Enhanced Hematopoietic Differentiation Toward Erythrocytes from Murine Embryonic Stem Cells with HepG2-Conditioned Medium

Abstract

Embryonic stem cell (ESC) differentiation via embryoid body (EB) formation is an established method that generates the 3 germ layers. However, EB differentiation poses several problems including formation of heterogeneous cell populations. Previously, we have enhanced mesoderm derivation from murine ESCs (mESCs) using conditioned medium (CM) from HepG2 cells. We used this technique to direct hematopoiesis by generating “embryoid-like” colonies (ELCs) from mESCs without standard formation of EBs. Two predifferentiation conditions were tested: (1) mESCs cultured 3 days in standard predifferentiation medium (control) and (2) mESCs cultured 3 days in HepG2 CM (CM-mESCs). Both groups were then exposed to primary differentiation for 8 days (ELC-formation period) and 14 days of hematopoietic differentiation. Enhanced mesoderm formation was observed in the CM-mESC group with an almost 5-fold increase in ELC formation (P≤0.05) and higher expression of mesoderm genes—Brachyury-T, Goosecoid, and Flk-1—compared with those of control mESCs. Hematopoietic colony formation by CM-mESCs was also enhanced by 2-fold at days 7 and 14 with earlier colony commitment compared with those of control mESCs (P≤0.05). This early clonogenic capacity was confirmed morphologically by the presence of nucleated erythrocytes and macrophages as early as day 7 in CM-mESC culture using standard 14-day colony-forming assay. Early expression of hematopoietic primitive (ζ-globin) and definitive (β-globin) erythroid genes and proteins was also observed by day 7 in CM-mESC cultures. These data indicate that hematopoietic cells more quickly differentiate from CM-mESCs, compared with those using standard EB approaches, and provide an efficient bioprocess platform for erythroid-specific differentiation of ESCs.

Introduction

E mbryonic stem cells (ESCs) spontaneously differentiate in vitro through formation of embryoid bodies (EBs), tissue-like spheroids cultivated in suspension culture [1 –3]. EB formation recapitulates some aspects of early embryogenesis, including the formation of a complex 3-dimensional arrangement wherein cell–cell and cell–matrix interactions support the development of the 3 embryonic germ layers—mesoderm, ectoderm, and endoderm. Following EB formation, cells are returned to adherent culture conditions in order for directed differentiation to occur [4 –6]. However, EB-based methodologies are imprecise since spontaneous differentiation into the 3 germ layers is not controlled [4,5].

Blood is derived from mesoderm in direct competition with spontaneous angiogenic and cardiomyogenic differentiation [6 –9]. To recapitulate the process of blood formation from mesoderm in vitro, ESCs are allowed to form EBs for ∼5–8 days followed by terminal hematopoietic differentiation through the use of various supplements and cytokines [3,6,10]. Recent efforts in in vitro red cell production starting from ESCs with a view to clinical applications have resulted in successful serum-free cultures for hematopoietic differentiation and the production of functional nucleated red blood cells [11 –13]. However, these methods have all used EB formation and coculture with feeder cells or conditioned media (CM). Non-EB cultures of hematopoietic cells derived from ESCs can also be achieved with coculture using stromal cells [11,14 –16]. Although coculture provides microenvironmental cues for differentiation of ESCs, the method is labor intense and problematic in the separation of feeders from differentiated cells and the possible formation of heterokaryons within the culture [17]. Recombinant cytokines are used for more defined culture conditions for the controlled differentiation of mesoderm from ESCs. However, the method is costly and can, paradoxically, lead to multilineage development due to the redundant action of cytokines and morphogens, such as BMP-4 and Activin-A [5,18]. Alternatively, CM from the culture of differentiated somatic cells contain soluble factors, although largely undefined, that direct ESC differentiation into layers such as mesoderm in vitro and are less resource intensive, making it a practical alternative for the study of mesoderm derivatives in vitro [5,17,19 –21].

We have previously demonstrated that CM, obtained from cultures of the human hepatocarcinoma cell line HepG2, enhanced mesoderm formation from murine ESCs (mESCs) without EB formation [5]. HepG2 cells have characteristics similar to those of visceral endoderm, an early organizer during embryogenesis that secret signaling molecules specifying cell fate [19,22,23]. The similarities between liver carcinoma cell lines and visceral endoderm have led to the suggestion that HepG2 CM reiterate visceral endoderm-like signaling in this system [5,19]. Differentiation of mESCs cultured in HepG2 CM resulted in a restricted repertoire of cell types comprised of mesoderm and parietal endoderm providing an efficient method for enriched mesoderm formation in vitro [5,24]. Herein, we extend our studies of directed mesoderm differentiation from mESCs using HepG2 CM and present an efficient method for the in vitro development of the hematopoietic lineage, as an alternative process for potential study and application of in vitro erythropoiesis from ESCs.

Materials and Methods

Experimental and control groups were set up as shown in Fig. 1.

FIG. 1.

Experimental design: control murine embryonic stem cell (mESC) and conditioned medium (CM)-mESC groups. The control group consisted of normal mESC culture, exposed to standard Iscove's modified Dulbecco's medium (IMDM) prior to differentiation that had undergone an 8-day embryoid-like colony (ELC) formation period using primary differentiation medium followed by a further 14 days in the secondary hematopoietic differentiation medium, as previously described [54]. The experimental CM-mESC group consisted of mESCs previously exposed to HepG2 CM prior to differentiation, followed by the same 8-day ELC formation period using primary differentiation medium and a further 14 days of culture in the secondary hematopoietic differentiation medium, as explained previously. Both culture groups were analyzed simultaneously.

