Gastric Cancer Cell-Derived Exosomes Can Regulate the Biological Functions of Mesenchymal Stem Cells by Inducing the Expression of Circular RNA circ

Abstract

As an important component of the dynamic tumor microenvironment, mesenchymal stem cells (MSCs) can interact with tumor cells to promote tumor growth. Treatment with tumor cell-derived exosomes can change the biological functions of MSCs. We want to study the mechanism by which exosomes derived from gastric cancer cells affect the biological functions of MSCs. After MSCs were treated with adenocarcinoma gastric cells (AGS) cell-derived exosomes, circular RNAs differentially expressed in MSCs were verified using existing RNA microarray results combined with quantitative real-time polymerase chain reaction (qRT-PCR). Then, circular RNAs were knocked down or overexpressed by plasmids, and the functions of circular RNAs were evaluated by Migration and invasion assay. Dual luciferase reporter assay was used to evaluate the potential mechanism of circular RNAs. After treatment with exosomes secreted by AGS, the results showed that some circular RNAs expressed by human adipose-derived MSCs showed significant differences. The elevated circ_0004303 promoted the migration and invasion of human adipose-derived MSCs in vitro. Circ_0004303 upregulated the expression of activated leukocyte cell adhesion molecule (ALCAM) by acting as a miR-148a-3p sponge, thereby enhancing the migration and invasion functions of human adipose-derived MSCs. Therefore, exosomes secreted by AGS can affect the expression of circular RNAs in human adipose-derived MSCs. Hsa_circ_0004303 can regulate the migration and invasion of human adipose-derived MSCs via the miR-148a-3P/ALCAM axis. This study suggests that tumor cells can promote the migration and homing of MSCs in adjacent tissues by secreting exosomes.

Introduction

Gastric cancer has the fifth highest incidence rate and the fifth highest mortality rate among cancers in the world [1]. Cases of gastric cancer in China alone account for 42.6% of the global incidence rate and 45% of the global mortality rate [2]. Although important progress has been made in the treatment of gastric cancer through conventional treatment combined with chemotherapy and targeted drugs, the results of many phase III clinical trials are less than satisfactory, and many challenges remain for advancing the current treatment of gastric cancer [3]. Further research is urgently needed to identify more effective diagnosis and therapeutic schedules.

The tumor microenvironment (TME) includes surrounding mesenchymal stem cells (MSCs), immune cells, extracellular matrix, fibroblasts, and lymphocytes [4], and the interactions among these components affect the occurrence and development of tumors. The composition and structure of TME vary with cancer types and patients. As an important component of the TME, human MSCs can be extracted from a variety of adult organs and tissues, such as adipose tissues, bone marrow, and peripheral blood. MSCs have differentiation ability of osteogenesis, chondroblast, and adipogenesis [5].

Adipose MSCs have been found in human gastric cancer. Adipose tissue exists in the gastric submucosa and subserosa. Adipose tissue stromal cells influence the progression of gastric cancer by increasing their growth/invasion and decreasing their apoptosis through MAPK activation in a COX-2-independent way [6]. Helicobacter pylori, as a part of the gastric cancer microenvironment, can promote the migration of human adipose-derived MSCs into the TME and transformation into cancer cells [7]. MSCs that are recruited into the TME can indirectly affect the growth and metastasis of tumor cells by secreting a variety of inflammatory cytokines and chemokines in the TME to regulate immune cells functions. MSCs can also play an important role in direct interaction with immune cells and tumor cells [8].

Tumor cells can modulate tumor stromal cells through intercellular communications. This process can be mediated through either direct cell contact or secreted signaling factors (cytokines, chemokines, and growth factors) and microvesicles [9]. Exosomes are extracellular vesicles that can be generated by all cells. They carry soluble factors such as nucleic acids, proteins, enzymes, lipids, and cytokines and serve significant information transmission functions between cells [10].

Recently, a growing number of studies have investigated the application of exosomes in the TME. Tumor cell-derived exosomes carry tumor-associated antigens (TAA), costimulatory molecules, and major histocompatibility complex components, which enable them to stimulate immune cells and promote antitumor responses [11]. Lung cancer cell-derived exosomes can activate the Toll-like receptor 2 (TLR2)/nuclear factor kappa B (NF-κB) signaling pathway and induce MSCs to be proinflammatory MSCs, thereby promoting tumor growth [9]. Compared with bone marrow-derived MSCs (BM-MSCs), MSCs cultured with melanoma cell-derived exosomes (TE-MSCs) significantly promoted tumor growth [12].

Circular RNAs are a subclass of noncoding RNAs, which have a covalently closed-loop structure [13]. The expression of circular RNAs is specific at different tissue and different stages of development. Since circular RNAs lack free 5′ and 3′ terminals and are not sensitive to nucleases, they are stabler than linear RNA [14]. With the development of RNA sequencing technology, there has been an increasing interest in the study of circular RNAs, which are closely related to many physiological and pathological processes. For example, circMTO1 acts as a sponge for miR-9 to upregulate p21 expression and inhibit hepatocellular carcinoma progression [15]. Circ- FBXW7 encodes a new protein, FBXW7–185aa, which competitively interacts with USP28 and releases FBXW7a to degrade c-Myc, thereby inhibiting glioma cell proliferation and slowing down the cell cycle [16]. However, research studying the role of circular RNAs in gastric cancer is still very limited.

