M.E.

, He

, Kaczka

, Frame

P.T.

, Holmes

, Waskin

, Fass

R.J.

, and Powderly

W.G.

. 1992. A controlled trial of trimethoprim- sulfamethoxazole or aerosolized pentamidine for secondary prophylaxis of Pneumocystis carinii pneumonia in patients with the acquired immunodeficiency syndrome. AIDS Clinical Trials Group Protocol 021. N. Engl. J. Med., 327:1842–1848.

Chintu

, Bhat

G.J.

, Walker

A.S.

, Mulenga

, Sinyinza

, Lishimpi

, Farrelly

, Kagansan

, Zumla

, Gillespie

S.H.

, Nunn

A.J.

, Gibb

D.M.

, and CHAP Trial Team. 2004. Co-trimoxazole as prophylaxis against opportunistic infections in HIV-infected Zambian children (CHAP): a double-blind randomized placebo-controlled trial. Lancet, 364:1865–1871.

World Health Organization. 2000. Provisional WHO/UNAIDS Secretariat Recommendations on the Use of Cotrimoxazole Prophylaxis in Adults and Children Living with HIV/AIDS in Africa. WHO/UNAIDS, Geneva, Switzerland.

World Health Organization. 2006. Guidelines on Co-trimoxazole Prophylaxis for HIV Related Infections Among Children, Adolescents and Adults: Recommendations for a Public Health Approach. WHO/UNAIDS, Geneva, Switzerland.

Martin

J.N.

, Rose

D.A.

, Hadley

W.K.

, Perdreau-Remington

, Lam

P.K.

, and Gerberding

J.L.

. 1999. Emergence of trimethoprim-sulfamethoxazole resistance in the AIDS era. Clin. Infect. Dis., 180:1809–1818.

Mazel

2006. Integrons: agents of bacterial evolution. Nat. Rev. Microbiol., 4:608–620.

Rameshkumar

M.R.

, Vijaykanth

, Vignesh

, Balakrishnan

, Solomon

, and Arunagirinathan

. 2014. Trimethoprim sulfamethoxazole drug resistance with co-resistance to extended spectrum β-lactam antibiotics among bacterial isolates from HIV patients. BMC Infect. Dis., 14:57.

National AIDS Control Organization. 2007. Guidelines for HIV Testing. NACO, Government of India, New Delhi, pp. 39–40.

10.

Clinical and Laboratory Standards Institute (CLSI). 2012. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement (M100-S21). CLSI, Wayne, PA.

11.

Kerrn

M.B.

, Klemmensen

, Frimodt-Møller

, and Espersen

. 2002. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother., 50:513–516.

12.

Toro

C.S.

, Farfan

, Contreras

, Flores

, Navarro

, Mora

G.C.

, and Prado

. 2005. Genetic analysis of antibiotic- resistance determinants in multidrug-resistant Shigella strains isolated from Chilean children. Epidemiol. Infect., 133:81–86.

13.

Grape

, Motakefi

, Pavuluri

, and Kahlmeter

. 2007. Standard and real-time multiplex PCR methods for detection of trimethoprim resistance dfr genes in large collections of bacteria. Clin. Microbiol. Infect., 13:1112–1118.

14.

Machado

, Cantón

, Baquero

, Galán

J.C.

, Rollán

, Peixe

, and Coque

T.M.

. 2005. Integron content of extended-spectrum-β-lactamase-producing Escherichia coli strains over 12 years in a single hospital in Madrid, Spain. Antimicrob. Agents Chemother., 49:1823–1829.

15.

Oliver

, Weigel

L.M.

, Rasheed

J.K.

, McGowan

J.E.

Jr , Raney

, and Tenover

F.C.

. 2002. Mechanisms of decreased susceptibility to cefpodoxime in Escherichia coli. Antimicrob. Agents Chemother., 46:3829–3836.

16.

Pagani

, Dell'Amico

, Migliavacca

, D'Andrea

M.M.

, Giacobone

, Amicosante

, Romero

, and Rossolini

G.M.

. 2003. Multiple CTX-M-type extended-spectrum β-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. J. Clin. Microbiol., 41:4264–4269.

17.

Pérez-Pérez

F.J.

and Hanson

N.D.

. 2002. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using Multiplex PCR. J. Clin. Microbiol., 40:2153–2162.

18.

Ellington

M.J.

, Kistler

, Livermore

D.M.

, and Woodford

. 2007. Multiplex PCR for rapid detection of genes encoding acquired metallo β-lactamases. J. Antimicrob. Chemother., 59:321–322.

19.

Mostachio

A.K.

, Heidjen

I.V.

, Rossi

, Levin

A.S.

, and Costa

S.F.

. 2009. Multiplex PCR for rapid detection of genes encoding OXA and metallo-beta-lactamases in carbapenem resistant Acinetobacter spp. J. Med. Microbiol., 58:1552–1554.

20.

Ngwai

Y.B.

, Nwan Kwo

H.N.

, and Adoga

M.P.

. 2011. Multi-drug resistant Escherichia coli from human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) patients in Keffi, Nigeria. Int. Res. J. Microbiol., 2:122–125.

21.

Padmavathy

, Padma

, and Rajasekaran

. 2011. Detection of extended-spectrum β lactamases and AmpC β-lactamase production in Escherichia coli causing urinary tract infection among HIV and non-HIV patients. American Med. J., 1:54–58.

22.

Grabe

, Bjerklund-Johansen

T.E.

, Botto

, Çek

, Naber

K.G.

, Pickard

R.S.

, Tenke

, Wagenlehner

, and Wullt

. 2013. Guidelines on Urological Infections (NL-6803 AA ARNHEM). European Association of Urology, The Netherlands, pp. 146–162.

23.

Marwa

K.J.

, Mushi

M.F.

, Konje

, Alele

P.E.

, Kidola

, and Mirambo

M.M.

. 2015. Resistance to cotrimoxazole and other antimicrobials among isolates from HIV/AIDS and non-HIV/AIDS patients at Bugando Medical Centre, Mwanza, Tanzania. AIDS Res. Treat., 2015:1–8.

24.

Dahmen

, Poirel

, Mansour

, Bouallegue

, and Nordmann

. 2010. Prevalence of plasmid-mediated quinolone resistance determinants in Enterobacteriaceae from Tunisia. Clin. Microbiol. Infect., 16:1019–1023.

25.

Antunes

, Machado

, Sousa

J.C.

, and Peixe

. 2005. Dissemination of sulfonamide resistance genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica strains and relation with integrons. Antimicrob. Agents Chemother., 49:836–839.

26.

Dahmen

, Mansour

, Boujaafar

, Arlet

, and Boualleque

. 2010. Distribution of cotrimoxazole resistance genes associated with class 1 integrons in clinical isolates of Enterobacteriaceae in University of Hospital in Tunisia. Microb. Drug Resist., 16:43–47.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.04 MB