Predifferentiation culture of mESCs (“Control”)

Undifferentiated mESCs (E14/TG2-a cell line; ATCC; P<20) were maintained as previously reported [5]. Predifferentiation medium was prepared by addition of 15% (v/v) fetal bovine serum (FBS; Gibco), 1 mM sodium pyruvate (Sigma-Aldrich), 100 U/mL penicillin, 100 μg/mL streptomycin (Gibco), 2 mM l-glutamine (Gibco), 0.1 mM nonessential amino acids (Sigma-Aldrich), 10 ng/mL leukemia inhibitory factor (Milipore), and 100 μM monothioglycerol (Sigma-Aldrich) in Iscove's modified Dulbecco's medium (IMDM; Gibco).

HepG2 CM–treated mESCs (“CM-mESCs”)

Culture of HepG2 cells (ATCC; HB-8605) and CM preparation were performed as previously reported [5].

“Embryoid-like” formation in primary differentiation

mESCs (3×10³ cells/mL) were plated on low-adherence 35-mm Petri dishes (VWR International Ltd.) with semi-solid media containing 1% basic methylcellulose (Stem Cell Technologies), 15% FBS, 2 mM l-glutamine, 150 μM monothioglycerol (MTG), and 40 ng/mL murine stem cell factor (mSCF) (R&D Systems) in IMDM. On day 7, the cultures were supplemented with 160 ng/mL mSCF, 30 ng/mL murine interleukin (mIL)-3, 20 ng/mL human IL (hIL)-6, and 3 U/mL human erythropoietin (hEPO; all from R&D Systems) and were cultured for an additional day (day 8 of culture).

Hematopoietic colony forming unit assay

Eight-day-old embryoid-like colonies (ELCs) were disrupted and replated (2×10⁵ cells/mL) on low-adherence 35-mm Petri dishes (VWR) in IMDM (Gibco) supplemented with 15% FBS, 2 mM l-glutamine, 150 μM MTG, 1% BIT [1% bovine serum albumin (BSA), 10 μg/mL insulin, and 200 μg/mL transferrin; Stem Cell Technologies], 150 ng/mL mSCF, 30 ng/mL mIL-3, 30 ng/mL hIL-6, 3 U/mL hEPO (all from R&D Systems), and 1% basic methylcellulose medium (Stem Cell Technologies). Cells were incubated for an additional 14 days and resultant colonies were scored using standard criteria based on the manufacturer's instructions (Stem Cell Technologies Hematopoietic Manual) and published protocols for mESCs [25,26].

MTS assay

Cell proliferation was assessed using the Cell Titre 96 Aqueous One Solution Reagent MTS assay (Promega) as per the manufacturer's instructions. Briefly, 3×10⁴ cells/cm² were cultured for 1, 2, 3, 4, and 5 days. Absorbance values were read at 490 nm using an enzyme-linked immunosorbent assay reader (ELx808; Bio-Tek).

Live and dead assay

Cells were incubated at room temperature for 30 min with 4 mM ethidium homodimer-1 and 2 mM calcein AM solution (Invitrogen). Cells fixed with 70% alcohol were used as negative control. Images were visualized on an Olympus BX51 microscope (Olympus) and captured using the F-view unit (Soft Imaging System GmbH). Images were not manipulated.

Immunocytochemistry

Cells were fixed in 4% (w/v) paraformaldehyde (VWR), and 0.2% (v/v) Triton X-100 (VWR) followed by blocking with 3% (v/v) goat serum (Santa Cruz Biotechnology) at room temperature. Primary antibodies for Oct-4 (Rabbit polyclonal) and stage-specific embryonic antigen-1 (SSEA-1; murine clone MC-480) (all from Santa Cruz Biotechnology) were incubated at 4°C overnight. Secondary antibodies, goat anti-rabbit fluorescein isothiocyanate and goat anti-mouse Texas Red (all from Santa Cruz Technologies), were applied for 1 h at room temperature. Images were visualized on an Olympus BX51 microscope (Olympus) and captured using the F-view unit (Soft Imaging System GmbH). Images were not manipulated.

Wright-Giemsa staining

Cytospins (1×10⁶ cells/mL) were prepared. Slides were stained for 10 s in Wright-Giemsa stain (Sigma-Aldrich). Images were visualized with an Olympus BX51 microscope and captured using the DP50 camera (Olympus). Images were not manipulated.

Western blot analysis

Total protein was quantified using the BCA™ Assay Kit (Thermo Fisher Scientific). BSA was used as a known protein standard. Protein samples were mixed with 2 × SDS-PAGE sample buffer (Sigma). Protein blotting was performed in the C140 Mini Blot Module (Thermo Electron) at a constant current of 30 mA for 50 min. Membranes were blocked with 5% (w/v) nonfat milk solution (Sigma) for 2 hrs. Primary antibody was incubated overnight followed by application of the appropriate horseradish peroxidase-conjugated (HRP) secondary antibody for 1 h. Proteins were detected using the SuperSignal West Pico chemiluminescent substrate (Thermo Fisher Scientific). Primary antibodies are as follows: rabbit anti-mGata-1 polyclonal (1:200), rabbit anti-mζ-globin polyclonal (1:200), chicken anti-mβ-major globin polyclonal (1:200), and rabbit anti-mGAPDH polyclonal (1:20,000). Secondary antibodies, anti-rabbit and anti-chicken polyclonal IgG, were conjugated to HRP (1:10,000). All antibodies were from Santa Cruz Biotechnology.