In this study, a novel circular RNA was identified from the DDX60, termed circ_0004303. After human adipose-derived MSCs were treated with exosomes derived from gastric cancer cells, circ_0004303 was significantly upregulated, and the high level of circ_0004303 enhanced the migration and invasion abilities of human adipose-derived MSCs. With regard to the mechanism of this effect, we found that an elevated circ_0004303 level affected the functions of human adipose-derived MSCs by sponging miR-148a-3p to upregulate activated leukocyte cell adhesion molecule (ALCAM) expression.

Materials and Methods

Cell culture

Human adipose-derived MSCs were isolated as previously reported [17] from discarded adipose tissue from patients undergoing liposuction in the Plastic surgery department of Peking Union Medical College Hospital. They have been approved by the Ethics Committee of the Institute of Basic Medicine of the Chinese Academy of Medical Sciences and obtained the informed consent of the patients.

Gastric cancer cell line adenocarcinoma gastric cells (AGS) was purchased from the Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences. AGS was cultured in Dulbecco's modified Eagle medium (DMEM)/F12 containing 10% fetal bovine serum in a cell incubator at 37°C with a constant temperature and 5% CO₂.

Exosome extraction

Exosome extraction was performed as previously described [18]. In brief, AGS cells were cultured in serum-free DMEM/F12 medium for 36 h, and then the supernatant was collected and centrifuged at 3,000 rpm for 30 min to remove lifted cells. The supernatant was transferred to 100,000 Mw cutoff membrane (CentriPlus-70, Millipore) and centrifuged to extract exosomes by ultrafiltration method. The volume of supernatant was reduced from approximately 250–500 mL to <3 mL. The supernatant was washed twice with phosphate-buffered saline (PBS) until it was approximately colorless. The supernatant was filtered with a 0.22 m filter and preserved at −80°C.

Transmission electron microscopy

Purified exosomes were fixed with 1% glutaraldehyde in PBS (pH 7.4). After rinsing, a 20-uL drop of the suspension was loaded onto a formvar/carbon-coated grid, negatively stained with 3% (w/v) aqueous phosphotungstic acid for 1 min and observed by transmission electron microscope.

Western blot analysis

Proteins were extracted with radio immunoprecipitation assay (RIPA) lysis buffer with phenylmethylsulfonyl fluoride (PMSF), quantified by bovine serum albumin (BCA) Protein Assay Kit, separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis gel, and then transferred onto a polyvinylidene fluoride membrane. The membrane was incubated with the primary antibody and then incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature. The primary antibodies were as follows: HSP70 (Santa Cruz), HSP90 (Santa Cruz) and CD63 (Cell Signaling Technology). Secondary (HRP)-conjugated antibodies were purchased from NeoBioscience. The immunodetection was then visualized by a chemiluminescent ECL reagent (Millipore).

Real-time PCR

Total RNA was extracted from cells using TRIzol reagent (Life Technologies) according to the manufacturer's protocol. Triplicate reactions were performed for each complementary DNA (cDNA) sample. The relative expression of each gene to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was calculated using the ΔCT method. The gene-specific primers are listed in Table 1.

Table 1.

Primers for Semiquantitative Reverse Transcription-Polymerase Chain Reaction and Quantitative Real-Time PCR

Gene	Forward sequence (5′-3′)	Reverse sequence (5′-3′)
IL-6	ACTCACCTCTTCAGAACGAATTG	CCATCTTTGGAAGGTTCAGGTTG
IL-8	ACTCCAAACCTTTCCACCCC	TTCTCAGCCCTCTTCAAAAACTTC
IL-10	ATGCGGTCTTTTTGATGCCC	CCGAATGTAGCTCCGCAGAA
MCP-1	CAGCCAGATGCAATCAATGCC	TGGAATCCTGAACCCACTTCT
TGF-β	CAAGTGGACATCAACGGGA	GCAGAAGTTGGCGTGGTAG
TNF-α	CCTCTCTCTAATCAGCCCTCTG	GAGGACCTGGGAGTAGATGAG
IP-10	GTGGCATTCAAGGAGTACCTC	TGATGGCCTTCGATTCTGGATT
IDO	TCAGGGAGACCAGAGCTTTCACAC	GCAAATGCAAGAACGGGACACT
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
circ_0004303	AACAGGATGAATGAAGGAGATGCT	TCCATGACTCTGGGTTGCTT
miR-148a-3p	AGCAGTTCAGTGCACTACAG	GCAGGGTCCGAGGTATTC
ALCAM	CTGGCAGTGGAAGCGTCATA	CTCTGTTTTCATTAGCAGAGACATT

ALCAM, activated leukocyte cell adhesion molecule; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IDO, indoleamine-2,3-dioxygenase; IL, interleukin; MCP-1, monocyte chemotactic protein 1; TGF-β, transforming growth factor beta; TNF-α, tumor necrosis factor alpha.

Exosome staining

Exosomes labeled with Dil dye was cocultured with MSCs. The uptake was observed in real-time using a living cell imager at different time points (from 1 to 24 h). After 24 h of uptake, the MSCs were fixed with 4% paraformaldehyde for 10 min. Then the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min and the results were observed.

Cell transfection

AGS cells were seeded into six-well plates (5 × 10⁴ cells/well) and cultured overnight to ∼70% confluence in a humidified atmosphere containing 5% CO₂ at 37°C. The cells were then transfected with 100 nM of small interfering RNA (siRNA), overexpression vector or negative control for circular RNA purchased from GeneBiogist (Shanghai, China) by using Lipofectamine 3000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. At 48 h after transfection, the transfected cells were collected to analyze the efficiency of transfection by quantitative real-time polymerase chain reaction (qRT-PCR).

