Association of Single-Nucleotide Polymorphisms in Immune-Related Genes with Development of Dengue Hemorrhagic Fever in a Mexican Population

Abstract

Single-nucleotide polymorphisms (SNPs) occurring in immune-related genes have been associated with risk or protection for development of dengue, depending on ethnicity. Here, we genotyped seven SNPs located in immune response-related genes to identify their association with severe forms of dengue in patients from an endemic region in Mexico. One hundred and thirty-eight patients with dengue fever (DF), thirty-one dengue hemorrhagic fever (DHF) patients, as well as 304 healthy donors were genotyped by using a TaqMan-based approach. SNP analysis, including rs1800629 (TNF), rs4804803 (CD209), rs2780831 (JAK1), rs1801274 (FCGR2A), rs231775 (CTLA4), rs12979860, and rs8099917 (IFNL3), was performed. The rs1800629 A-allele in the TNF gene was associated with an increased risk of DHF (OR = 3.4, CI = 1.235–9.284 p = 0.0212) whereas SNPs rs4804803, rs2780831, rs1801274, rs231775, rs12979860, and rs8099917 showed no association in this cohort. These results show that allelic variations in TNF can play an important role in the development of DHF. However, the lack of association between all remaining SNPs and DHF suggests that the genetic background might directly modify the role of these immune-related molecules, leading to the milder illness often observed in a Mexican population.

Introduction

Dengue virus (DENV) can cause a wide range of clinical manifestations ranging from asymptomatic infection to acute fever, headache, retro-orbital pain, myalgia, arthralgia, nausea, vomiting, maculopapular rash, and moderate hepatomegaly, clinically associated with dengue fever (DF). In some instances, DENV infection can progress to a severe disease, also referred to as dengue hemorrhagic fever (DHF). DHF is characterized by fluid accumulation, plasma leakage, hematocrit increase, thrombocytopenia, evidence of increased vascular permeability, and hemorrhage, which, in turn, can lead to hypovolemic shock (dengue shock syndrome, DSS) and death (17,47).

The mechanisms directly involved in the pathogenesis of dengue are not well understood. The smaller number of dengue seropositive individuals who develop severe forms of the disease, compared with individuals who only have moderate forms, suggests the participation of host genetic factors. In addition, ethnicity has also been associated with differences in susceptibility (16,36). The association between single-nucleotide polymorphisms (SNPs) throughout the host genome, particularly in genes coding for molecules related to the immune response, and the risk of DHF has been explored in different populations (9). In Thai (34) and Taiwanese (43) populations, the G-allele in SNP rs4804803 A>G, located in position −336 of the promoter region of the CD209 gene, which encodes DC-SIGN, a DENV receptor in dendritic cells (23,29,41), has been associated with a higher induction of this molecule. In addition, a higher risk for DHF has been associated with GG and AG genotypes. Conversely, in a Brazilian cohort, the GG genotype has been associated with protection against severe dengue (48) and a recent meta-analysis has shown no overall association. Thus, the participation of SNPs occurring in rs4804803 remains inconclusive.

TNF-alpha (TNF-α) is a pleiotropic cytokine that plays an important role in the inflammatory response (7,46). High levels of TNF-α have been reported in patients with dengue, and several groups have identified polymorphisms in the TNF gene that can affect transcription rates (11,12). SNP rs1800629 G>A, located in position −308 of the promoter region, has shown to be relevant in DENV infection. The A-allele has been associated with DHF in Venezuelan (11) and Cuban populations (33). However, other studies in adult populations from India (2), Mexico (14), and Brazilian children (48) reported no association between rs1800629 and DHF.

Janus Kinase 1 (JAK1) is a signaling protein that is associated with the type 1 interferon (IFN) response pathway. DENV nonstructural proteins block phosphorylation and downregulate expression of major components of the JAK/STAT pathway, inhibiting gene expression in response to IFN (28). SNP rs2780831, located in position +1421 in intron 2 of the JAK1 gene, originates a base substitution A > G that increased the risk of developing DHF (37). This suggests that SNPs in modulatory sites of JAK1 can modify the correct response mediated by the JAK/STAT signaling pathway.

FcγRIIa (CD32) is a cell receptor that mediates antibody-dependent enhancement (ADE) by binding to antibody-virus complexes, a mechanism that DENV uses to amplify infection (25). SNP rs1801274, at position +494 (A>G) of the FCGR2A gene, results in the substitution of Histidine by Arginine at amino-acidic position +131 (45). Studies in Vietnamese (26), Cuban (13), and Pakistani (27) populations reported a protective role for arginine homozygotes against DHF, whereas individuals with Histidine genotypes were more likely to develop severe clinical manifestations.