Reverse transcriptase–polymerase chain reaction

Reverse transcriptase–polymerase chain reaction (RT-PCR) analysis was conducted using cDNA with primer sequences as listed in Table 1. PCR conditions were as follows: reverse transcription at 42°C for 45 min, Taq polymerase activation at 95°C for 2 min, thermal cycling at 95°C for 30 s, specific primer annealing temperature at 65°C for 60 s and for 25–35 cycles, elongation at 72°C for 60 s, followed by a final elongation step at 72°C for 5 min. Samples without cDNA were used as negative controls. Images from gel electrophoresis were captured using the Dyversity gel-documentation system using the Geneflash program (SynGene). Images were not manipulated.

Table 1.

List of Polymerase Chain Reaction Primers

Reverse transcriptase PCR primers
Genes	Forward 5′-3′	Reverse 5′-3′	Length (bp)	PCR cycles
Pluripotency
Oct-4	TGTGGACCTCAGGTTGACT	CTTCTGCAGGGCTTTCATGT	181	27
Rex-1	CGTGTAACATACACCTCCG	GAAATCCTCTTCCAGAATGG	129	27
Primitive ectoderm
FGF-5	AGTTTCCAGTGGAGCCCTTC	AATTTGGCACTTGCATGGAG	236	31
Endoderm
Gata-4	CTCCTACTCCAG CCCCTACC	GTGGCATTGCTGGAGTTACC	571	30
α-feto protein	CCTTGGCTGCTCAGTACGACAAGG	CCTGCAGACACTCCAGCGAGTTTC	299	27
Mesoderm
Brac-T	AAGGAACCACCGGTCATCG	CGTGTGCGTCAGTGGTGTGTAATG	321	27
Flk-1	CCTGGTCAAACAGCTCATCA	AAGCGTCTGCCTCAATCACT	599	30
GSC	ATGCTGCCCTACATGAACGT	CAGTCCTGGGCCTGTACATT	516	32
Ectoderm
Sox-1	GCACACAGCGTTTTCTCGG	ACATCCGACTCCTCTTCCC	388	30
Nestin	CGGCCCACGCATCCCCCATCC	AGCGGCCTTCCAATCTCTGTTCC	259	27
Hematopoietic progenitors
Gata-2	TGCAACACACCACCCGATACC	CAATTTGGACAACAGGTGCCC	336	35
c-kit	GCTCATAAATGGCATGCTCCAGTGT	GAAGTTGCGTCGGGTCTATGTAAAC	458	35
Myeloid–erythroid
c-myb	GAGCTTGTCCAGAAATATGGTCCTAAG	GGCTGCCGCAGCCGGCTGAGGGAC	522	35
SCL	TAGCCTTAGCCAGCCGCTCG	GCGGAGGATCTCATTCTTGC	277	35
Erythroid
Gata-1	ATGCCTGTAATCCCAGCACT	TCATGGTGGTAGCTGGTAGC	581	35
βH1-globin	TTTGCACACTTGAGATCATCTC	GGTCTCCTTGAGGTTGTTCCATG	610	30
β-major globin	ATGGTGCACCTGACTGATGCTG	GGTTTAGTGGTACTTGTGAGCC	447	30
House-keeping
GAPDH	CATCACCATCTTCCAGGAGC	ATGCCAGTGAGCTTCCCGTC	500	27

Oct-4, octamer-binding transcription factor-4; Rex-1, reduced expression protein-1; FGF-5, fibroblast growth factor-5; Gata-4, glutamyl-tRNA(Gln) amidotransferase subunit A-4; α-feto protein, alpha-1-fetoprotein; Brac-T, brachyury transcription factor T-gene; Flk-1, fetal liver kinase-1; GSC, goosecoid; Sox-1, sex determining region Y-box1; Nestin, neuroepithelial stem cell specific protein; Gata-2, glutamyl-tRNA(Gln) amidotransferase subunit A-2; c-kit, cellular-homolog of protein kinase transmembrane receptor/tyrosine-protein kinase kit; c-myb, cellular-myeloblastosis oncogene/proto-oncogene protein; SCL/Tal-1, stem cell leukemia/T-cell acute lymphocytic protein 1; Gata-1, glutamyl-tRNA(Gln) amidotransferase subunit A-1; βH1-globin, hemoglobin beta-H1 chain; β-major globin, beta-major globin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; PCR, polymerase chain reaction.

Statistical analysis

All experiments were done in quadruplicate (n=4) on 5 separate occasions (n=5) and each value represents the mean±standard deviation (SD). Statistical significance of results was evaluated using two-way analysis of variance with a level of significance P≤0.05 or P≤0.01.

Results

CM-mESCs promote early differentiation with higher growth proliferation

mESCs cultivated in standard maintenance Dulbecco's modified Eagle medium (DMEM) formed typical spherical colonies whereas CM-mESC cultures (experimental) using HepG2 CM resulted in formation of clusters with a flattened morphology as described previously (Fig. 2A) [5,24]. Control mESCs in standard predifferentiation IMDM optimized for hematopoietic differentiation [25,26] also resulted in flattened morphology (Fig. 2A). CM-mESC proliferation rate in culture was higher compared with that of control predifferentiation mESCs during the first 3 days of culture (Fig. 2B; P≤0.05), wherein the viability of both mESCs and CM-mESCs was >95% (Fig. 3). Pluripotency expression of Oct-4 and SSEA-1 for all mESC cultures was both uniformly distributed and not restricted to subpopulations of cells within the colonies as previously described [5,19]. Expression of Oct-4 was confirmed with RT-PCR and Rex-1 expression in all culture conditions, indicative of pluripotent capacity. Interestingly, the primitive ectoderm marker FGF-5 was only expressed in CM-mESCs, suggestive of early differentiation.