Transwell assay

Migration of AGS cells was assayed using chamber with 8-μm-pore filters. AGS cells were trypsinized and 5 × 10⁴ AGS cells in serum-free medium were added to the upper chamber. Then, 1 mL media with 10% serum was added to the lower chamber. Cells were incubated for 18 h at 37°C, and then nonmigrating cells were removed with cotton swabs. Cells that migrated to the bottom of the membrane were then fixed with 4% paraformaldehyde for 20 minutes and stained with 0.2% crystal violet for 30 min, and then washed twice with PBS. Then stained cells were visualized under a microscope.

Luciferase reporter assay

The circ_004303 3′ untranslated region (3′-UTR) containing the potential binding site of hsa-miR-148a-3p was cloned into the pRL-TK vector (Invitrogen) by PCR method. In brief, cells were inoculated into a 24-well plate and were cotransfected with miR-148a-3p mimics or the negative control and the luciferase reporter vector as well as lipofectamine 2000 reagent (Invitrogen). After 48 h, cells were collected to measure Firefly and Renilla luciferase activity using the dual-luciferase reporter assay system (Promega).

Statistical analysis

Data are presented as mean ± standard deviation, which were representative at least in triplicate. The two-tailed Student's t-test was used to evaluate the significance of differences between two groups. Statistical analysis was performed using GraphPad Prism 5.0 (GraphPad Software, Inc., San Diego, CA). A value of P < 0.05 was considered to be statistically significant.

Results

Differentiation potential and phenotypic identification of human adipose-derived MSCs

The human adipose-derived MSCs isolated from adipose tissue grew adherently and showed a fusiform shape (Fig. 1A). Lipid formation, osteogenesis, and cartilage differentiation of human adipose-derived MSCs were determined by oil red O, alizarin red, and alkaline phosphatase staining. The results showed that human adipose-derived MSCs were capable of lipid formation, osteogenesis, and chondrogenic differentiation (Fig. 1B–D). Further analysis of the immunophenotype of stem cells indicated that CD90, CD29, CD44, and CD73 were positive (positive rate >95%), and HLA-DR, CD34, CD31, and CD106 were negative (positive rate <5%; Fig. 1E).

FIG. 1.

Differentiation potential and phenotypic identification of hAMSCs. (A) The cell morphology of hAMSCs under a light microscope. Scale bar = 100 μm. (B) Oil red O staining results on the day 12 of adipogenic differentiation. (C) ALP staining results on day 5 of osteogenic differentiation. (D) Alizarin red staining on day 12 of osteogenic differentiation. (E) The phenotype of hAMSCs was identified by flow cytometry. ALP, alkaline phosphatase; hAMSCs, human adipose-derived mesenchymal stem cells. Color images are available online.

Identification of AGS cell-derived exosomes and observation of exosomes entering human adipose-derived MSCs

Exosomes were isolated from AGS cells using ultrafiltration. Transmission electron microscopy showed that the exosomes were microvesicles with a diameter of about 40–100 nm (Fig. 2A). Western blot analysis showed that AGS cell-derived exosomes expressed HSP70, HSP90, and CD63 (Fig. 2B). NanoSight analysis showed that AGS cell-derived exosomes were uniform in size (Fig. 2C). To examine whether AGS cell-derived exosomes could be ingested by human adipose-derived MSCs, AGS cell-derived exosomes were labeled with DIR dye and cocultured with human adipose-derived MSCs. The process of exosomes uptake was observed in real-time, and the exosomes were observed in the cytoplasm of human adipose-derived MSCs after 10 h under a microscope (Fig. 2D). The nuclei of human adipose-derived MSCs were stained blue with Hoechst33342 dye (Fig. 2E). These results indicated that human adipose-derived MSCs could effectively ingest AGS cell-derived exosomes.

FIG. 2.

Characterization of exosomes secreted by AGS cancer cells. (A) Electron micrograph of exosomes secreted by AGS cells. Scale bar = 200 nm. (B) The expressions of CD63, HSP70, and HSP90 on the surface of exosomes were detected by western blot. (C) The particle size distribution of exosomes was measured with NanoSight analyzer. (D) Real-time fluorescence observation of the phagocytosis of Dil-labeled exosomes by hAMSCs. Dil-labeled exosomes are highlighted in orange red (scale bar = 100 μm). (E) Uptake at 24 h (The nucleus is blue, and the exosomes is orange red). AGS, adenocarcinoma gastric cells. Color images are available online.

Time and concentration dependence of the effects of AGS cell-derived exosomes on human adipose-derived MSCs

Previous research has found significant differences in inflammatory cytokines secreted by human adipose-derived MSCs after treatment with AGS cell-derived exosomes [19]. This study further verified this phenomenon. QRT-PCR results showed that the expressions of proinflammatory cytokines interleukin (IL)-6 and IL-8, chemokines monocyte chemotactic protein 1 (MCP-1) and IP-10, and anti-inflammatory cytokines indoleamine-2,3-dioxygenase (IDO) secreted by human adipose-derived MSCs were significantly upregulated after the treatment of AGS cell-derived exosomes (Fig. 3A).

FIG. 3.

Effects of AGS cell-derived exosomes on secretion of inflammatory cytokines in hAMSCs. (A) Levels of inflammatory cytokines secreted by hAMSCs were measured before and after treatment with AGS cell-derived exosomes. (B–F) The levels of IL-6, IL-8, MCP-1, IP-10, and IDO expressed by hAMSCs after different concentrations of exosomes (0, 100, 200, 300, and 400 ng/μL) were treated for different times (6, 24, and 48 h). Unpaired Student's t-test was used for the statistical analyses. *P < 0.05; **P < 0.01; ***P < 0.001. IDO, indoleamine-2,3-dioxygenase; IL, interleukin; MCP-1, monocyte chemotactic protein 1.

To explore whether AGS cell-derived exosomes have time-dependent and concentration-dependent effects on human adipose-derived MSCs, we treated human adipose-derived MSCs with different concentrations of AGS cell-derived exosomes for 6, 24, and 48 h. The qRT-PCR results (Fig. 3B–F) showed that different concentrations of exosomes hardly affected the expression levels of inflammatory factors at the same time point. With the extension of time, the mRNA levels of IL-6 secreted by human adipose-derived MSCs showed an increasing trend, while the mRNA levels of IL-8, MCP-1, IP-10, and IDO secreted by human adipose-derived MSCs showed a decreasing trend. Combined with the treatment conditions and the expression of inflammatory factors reported in literature, the concentration and time of treatment were finally determined to be 200 ng/μL and 24 h.

Effects of AGS cell-derived exosomes on human adipose-derived MSCs gene expression profile

Existing gene microarray results showed that a total of 135,750 differentially expressed genes were detected before and after treating human adipose-derived MSCs with AGS cell-derived exosomes for 24 h (P ≤ 0.05) [19]. Compared with the control group, 69,091 genes were upregulated, and 66,659 genes were downregulated in the human adipose-derived MSCs treated with exosomes.

Gene Ontology (GO) analysis showed that these differentially expressed genes were mainly related to proteasome activator complex, apical plasma membrane, chloride ion channel complex, and ICE protease-activating factor inflammatory complex (cellular component); type I interferon signaling pathway, defense against virus, neuron migration, response to virus, and interferon-β (biological process); and double-stranded RNA binding, 2′–5′-oligosadenylate synthase activity, and olfactory receptor activity were associated with single-stranded RNA binding (molecular function) (Fig. 4A). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that it was mainly enriched in NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, NF-κB signaling pathway, and Toll-like receptor signaling pathway (Fig. 4B).

FIG. 4.

Effects of AGS cell-derived exosomes on hAMSCs gene expression profile. (A) GO Analysis of differentially expressed genes in hAMSCs. (B) KEGG analysis of differentially expressed genes in hAMSCs. GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes. Color images are available online.

Analysis of DDX60-derived circular RNAs in human adipose-derived MSCs

The gene chip results showed that after treating human adipose-derived MSCs with AGS-derived exosomes for 24 h, the circular RNAs expressed by human adipose-derived MSCs showed significant differences (Supplementary Table S1). Further screening of differentially expressed circular RNAs in the microarray results by qRT-PCR showed that six circular RNAs were significantly upregulated (Fig. 5A) and three circular RNAs were significantly downregulated (Fig. 5B). Gene microarray results showed that there was a significant difference between the expressions of hsa_circ_0004303 in human adipose-derived MSCs before and after the treatment of AGS cell-derived exosomes (Fig. 5C), and the differential expression of hsa_circ_0004303 had a certain influence on the biological functions of human adipose-derived MSCs.

FIG. 5.

Expression and identification of circ_0004303. (A) circRNAs with significantly upregulated expression detected by qRT-PCR before and after treatment with AGS cell-derived exosome, respectively. (B) circRNAs with significantly downregulated expression detected by qRT-PCR before and after treatment with AGS cell-derived exosome, respectively. (C) The heatmap of some differentially expressed circRNAs in hAMSCs before and after treatment with AGS cell-derived exosome, respectively. (D) circ_0004303 formation via exon 31–37 circularization of the DDX60 gene. The presence of circ_0004303 was validated by qRT-PCR, followed by Sanger sequencing. (E) Location of circ_0004303 in the genome. (F) Analysis of species conservation of circ_0004303. (G) circ_0004303 and its corresponding mRNA (treated with RNase R). (H) The intracellular localization of circ_0004303. Nucleo-cytoplasmic separation assay was used. The internal reference of nucleus was U6, and the internal reference of cytoplasm was GAPDH. Unpaired Student's t-test was used for the statistical analyses. *P < 0.05; **P < 0.01; ***P < 0.001. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative real-time polymerase chain reaction. Color images are available online.

There were also many differentially expressed genes involved in cell migration, immunity, inflammation, cell proliferation, and angiogenesis (Supplementary Fig. S1). The sequence and gene localization of circ_0004303 were obtained from the UCSC database. It was found that circ_0004303 was 875bp in length and comprised exon 31–37 of the DDX60 gene (chr4: 169141805-169158946). The head-to-tail splicing structure of circ_0004303 was verified via Sanger sequencing (Fig. 5D). The UCSC database showed that circ_0004303 is located in the q32.2 region of chromosome 4 (Fig. 5E), and that this gene is not conservative (Fig. 5F). Furthermore, we found that circ_0004303 was less sensitive to RNase R than the linear DDX60 in human adipose-derived MSCs (Fig. 5G). Nuclear cytoplasmic separation experiments showed that circ_0004303 was mainly located in the cytoplasm, which provided an idea for exploring the mechanism of its functions (Fig. 5H).

circ_0004303 regulates the migration and invasion ability of human adipose-derived MSCs