FIG. 2.

Morphological and growth evaluation of control and CM-mESCs. (A) Shown are examples of mESCs cultured at day 3 in (i) maintenance DMEM where cells congregated in a 3-dimensional spherical colony, (ii) predifferentiation Iscove's modified Dulbecco's medium (IMDM) that resulted in a flattened colony, and (iii) HepG2 CM that resulted in colonies exhibiting the flattest morphology of the 3 colony types and contained cells with larger nucleoli. Images were captured at 100× magnification under light microscopy (scales for each image: 20 μm). (B) Summary of proliferation in the control (mESCs in DMEM) and experimental (CM-mESCs) groups over 5 days of culture. A higher proliferation rate was observed in the CM group over the first 3 days followed by a plateau phase. Data are shown as mean number of cells±standard deviation (SD) (n=5; *P<0.05 and **P≤0.01). DMEM, Dulbecco's modified Eagle medium.

FIG. 3.

Viability and maintenance of pluripotency of undifferentiated mESCs in different culture conditions at day 3 of culture. (A) A high proportion of mESCs were viable as indicated by expression of Calcien AM (green) with relatively fewer nonviable cells, stained with ethidium homodimer-1 (red), in each culture condition—maintenance DMEM, predifferentiation IMDM, and HepG2 CM. The inset for each shows the respective negative control. (B) Expression of pluripotency markers, Oct-4 (intracellular marker, fluorescein isothiocyanate-green) and stage-specific embryonic antigen-1 (SSEA-1) (surface marker, Rhodamine red- red), was assessed by immunofluorescence in mESCs cultured at day 3. All culture conditions supported the maintenance of these markers. The nuclear staining with DAPI is shown in blue. The insets for each show negative controls for nonspecific binding of the primary antibodies. Images were captured at 20× magnification under fluorescence microscopy (scales for each image: 200 μm). (C) Reverse transcriptase–polymerase chain reaction (RT-PCR) at day 3 of culture confirmed potential for pluripotency with expression of the genes, Oct-3 and Rex-1, in mESCs cultured under different conditions. Expression of the primitive ectoderm gene marker FGF5 was only observed in CM-mESCs and is suggestive of early differentiation signals. The negative controls consisted of samples without cDNA.

Mesoderm differentiation of ELCs is best with CM-mESCs

ELC formation from the control mESC group by day 8 (Fig. 4A[i]) was larger when compared with that of CM-mESCs (Fig. 4A[ii]), as previously described [5]. Interestingly, culture of CM-mESCs resulted in an almost 5-fold enhancement of ELCs formed (P≤0.01) as compared with that formed by the control group at day 8 (Fig. 4B). Further characterization of the 3 germ layers and early hematopoietic differentiation using RT-PCR indicated that endoderm (Gata-4 and α-fetoprotein), mesoderm (Brachyury-T, Goosecoid, and Flk-1), and ectoderm (Nestin and Sox-2) gene markers were detected in ELCs of the control group (Fig. 4C). In contrast, there was a higher expression of the mesoderm gene Flk-1, but no expression of the endoderm genes Gata-4 and α-fetoprotein in ELCs of CM-mESCs (Fig. 4C). In agreement with this enhanced mesoderm pattern induced by HepG2 CM, ELCs from CM-mESCs displayed a higher expression of Gata-2 and c-Kit, indicative of early hematopoietic differentiation (Fig. 4C).

FIG. 4.

Formation of ELCs in both culture groups at day 8. (A) Shown are examples of (i) control and (ii) CM-mESC ELCs. Images were captured at 20× magnification under light microscopy (scales for each image: 200 μm). (B) A higher number of ELCs formed was observed in the CM-mESC group on day 8. Data shown are mean number of colonies±SD (n=5; **P<0.01). (C) RT-PCR analysis of genes indicative of the 3 germ layers at day 8 of culture in control mESCs and CM-mESCs. Expression of genes of all 3 germ layers was observed in ELCs from control mESCs whereas a higher expression of Flk-1 and loss of endoderm gene expression (GATA-4 and AFP) indicated more pronounced differentiation toward mesoderm with some early differentiation toward the hematopoietic lineage (Gata-2 and C-Kit) in those of CM-mESCs. Negative controls consisted of samples without cDNA. AFP, α-fetoprotein; Flk-1, fetal-liver kinase-1; Bra-T, brachyury-T; GS, goosecoid; Sox-1, sry-related HMG box-1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