We further verified whether exosomes derived from AGS cells have an effect on the migration and invasion abilities of human adipose-derived MSCs. Results showed that the migration and invasion abilities of human adipose-derived MSCs were enhanced after treating with AGS cell-derived exosome (Fig. 6A, B). To explore the biological functions of circ_0004303, we conducted a series of in vitro experiments. We used siRNAs specifically targeting the circ_0004303 back-splice junction site to knock down circ_0004303, circ_0004303 expressions were significantly downregulated by circ_0004303 siRNAs compared with the control siRNA (designated control) in human adipose-derived MSCs (Fig. 6C). Migration and invasion assays showed that knocking down of circ_0004303 reduced the migration and invasion abilities of human adipose-derived MSCs (Fig. 6D, E). By using a plasmid, we succeeded in overexpressing circ_0004303 in human adipose-derived MSCs (Fig. 6F). Migration and invasion assays showed that the overexpression of circ_0004303 increased the migration and invasion ability of human adipose-derived MSCs (Fig. 6G, H).

FIG. 6.

circ_0004303 regulates the migration and invasion ability of hAMSCs. (A) Transwell migration assay was used to detect the migration ability of hAMSCs following treatment with AGS cell-derived exosome. (B) Transwell invasion assay was used to detect the invasion ability of hAMSCs following treatment with AGS cell-derived exosome. (C) The efficacy of circ_0004303 interference was analyzed by qRT-PCR. (D) Transwell migration assay was used to detect the migration ability of hAMSCs after knocking down circ_0004303. (E) Transwell invasion assay was used to detect the invasion ability of hAMSCs after knocking down circ_0004303. (F) The efficacy of circ_0004303 overexpression was analyzed by qRT-PCR. (G) Transwell migration assay was used to detect the migration ability of hAMSCs after circ_0004303 overexpression. (H) Transwell invasion assay was used to detect the invasion ability of hAMSCs after circ_0004303 overexpression. Unpaired Student's t-test was used for the statistical analyses. **P < 0.01; ***P < 0.001. Color images are available online.

circ_0004303 regulates the migration and invasion abilities of human adipose-derived MSCs via sponging miR-148a-3p

A growing number of studies have shown that circular RNAs mainly function as miRNA sponges. Therefore, we speculated that circ_0004303 may act as a sponge of certain miRNAs that might play a role in the transformation of N-MSC to T-MSC. Through the Nuclear/Cytosol Fractionation assay, we demonstrated that circ_0004303 was mainly localized in the cytoplasm of human adipose-derived MSCs. Potential targets of circ_0004303 were predicted using the StarBase database, and some miRNAs, including miR-148a-3p, were found to have binding sites in circ_0004303 region (Fig. 7A). To further verify the interaction between miR-148a-3p and circ_0004303, we carried out luciferase reporter assays by transfecting HEK-293T cells with luciferase reporter vectors (containing the wild type or mutant sequence of circ_0004303 target). The Luciferase reporter activity was significantly decreased by the miR-148a-3p mimics in cells transfected with the wild-type sequence compared to those transfected with the mutant sequence (Fig. 7B, C).

FIG. 7.

circ_0004303 regulates the migration and invasion ability of hAMSCs via sponging miR-148a-3p. (A) Putative binding sites of the miRNAs associated with circ_0004303. (B) Putative binding sites of miR-148a-3p associated with circ_0004303 (predicted by StarBase v3.0). (C) Detection of the luciferase activity of the reporter gene after being transfected into HEK-293T cells. (D) The level of miR-148a-3p in hAMSCs after knockdown and overexpression of circ_0004303, respectively. (E) The level of circ_0004303 in hAMSCs after knockdown and overexpression of miR-148a-3p, respectively. (F) The knockdown of miR-148a-3p was verified by qRT-PCR. (G) Transwell migration assay was used to detect the migration ability of hAMSCs after knocking down miR-148a-3p. (H) Transwell invasion assay was used to detect the invasion ability of hAMSCs after knocking down miR-148a-3p. (I) The overexpression of miR-148a-3p was verified by qRT-PCR. (J) Transwell migration assay was used to detect the migration ability of hAMSCs after overexpression of miR-148a-3p. (K) Transwell invasion assay was used to detect the invasion ability of hAMSCs after overexpression of miR-148a-3p. Unpaired student's t-test was used for the statistical analyses. *P < 0.05; ***P < 0.001; ns, not significant. Color images are available online.

After knocking down circ_004303, the expression level of miR-148a-3p was significantly upregulated, and after overexpressing circ_004303, the expression level of miR-148a-3p was significantly downregulated (Fig. 7D). However, the expression level of circ_004303 remained unchanged after miR-148a-3p being upregulated or downregulated (Fig. 7E). Then, miR-148a-3p inhibitor was used to knock down the expression of miR-148a-3p (Fig. 7F). Migration and invasion assays showed that knockdown of miR-148a-3p increased the migration and invasion abilities of human adipose-derived MSCs (Fig. 7G, H). MiR-148a-3p was overexpressed using miR-148a-3p mimics (Fig. 7I). Migration and invasion assays showed that the overexpression of miR-148a-3p reduced the migration and invasion abilities of human adipose-derived MSCs (Fig. 7J, K).

Taken together, our results provide evidence that circ_004303 can directly bind to miR-148a-3p in human adipose-derived MSCs, and that miR-148a-3p can regulate the migration and invasion abilities of human adipose-derived MSCs.

circ_0004303 upregulates the level of ALCAM by acting as a miR-148a-3p sponge, and ALCAM is involved in regulating the migration and invasion abilities of human adipose-derived MSCs

Four databases (including miRWalk, TargetScan, miRTarBase, and miRDB) were used to predict the potential targets of miR-148a-3p, and 40 mRNAs were overlapped in these four databases (Fig. 8A). ALCAM has been reported to promote tumor progression [20 –22]. Therefore, we speculated that circ_0004303 mainly acts as a miR-148a-3p sponge to regulate the expression of ALCAM, thereby affecting the progression of gastric cancer. In addition, mRNA and protein levels of ALCAM significantly decreased after circ_0004303 downregulation, and significantly increased after circ_0004303 upregulation (Fig. 8B).

FIG. 8.

circ_0004303 upregulates the level of ALCAM by acting as a miR-148a-3p sponge, and ALCAM is involved in regulating the migration and invasion ability of hAMSCs. (A) The overlap of miR-148a-3p target mRNAs, predicted by miRWalk, TargetScan, miRTarBase, and miRDB databases. (B–D) Relative mRNA and protein expression of ALCAM in hAMSCs with different treatments. (E) Transwell migration assay was used to detect the migration ability of hAMSCs after ALCAM knockdown. (F) Transwell invasion assay was used to detect the invasion ability of hAMSCs after ALCAM knockdown. Unpaired Student's t-test was used for the statistical analyses. *P < 0.05; ***P < 0.001. ALCAM, activated leukocyte cell adhesion molecule. Color images are available online.

Moreover, mRNA and protein levels of ALCAM significantly increased after miR-148a-3p downregulation in human adipose-derived MSCs, and significantly decreased after miR-148a-3p upregulation in human adipose-derived MSCs (Fig. 8C). The mRNA and protein levels of ALCAM were significantly reduced after human adipose-derived MSCs were transfected with shRNA specifically targeting ALCAM (Fig. 8D). Migration and invasion assays showed that knockdown of ALCAM reduced the migration and invasion abilities of human adipose-derived MSCs (Figs. 8E, F). In conclusion, our results provide evidence that circ_0004303 upregulates the level of ALCAM by acting as a miR-148a-3p sponge, and ALCAM can regulate the migration and invasion ability of human adipose-derived MSCs.

Discussion

To date, a substantial body of research has shown that exosomes secreted by tumor cells influence the functions of MSCs, but the effects and the mechanisms of such effects vary depending on the sources of the MSCs and the exosomes. Our study found that exosomes of AGS can affect the gene expression of human adipose-derived MSCs and enhance their migration and invasion ability. Results have shown that the expression of some circular RNAs is significantly different after human adipose-derived MSCs being treated with exosomes secreted by AGS for 24 h. Through a series of in vitro experiments, we further identified that circ_0004303 could regulate the migration and invasion abilities of human adipose-derived MSCs. This study enriches the research field of circular RNAs in gastric cancer.

Studies have shown that circular RNAs can play an important role through different modes, such as acting as sponges to absorb miRNA, binding to proteins, translating into polypeptides or proteins, and generating pseudogenes. Competitive endogenous RNA (ceRNA) has many miRNA binding sites and can act as miRNA sponge to regulate the activity of miRNA on its target genes [23]. Circular RNA Cdr1as regulates the stability of miR-7 in neurons, while miR-671 regulates the level of Cdr1as. Cdr1as and miRNAs directly interact with it play an important role in sensorimotor gating and synaptic transmission [24]. circHIPK3 acts as a miR-124 sponge to inhibit miR-124 activity and regulate cell growth [25].

In this study, it was found that circ_0004303 was mainly distributed in the cytoplasm through nucleocytoplasmic separation assay. Database prediction combined with dual luciferase reporter gene assay further confirmed that circ_0004303 acted as a sponge for miR-148a-3p. MiRNA is an important posttranscriptional regulator, which leads to decreased mRNA stability by binding to the target site of mRNA 3′-UTR [26]. By using database prediction combined with literature review, the target gene ALCAM of miR-148a-3p was obtained. These findings indicate that circ_0004303 can act as a ceRNA to regulate ALCAM gene expression as a miR-148a-3p sponge, thereby affecting the biological functions of human adipose-derived MSCs.

ALCAM (CD166) belongs to the immunoglobulin superfamily and consists of five immunoglobulin-like domains [27]. ALCAM is expressed in a variety of cells, such as neurons, fibroblasts, endothelial cells, and so on [28]. ALCAM-mediated cell adhesion is essential in different physiological and pathological processes, especially in terms of leukocyte exudation, immune synapse stabilization, T cell activation and proliferation, and tumor growth and metastasis [29]. The overexpression of ALCAM promotes the progression of malignant mesothelioma, and ALCAM can be used as a potential therapeutic target for malignant mesothelioma [21]. ALCAM can promote the migration, invasion, and metastasis of tumor cells and thus can be used as a marker for the recurrence of endometrial cancer [30].

In the tumor tissue microenvironment, ALCAM plays an integrated role in regulating cell adhesion, growth, invasion, and proteolysis [31]. Knockdown of ALCAM significantly increases the growth and migration ability of gastric epithelial cells HFE145 [32]. High levels of ALCAM on the membrane of gastric cancer cells and in the serum of patients with gastric cancer are signs of poor prognosis in patients with gastric cancer [33]. The level of ALCAM in the serum of patients with gastric cancer is significantly higher than that in the control group, and the level of ALCAM in the serum can be used as a diagnostic indicator for patients with gastric cancer [34]. In this study, we found that circ_0004303 acts as a miR-148a-3p sponge to reduce the inhibition of miR-148a-3p on ALCAM expression. The reduction of ALCAM can reduce the migration and invasion abilities of human adipose-derived MSCs.