CM-mESCs efficiently commit to the hematopoietic lineage in clonogenic assays

Early maturation of hematopoietic progenitor colonies burst-forming unit erythroid (BFU-E), colony forming unit (CFU)-E, CFU-GM, and CFU-GEMM was observed as early as day 7 in the CM-mESC group (Fig. 5A) when compared with that of the control mESC group. Further incubation of the same dishes to the standard 14 days resulted in changes in morphology, with a reduction in the reddish hue of the colonies, associated with a loss of hemoglobin [27,28] in the CM-mESC group, whereas the control mESC group displayed well-matured hematopoietic colonies. A higher number of hematopoietic colonies was also achieved in the CM-mESC group at day 7 as well as at day 14 of incubation (Fig. 5B; P≤0.05) with a 2-fold enhancement of all types of myeloid-erythroid progenitor colonies compared with that of the control mESCs. No morphologic differences were observed between the BFU-E colonies in the different groups. Nucleated erythrocytes and macrophages were identified in the CFUs from CM-mESCs at day 7 (Fig. 5C), as previously noted [29]. Expression of early hematopoietic and myeloid-erythroid genes was not detected in control mESCs yet was distinct in CFUs from CM-mESCs at day 7 of CFU culture (Fig. 5D). Specifically, the definitive erythroid gene β-major globin was detected on day 7, earlier than that observed in control mESCs, with relatively lower expression of the primitive erythroid gene βH1-globin at the same time point. At 14 days of the colony assay, control mESC and experimental CM-mESC groups showed a constant expression of all hematopoietic and myeloid-erythroid genes with lower expression of β-major globin and no expression of βH1-globin (Fig. 5D). This early erythroid maturation of adult type at day 7 of CM-mESC culture was confirmed by detection of Gata1 and β-major globin proteins with a lower expression of the primitive erythroid marker ζ-globin (Fig. 5E). Gata-1 and β-globin markers were maintained in both groups at day 14. Interestingly, the primitive erythroid markers βH1-globin gene and ζ-globin protein were not expressed in the control mESCs at any time point. Overall, the data indicated that CM-mESCs were capable of hematopoietic maturation earlier than control mESCs, indicating a more efficient differentiation system to mesoderm and the hematopoietic lineage.

FIG. 5.

Clonogenic capacity and gene and protein expression of terminally differentiated mESCs at days 7 and 14. (A) Standard methylcellulose assay was used to determine hematopoietic clonogenic capacity for burst-forming unit erythroid (BFU-E), colony forming unit (CFU)-E, CFU-GM, and CFU-GEMM at days 7 and 14 from ELCs of CM-mESCs and control mESCs. Morphological changes observed in the CM-ESC group at day 14 of culture were consistent with loss of hemoglobin within the colonies as indicated by the reduction of reddish hue. Images were captured at 20× magnification under light microscopy (scales for each image: 200 μm). (B) Summary bar graph of CFU numbers from both mESC groups at days 7 and 14 of the terminal differentiation culture. A higher number of all hematopoietic CFUs was observed in the CM-mESC group. (C) Wright-Giemsa staining of hand-picked BFU-E and CFU-GM colonies at day 7 of cultivated CM-mESCs confirmed the early maturation of hematopoietic colonies. Images were captured at 20× magnification under light microscopy (scales for each image: 200 μm). Data shown are mean number of colonies±SD (n=5; **P<0.01). nE=nucleated erythroid cells; Mac=macrophage. (D) RT-PCR analysis of myeloid-erythroid genes in cells from day 7 CFU cultures in control mESCs and CM-mESCs indicates early expression of hematopoietic genes only in the experimental condition. Incubation for the standard 14 days resulted in expression of all hematopoietic and myeloid-erythroid markers in both control and experimental groups with loss of expression of the primitive erythroid marker βH1 globin. The negative control consisted of samples without cDNA. (E) Western blot analysis of CFUs from days 7 and 14 confirms early erythroid maturation at day 7 in the CM-mESC experimental group with primitive erythroid expression of ζ-globin protein. The negative control consisted of samples without protein extract.

Discussion

We have developed an efficient bioprocess for hematopoietic differentiation toward erythropoiesis from mESCs in the absence of traditional EB formation using HepG2 CM. This method resulted in higher numbers and early hematopoietic maturation, mirroring those found in normal mammalian development. The use of HepG2 CM resulted in a less labor-intensive protocol with reduced use of resources making it a viable alternative for large-scale applications in future.

The enhancement of mesoderm formation using HepG2 CM is consistent with previous findings [5] that were induced by the visceral endoderm-like signaling of the CM. Currently, in vitro differentiation of mESCs toward the hematopoietic lineage is triggered by the addition of hematopoietic growth factors [1 –3,10]. Although cardiogenic differentiation has been considered as a spontaneous effect in mesodermal differentiation [30], our data do not suggest that hematopoietic differentiation occurred spontaneously during mesoderm differentiation using HepG2 CM. Despite the fact that many active factors within the CM are as yet uncharacterized [31,32], initial studies into defining the active properties of the CM have already been undertaken [24]. One of the mesodermal enhancer factors found in HepG2 CM is fibronectin [24] that is expressed in the primitive endoderm and epithelial (epiblast) cells developing into mesoderm during embryogenesis [33]. Serum transferrin—an iron binding glycoprotein that controls the level of iron, the crucial element contained in hemoglobin [34]—is also found in HepG2 CM providing a platform for the enhanced erythropoietic differentiation [24]. Interestingly, erythrocyte membrane proteins, such as α- and β-Spectrin, Ankyrin, and Protein 4.1, are also among the active factors found in HepG2 CM [24,35]. Major protein isoforms such as these, which are produced by developing erythroid cells, are critical in erythroid development, including membrane assembly, expression of erythroid-specific genes, and hematopoiesis generally [35]. The presence of such isoforms in HepG2 CM, in addition to fibronectin, vimentin, and transferrin, may partially explain the enhancement of hematopoietic colonies toward erythropoiesis observed in the CM-mESCs through as yet largely undefined mechanisms, introducing an interesting area of future research using this model. Further efforts into understanding both the protein and peptide active factors found within HepG2 CM and the effects on mESCs during development in vitro could enhance understanding on the mechanisms and biology of both primitive and definitive erythropoiesis. By extension, this model could be used as a tool to offer insight into disease processes and novel targets for treatments in disorders of red cell development and maturation.