Conclusion

In conclusion, our study illustrates the mechanism by which circ_0004303 regulates the biological function of hAMSCs, and that the expression of ALCAM in hAMSCs will affect the migration and invasion ability of hAMSCs and further affects the homing of hAMSCs to tumor tissue. The biological characteristics of MSCs homing to tumors will change and form phenotypes that promote tumor progression.

Availability of Data and Materials

All data generated or analyzed during this study are included either in this article or in the Supplementary Materials and Methods, Tables, Figures, and Figure Legends files.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by grants from The National Key Research and Development Program of China (2016YFA0101000,2016YFA0101003,20 18YFA0109800); CAMS Innovation Fund for Medical Sciences (2017-I2M-3-007, 2017-2017-I2M-3-006); Supported by the 111 Project (B18007) National Natural Science Foundation of China (81672313, 81700782).

Supplementary Material

Supplementary Figure S1

Supplementary Table S1

References

Torre

, Bray

, Siegel

, Ferlay

, Lortet-Tieulent

and Jemal

. (2015). Global cancer statistics, 2012. CA Cancer J Clin, 65:87–108.

Wang

, Sun

, Deng

, Qi

, Feng

, Fang

, Ma

, Wang

, Liang

, Xu

and Zhou

. (2018). A novel nomogram individually predicting disease-specific survival after D2 gastrectomy for advanced gastric cancer. Cancer Commun (Lond), 38:23.

Digklia

and Wagner

. (2016). Advanced gastric cancer: current treatment landscape and future perspectives. World J Gastroenterol, 22:2403–2414.

Spill

, Reynolds

, Kamm

and Zaman

. (2016). Impact of the physical microenvironment on tumor progression and metastasis. Curr Opin Biotechnol, 40:41–48.

Bianco

(2014). “Mesenchymal” stem cells. Annu Rev Cell Dev Biol, 30:677–704.

Nomoto-Kojima

, Aoki

, Uchihashi

, Matsunobu

, Koike

, Ootani

, Yonemitsu

, Fujimoto

and Toda

. (2011). Interaction between adipose tissue stromal cells and gastric cancer cells in vitro. Cell Tissue Res, 344:287–298.

Moradi

, Eslami

, Goudarzi

, Hajishafieeha

, Soleimani

, Mohammadzadeh

and Ardeshirylajimi

. (2016). Role of Helicobacter pylori on cancer of human adipose-derived mesenchymal stem cells and metastasis of tumor cells-an in vitro study. Tumour Biol, 37:3371–3378.

Suzuki

, Sun

, Origuchi

, Kanehira

, Takahata

, Itoh

, Umezawa

, Kijima

, Fukuda

and Saijo

. (2011). Mesenchymal stromal cells promote tumor growth through the enhancement of neovascularization. Mol Med, 17:579–587.

, Wang

, Zhu

, Li

, Han

and Zhao

. (2016). Lung tumor exosomes induce a pro-inflammatory phenotype in mesenchymal stem cells via NFκB-TLR signaling pathway. J Hematol Oncol, 9:42.

10.

Keller

, Ridinger

, Rupp

A-K

, Janssen

JWG

and Altevogt

. (2011). Body fluid derived exosomes as a novel template for clinical diagnostics. J Transl Med, 9:86.

11.

Bobrie

and Théry

. (2013). Exosomes and communication between tumours and the immune system: are all exosomes equal?. Biochem Soc Trans, 41:263–267.

12.

Lin

, Du

, Cao

, Huang

, Yu

, Zhang

, Li

, Wang

and Shi

. (2016). Tumour cell-derived exosomes endow mesenchymal stromal cells with tumour-promotion capabilities. Oncogene, 35:6038–6042.

13.

Wilusz

and Sharp

. (2013). Molecular biology. A circuitous route to noncoding RNA. Science, 340:440–441.

14.

Salzman

, Chen

, Olsen

, Wang

and Brown

. (2013). Cell-type specific features of circular RNA expression. PLoS Genet, 9:e1003777.

15.

Han

, Li

, Wang

, Su

, Hou

, Gu

, Qian

, Lin

, Liu

, et al. (2017). Circular RNA circMTO1 acts as the sponge of microRNA-9 to suppress hepatocellular carcinoma progression. Hepatology, 66:1151–1164.

16.

Yang

, Gao

, Zhang

, Yan

, Sun

, Xiao

, Huang

, Yang

, Zhao

, et al. (2018). Novel role of FBXW7 circular RNA in repressing glioma tumorigenesis. J Natl Cancer Inst, 110:304–315.

17.

Cao

, Sun

, Liao

, Meng

, Han

and Zhao

. (2005). Human adipose tissue-derived stem cells differentiate into endothelial cells in vitro and improve postnatal neovascularization in vivo. Biochem Biophys Res Commun, 332:370–379.

18.

Lin

, Wang

and Zhao

. (2013). Exosomes from human adipose-derived mesenchymal stem cells promote migration through Wnt signaling pathway in a breast cancer cell model. Mol Cell Biochem, 383:13–20.

19.

Shen

, Xue

, Li

, Ba

, Gu

, Sun

, Han

and Zhao

. (2019). Effects of gastric cancer cell-derived exosomes on the immune regulation of mesenchymal stem cells by the NF-kB signaling pathway. Stem Cells Dev, 28:464–476.

20.

Darvishi

, Boroumandieh

, Majidzadeh

, Salehi

, Jafari

and Farahmand

. (2020). The role of activated leukocyte cell adhesion molecule (ALCAM) in cancer progression, invasion, metastasis and recurrence: a novel cancer stem cell marker and tumor-specific prognostic marker. Exp Mol Pathol, 115:104443.

21.

Ishiguro

, Murakami

, Mizuno

, Fujii

, Kondo

, Usami

, Yokoi

, Osada

and Sekido

. (2012). Activated leukocyte cell-adhesion molecule (ALCAM) promotes malignant phenotypes of malignant mesothelioma. J Thorac Oncol, 7:890–899.

22.

Ferragut

, Cagnoni

, Colombo

, Sánchez Terrero

, Wolfenstein-Todel

, Troncoso

, Vanzulli

, Rabinovich

, Mariño

and Elola

. (2019). Dual knockdown of Galectin-8 and its glycosylated ligand, the activated leukocyte cell adhesion molecule (ALCAM/CD166), synergistically delays in vivo breast cancer growth. Biochim Biophys Acta Mol Cell Res, 1866:1338–1352.

23.

, Yang

and Chen

. (2018). The biogenesis, functions, and challenges of circular RNAs. Mol Cell, 71:428–442.

24.

Piwecka

, Glazar

, Hernandez-Miranda

, Memczak

, Wolf

, Rybak-Wolf

, Filipchyk

, Klironomos

, Cerda Jara

, et al. (2017). Loss of a mammalian circular RNA locus causes miRNA deregulation and affects brain function. Science, 357:eaam8526.

25.

Zheng

, Bao

, Guo

, Li

, Chen

, Luo

, Lyu

, Li

, et al. (2016). Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nat Commun, 7:11215.

26.

Cho WC. (2007). OncomiRs: the discovery and progress of microRNAs in cancers. Mol Cancer, 6:60.

27.

Aruffo

, Bowen

, Patel

, Haynes

, Starling

, Gebe

J.A

and Bajorath

. (1997). CD6-ligand interactions: a paradigm for SRCR domain function?. Immunol Today, 18:498–504.

28.

Ikeda

and Quertermous

. (2004). Molecular isolation and characterization of a soluble isoform of activated leukocyte cell adhesion molecule that modulates endothelial cell function. J Biol Chem, 279:55315–55323.

29.

Gilsanz

, Sánchez-Martín

, Gutiérrez-López

, Ovalle

, Machado-Pineda

, Reyes

, Swart

, Figdor

, Lafuente

and Cabañas

. (2013). ALCAM/CD166 adhesive function is regulated by the tetraspanin CD9. Cell Mol Life Sci, 70:475–493.

30.

Devis

, Moiola

, Masia

, Martinez-Garcia

, Santacana

, Stirbat

, Brochard-Wyart

, Á García, Alameda

, et al. (2017). Activated leukocyte cell adhesion molecule (ALCAM) is a marker of recurrence and promotes cell migration, invasion, and metastasis in early-stage endometrioid endometrial cancer. J Pathol, 241:475–487.

31.

van Kilsdonk

, Wilting

, Bergers

, van Muijen

, Schalkwijk

, van Kempen

and Swart

. (2008). Attenuation of melanoma invasion by a secreted variant of activated leukocyte cell adhesion molecule. Cancer Res, 68:3671–3679.

32.

Jin

, Selaru

, Cheng

, Kan

, Agarwal

, Mori

, Olaru

, Yang

, David

, et al. (2011). MicroRNA-192 and -215 are upregulated in human gastric cancer in vivo and suppress ALCAM expression in vitro. Oncogene, 30:1577–1585.

33.

, Du

, Nie

, Zhou

, Cao

and Li

. (2015). Overexpression of activated leukocute cell adhesion molecule in gastric cancer is associated with advanced stages and poor prognosis and miR-9 deregulation. Mol Med Rep, 11:2004–2012.

34.

Erturk

, Tastekin

, Bilgin

, Serilmez

, Bozbey

and Sakar

. (2016). Serum activated leukocyte cell adhesion molecule and intercellular adhesion molecule-1 in patients with gastric cancer: can they be used as biomarkers?. Biomed Pharmacother, 77:86–91.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

1.05 MB

0.09 MB

Gastric Cancer Cell-Derived Exosomes Can Regulate the Biological Functions of Mesenchymal Stem Cells by Inducing the Expression of Circular RNA circ_0004303

Abstract

Introduction

Materials and Methods

Cell culture

Exosome extraction

Transmission electron microscopy

Western blot analysis

Real-time PCR

Exosome staining

Cell transfection

Transwell assay

Luciferase reporter assay

Statistical analysis

Results

Differentiation potential and phenotypic identification of human adipose-derived MSCs

Identification of AGS cell-derived exosomes and observation of exosomes entering human adipose-derived MSCs

Time and concentration dependence of the effects of AGS cell-derived exosomes on human adipose-derived MSCs

Effects of AGS cell-derived exosomes on human adipose-derived MSCs gene expression profile

Analysis of DDX60-derived circular RNAs in human adipose-derived MSCs

circ_0004303 regulates the migration and invasion ability of human adipose-derived MSCs

circ_0004303 regulates the migration and invasion abilities of human adipose-derived MSCs via sponging miR-148a-3p

circ_0004303 upregulates the level of ALCAM by acting as a miR-148a-3p sponge, and ALCAM is involved in regulating the migration and invasion abilities of human adipose-derived MSCs

Discussion

Conclusion

Availability of Data and Materials

Footnotes

Author Disclosure Statement

Funding Information

Supplementary Material

References

Supplementary Material