CFU numbers presented in this work were highest in cultures using CM-mESCs with 1.5-fold expansion in all types of hematopoietic progenitors on day 7, which increased to 3.2-fold at 14 days of incubation, without requiring EB-stage formation. These CFU data compare favorably with other differentiation protocols directing mESCs to hematopoiesis via EB formation, such as those using cytokine-enhanced media resulting in formation of only erythroid progenitor colonies with inhibition of myeloid and pro-erythroblast colony formation after 16 days of culture [36], and using OP9 stromal cells resulting in a 2.6-fold increase in CFUs after 14 days of incubation [16]. Our current findings indicate that hematopoietic differentiation may be controlled and enhanced toward erythropoiesis specifically in the absence of standard EB formation or coculture methodologies, through streamlining mesoderm differentiation and simplifying the culture process with HepG2 CM. The differentiation time to erythropoiesis starting from mESCs is also truncated using HepG2 CM and can be as little as 12–13 days (3 days in HepG2 CM, followed by 2–3 days in primary differentiation and then 7 days in secondary differentiation medium) [37 –39]. This expedited maturation provides the opportunity for an efficient bioprocess for both the study of erythropoiesis and exploitation of the system in vitro as a potential novel platform for ex vivo blood cell bioprocessing and manufacture once the active factors critical for enhanced erythropoiesis are clarified.

Myeloid-erythroid markers were present as early as day 7 of incubation in CM-mESC cultures [3]. Gata-1, found at an early stage in these cultures, is expressed in primitive and definitive erythroid cells, and is essential for normal erythropoiesis, erythroid cell survival, and proliferation [40,41]. Gene and protein expression of βH1-globin and primitive ζ-globin, respectively, present in primitive erythroid cells (primitive erythroblasts) from E7.5 through E8.5 of mouse gestation [11,28,42,43], and β-major globin, an adult hemoglobin gene correlating with definitive β-globin protein normally expressed in both circulating primitive erythroblasts and differentiating definitive erythroblasts in the fetal liver [11,28,42,43], was also found in the CM-ESCs at day 7 of CFU formation. These findings are consistent with the known downregulation of βH1-globin and upregulation of β-major globin prior to the maturational globin switch from primitive erythroblast to definitive erythroblast between E8.5 and E12.5 [28]. In contrast, low expression of the early hematopoietic progenitor gene c-myb in control mESCs at day 7 suggested that the hematopoietic program had just started and that commitment toward specific blood progenitors was not yet well-developed in culture [44 –47]. By using ESC differentiation as a model, cells with hemangioblast potential have been identified, known as blast colony-forming cells (BL-CFCs; possibly the in vitro equivalent of the hemangioblast), and represent a transient population that appears in cell aggregates before the establishment of any other hematopoietic lineages [12,48 –50]. Our work has also shown an early maturational stage in the CM-mESC group during the 8 days of ELC primary differentiation with high expression of Flk-1 together with Brachyury-T, SCL, Gata-2, and c-kit, suggesting that hemangioblast-type colonies might be identified [9,51 –53], representing an area for future research using this model.

Herein, we have demonstrated that the use of HepG2 CM-mESCs enhanced hematopoietic differentiation and promoted specific erythroid lineage differentiation, making the protocol a useful tool in the study of hematopoiesis. These data support the hypothesis that HepG2 CM enhances mesoderm formation and its derivatives from ESCs and may enable the development of an efficient and defined differentiation method for directed erythrocyte production from ESCs.

Footnotes

Acknowledgments

This work was supported by the Higher Ministry of Education Malaysia, Universiti Malaysia Terengganu, and The Richard Thomas Leukemia Fund.

Author Disclosure Statement

The authors have no conflicts of interest.

References

Evans

, Kaufman

. 1981. Establishment in culture of pluripotential cells from mouse embryos. Nature, 292:154–156.

Kennedy

, Firpo

, Choi

, Wall

, Robertson

, Kabrun

, Keller

. 1997. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature, 386:488–493.

Irion

, Clarke

, Luche

, Kim

, Morrison

, Fehling

, Keller

. 2010. Temporal specification of blood progenitors from mouse embryonic stem cells and induced pluripotent stem cells. Development, 137:2829–2839.

Placzek

, Chung

, Macedo

, Ismail

, Blanco

, Lim

, Cha

, Fauzi

, Kang

et al. 2009. Stem cell bioprocessing: fundamentals and principles. J R Soc Interface, 6:209–232.

Hwang

, Randle

, Bielby

, Polak

, Mantalaris

. 2006. Enhanced derivation of osteogenic cells from murine embryonic stem cells after treatment with HepG2-conditioned medium and modulation of the embryoid body formation period: application to skeletal tissue engineering. Tissue Eng, 12:1381–1392.

Zhang

, Park

, Arentson

, Choi

. 2005. Modulation of hematopoietic and endothelial cell differentiation from mouse embryonic stem cells by different culture conditions. Blood, 105:111–114.

Bielinska

, Narita

, Heikinheimo

, Porter

, Wilson

. 1996. Erythropoiesis and vasculogenesis in embryoid bodies lacking visceral yolk sac endoderm. Blood, 88:3720–3730.

Eilken

, Nishikawa

, Schroeder

. 2009. Continuous single-cell imaging of blood generation from haemogenic endothelium. Nature, 457:896–900.

Kouskoff

, Lacaud

, Schwantz

, Fehling

, Keller

. 2005. Sequential development of hematopoietic and cardiac mesoderm during embryonic stem cell differentiation. Proc Natl Acad Sci U S A, 102:13170–13175.

10.

Pick

, Azzola

, Mossman

, Stanley

, Elefanty

. 2007. Differentiation of human embryonic stem cells in serum-free medium reveals distinct roles for bone morphogenetic protein 4, vascular endothelial growth factor, stem cell factor, and fibroblast growth factor 2 in hematopoiesis. Stem Cells, 25:2206–2214.

11.

, Feng

, Park

, Vida

, Lee

, Strausbauch

, Wettstein

, Honig

, Lanza

. 2008. Biologic properties and enucleation of red blood cells from human embryonic stem cells. Blood, 112:4475–4484.

12.

Kennedy

, D'Souza

, Lynch-Kattman

, Schwantz

, Keller

. 2007. Development of the hemangioblast defines the onset of hematopoiesis in human ES cell differentiation cultures. Blood, 109:2679–2687.

13.

Lapillonne

, Kobari

, Mazurier

, Tropel

, Giarratana

, Zanella-Cleon

, Kiger

, Wattenhofer-Donze

, Puccio

et al. 2010. Red blood cell generation from human induced pluripotent stem cells: perspectives for transfusion medicine. Haematologica, 95:1651–1659.

14.

, Ebihara

, Umeda

, Sakai

, Hanada

, Zhang

, Zaike

, Tsuchida

, Nakahata

, Nakauchi

, Tsuji

. 2008. Generation of functional erythrocytes from human embryonic stem cell-derived definitive hematopoiesis. Proc Natl Acad Sci U S A, 105:13087–13092.

15.

Hiroyama

, Miharada

, Sudo

, Danjo

, Aoki

, Nakamura

. 2008. Establishment of mouse embryonic stem cell-derived erythroid progenitor cell lines able to produce functional red blood cells. PLoS One, 3:e1544.

16.

, Vijayaragavan

, Bosse

, Weisel

, Bhatia

. 2008. OP9 stroma augments survival of hematopoietic precursors and progenitors during hematopoietic differentiation from human embryonic stem cells. Stem Cells, 26:2485–2495.

17.

Heng

, Cao

, Haider

, Wang

DZM

, Sim

EKW

, Ng

. 2004. An overview and synopsis of techniques for directing stem cell differentiation in vitro. Cell Tissue Res, 315:291–303.

18.

Willems

, Leyns

. 2008. Patterning of mouse embryonic stem cell-derived pan-mesoderm by activin A/nodal and Bmp4 signaling requires fibroblast growth factor activity. Differentiation, 76:745–759.

19.

Rathjen

, Lake

, Bettess

, Washington

, Chapman

, Rathjen

. 1999. Formation of a primitive ectoderm like cell population, EPL cells, from ES cells in response to biologically derived factors. J Cell Sci, 112:601–612.

20.

Rathjen

, Haines

, Hudson

, Nesci

, Dunn

, Rathjen

. 2002. Directed differentiation of pluripotent cells to neural lineages: homogeneous formation and differentiation of a neurectoderm population. Development, 129:2649–2661.

21.

Mummery

, Ward-van Oostwaard

, Doevendans

, Spijker

, van den Brink

, Hassink

, van der Heyden

, Opthof

, Pera

et al. 2003. Differentiation of human embryonic stem cells to cardiomyocytes—role of coculture with visceral endoderm-like cells. Circulation, 107:2733–2740.

22.

Rodda

, Kavanagh

, Rathjen

. 2002. Embryonic stem cell differentiation and the analysis of mammalian development. Int J Dev Biol, 46:449–458.

23.

Rathjen

, Rathjen

. 2001. Mouse ES cells: experimental exploitation of pluripotent differentiation potential. Curr Opin Genet Dev, 11:587–594.

24.

Kang

, Nagy

, Polak

, Mantalaris

. 2009. Proteomic characterization of the conditioned media produced by the visceral endoderm-like cell lines HepG2 and END2: toward a defined medium for the osteogenic/chondrogenic differentiation of embryonic stem cells. Stem Cells Dev, 18:77–91.

25.

Adamo

, Naveiras

, Wenzel

, McKinney-Freeman

, Mack

, Gracia-Sancho

, Suchy-Dicey

, Yoshimoto

, Lensch

et al. 2009. Biomechanical forces promote embryonic haematopoiesis. Nature, 459:1131–1135.

26.

Keller

, Webb

, Kennedy

. 2002. Hematopoietic development of ES cells in culture. Methods Mol Med, 63:209–230.

27.

Keller

, Kennedy

, Papayannopoulou

, Wiles

. 1993. Hematopoietic commitment during embryonic stem-cell differentiation culture. Mol Cell Biol, 13:473–486.

28.

Kingsley

, Malik

, Emerson

, Bushnell

, McGrath

, Bloedorn

, Bulger

, Palis

. 2006. “Maturational” globin switching in primary primitive erythroid cells. Blood, 107:1665–1672.

29.

Medvinsky

, Taoudi

, Mendes

, Dzierzak

. 2008. Analysis and manipulation of hematopoietic progenitor and stem cells from murine embryonic tissues. Curr Protoc Stem Cell BiolChapter 2:Unit 2A6.

30.

Arai

, Yamamoto

, Toyama

. 1997. Murine cardiac progenitor cells require visceral embryonic endoderm and primitive streak for terminal differentiation. Dev Dyn, 210:344–353.

31.

Wang

, Ruan

, Guan

, Liu

. 2003. Expression of IGF-II in early experimental hepatocellular carcinomas and its significance in early diagnosis. World J Gastroenterol, 9:267–270.

32.

Khaoustov

, Risin

, Pellis

, Yoffe

. 2001. Microarray analysis of genes differentially expressed in HEPG2 cells cultured in simulated microgravity: preliminary report. In Vitro Cell Dev Biol Anim, 37:84–88.

33.

Morin

, Sullivan

. 1994. Expression of fibronectin and a fibronectin-binding molecule during preimplantation development in the mouse. Hum Reprod, 9:894–901.

34.

Leibman

, Aisen

. 1979. Distribution of iron between the binding-sites of transferrin in serum—methods and results in normal human-subjects. Blood, 53:1058–1065.

35.

Steiner

, Maksimova

, Schulz

, Wong

, Raha

, Mahajan

, Weissman

, Gallagher

. 2009. Chromatin architecture and transcription factor binding regulate expression of erythrocyte membrane protein genes. Mol Cell Biol, 29:5399–5412.

36.

Carotta

, Pilat

, Mairhofer

, Schmidt

, Dolznig

, Steinlein

, Beug

. 2004. Directed differentiation and mass cultivation of pure erythroid progenitors from mouse embryonic stem cells. Blood, 104:1873–1880.

37.

Baron

, Isern

, Fraser

. 2012. The embryonic origins of erythropoiesis in mammals. Blood, 119:4828–4837.

38.

Brotherton

, Chui

, Gauldie

, Patterson

. 1979. Hemoglobin ontogeny during normal mouse fetal development. Proc Natl Acad Sci U S A, 76:2853–2857.

39.

Johnson

, Barker

. 1985. Erythroid progenitor cells and stimulating factors during murine embryonic and fetal development. Experimental Hematology, 13:200–208.

40.

Zheng

, Kitajima

, Sakai

, Kimura

, Minegishi

, Yamamoto

, Nakano

. 2006. Differential effects of GATA-1 on proliferation and differentiation of erythroid lineage cells. Blood, 107:520–527.

41.

Pevny

, Simon

, Robertson

, Klein

, Tsai

, Dagati

, Orkin

, Costantini

. 1991. Erythroid-differentiation in chimeric mice blocked by a targetted mutation in the gene for transcription factor Gata-1. Nature, 349:257–260.

42.

Kingsley

, Malik

, Fantauzzo

, Palis

. 2004. Yolk sac-derived primitive erythroblasts enucleate during mammalian embryogenesis. Blood, 104:19–25.

43.

Lux

, Yoshimoto

, McGrath

, Conway

, Palis

, Yoder

. 2008. All primitive and definitive hematopoietic progenitor cells emerging before E10 in the mouse embryo are products of the yolk sac. Blood, 111:3435–3438.

44.

Tober

, McGrath

, Palis

. 2008. Primitive erythropoiesis and megakaryopoiesis in the yolk sac are independent of c-myb. Blood, 111:2636–2639.

45.

Sandberg

, Sutton

, Pletcher

, Wiltshire

, Tarantino

, Hogenesch

, Cooke

. 2005. C-Myb and p300 regulate hematopoietic stem cell proliferation and differentiation. Dev Cell, 8:153–166.

46.

Kastan

, Slamon

, Civin

. 1989. Expression of protooncogene-C-Myb in normal human hematopoietic-cells. Blood, 73:1444–1451.

47.

Golay

, Capucci

, Arsura

, Castellano

, Rizzo

, Introna

. 1991. Expression of C-Myb and B-Myb, but not A-Myb, correlated with proliferation in human hematopoietic-cells. Blood, 77:149–158.

48.

Huber

, Kouskoff

, Fehling

, Palis

, Keller

. 2004. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature, 432:625–630.

49.

Lancrin

, Sroczynska

, Stephenson

, Allen

, Kouskoff

, Lacaud

. 2009. The haemangioblast generates haematopoietic cells through a haemogenic endothelium stage. Nature, 457:892–895.

50.

, Feng

, Caballero

, Chen

, Moore

MAS

, Grant

, Lanza

. 2007. Generation of functional hemangioblasts from human embryonic stem cells. Nat Methods, 4:501–509.

51.

Ema

, Yokomizo

, Wakamatsu

, Terunuma

, Yamamoto

, Takahashi

. 2006. Primitive erythropoiesis from mesodermal precursors expressing VE-cadherin, PECAM-1, Tie2, endoglin, and CD34 in the mouse embryo. Blood, 108:4018–4024.

52.

Kattman

, Huber

, Keller

. 2006. Multipotent Flk-1(+) cardiovascular progenitor cells give rise to the cardiomyocyte, endothelial, and vascular smooth muscle lineages. Dev Cell, 11:723–732.

53.

Wang

, Tang

, Sun

, Miao

, Lv

, Yang

, Zhang

, Liu

et al. 2012. TGFbeta inhibition enhances the generation of hematopoietic progenitors from human ES cell-derived hemogenic endothelial cells using a stepwise strategy. Cell Res, 22:194–207.

54.

Keller

, Webb

, Kennedy

. 2002. Hematopoietic development of ES cells in culture. Methods Mol Med, 63:209–230.