CTLA-4 plays an essential role in maintaining immune homeostasis as a negative regulator for T cells (44). The SNP rs231775 A>G is located in position +49 in exon 1 of the CTLA4 gene. The G-allele alters the intracellular distribution of CTLA-4 and, consequently, the production of IL-2, influencing T cell proliferation (19). The A-allele is less frequent in patients with DHF compared with DF patients (10). In a Taiwanese population, the combination of G-allele and a CC genotype in position −509 of the promoter region of the TGF-β1 almost doubled the risk of developing DHF (5).

IL-28B belongs to the family of type III Interferons. IL-28B seems to play an important role in RNA virus infection, including dengue (18). Two polymorphisms have been described in an intergenic region near the IFNL3 gene, rs12979860 T > C and rs8099917 T>G, that directly impact the expression of the protein (18,42). The T-allele for SNP rs12979860 and the G-allele for SNP rs8099917 are two variants associated with higher protein production (22,39,40). We propose that SNPs rs12979860 and rs8099917 could be involved in the development of DHF since lambda IFNs play a crucial role in controlling the infection at earlier stages.

Here, we investigate whether these seven SNPs occurring in immune-related genes are associated with severity of dengue in Mexican individuals.

Methods

Clinical characteristics of patients and healthy donors

Our study included 169 patients, 138 DF and 31 DHF, according to WHO criteria (47). Diagnosis was performed within 1–5 days after fever onset. Confirmation of diagnosis was carried out by identification of IgM and IgG antibodies and NS1 with SD BIOLINE Dengue Duo rapid test kit (Standard Diagnostics, Suwon city, Gyeonggi-do, Republic of Korea) following the manufacturer's instructions. To identify primary or secondary infection, the Platelia™ Dengue IgG Capture assay (Bio-Rad, Marnes-la-Coquette France) was used according to the manufacturer's instructions. The infecting viral serotype was determined by real-time multiplex RT-PCR based on the method described by Chien et al. (6) using the following primers and probes: mFU1: 5′ TACAACATGATGGGAAAGCGAGAGAAA AA 3; CFD2: 5′ GTGTCCCAGCCGGCGGTGTCATCAGC 3′; probe DEN-1: 5′ FAM–TCAGAGACATATCAAAGATTCCAGGGGG-BHQ1 3; probe DEN-2: 5′ Texas Red- AAGAGACGTGAGCAGGAAGGAAGGGGGAGCBHQ2 3′; probe DEN-3: 5′ CY5-TGAGAGATATTTCCAAGATACCCGGAGGAG-BHQ3 3; probe DEN-4: 5′ HEX-TGGAGGAGATAGACAAGAAGGATGGAGACC-BHQ1 3′.

Healthy subjects (304) with equivalent socioeconomic conditions were also enrolled in this study. Both patients and healthy subjects were Mexican Mestizos, Mexicans by birth, with Mexican ancestors at least three generations back and with a Hispanic last name as described in previous studies (14,24,35). Healthy donors (HD) were negative for both Duo rapid test kit and Platelia Dengue IgG Capture assay. All subjects included in this study come from the geographic region of the State of Veracruz.

Genotyping

Genomic DNA was isolated from 5 mL of whole blood by using the Qiagen DNA extraction kit (QIAGEN, Valencia). A total of 10 ng of genomic DNA was used as template for amplification. Genotypes were determined by using commercial TaqMan allelic discrimination assay kits with MGB probes (Applied Biosystems, Foster City, CA) for the SNPs: rs1800629 (TNF), rs4804803 (CD209), rs2780831 (JAK1), rs1801274 (FCGR2A), rs231775 (CTLA4), rs12979860, and rs8099917 (IFNL3). PCR amplification was performed on a LightCycler 480 real-time PCR system (Roche, San Francisco). The amplification protocol included an initial activation at 95°C for 10 min, followed by 40 cycles of denaturation at 92°C for 15 sec and alignment and extension at 60°C for 60 sec. Results were analyzed by using the TaqMan Genotyper Software and were compared with sequenced SNPs that served as a gold standard.

Statistical analysis

Hardy–Weinberg equilibrium (HWE) for SNPs genotype frequencies were established by χ ² test. The genotype frequencies for each polymorphism were estimated and reported as percentage. Genotypic and allelic frequencies between patients with DF and DHF were compared separately for each SNP by χ ² test. Odds ratios (OR) and 95% confidence intervals (CI) were calculated, and a p-value <0.05 was considered statistically significant. Analyses were carried out by using MedCalc^® version 13.3.3.0 and SPSS Statistics v19. Statistical power to detect an association of SNPs with the clinical form of dengue was calculated while taking into account the frequencies of the polymorphisms and the incidence of dengue in Mexican populations (32), under an additive model, using QUANTO software.

Ethical considerations

This study was approved by the Research Ethics Committee (CE-IIMBUV-2015-13, Instituto de Investigaciones Biomedicas, Universidad Veracruzana), and informed consent was obtained from patients and HD enrolled at the Hospital Regional de Alta Especialidad de Veracruz.

Results

Clinical characteristics of dengue patients are shown in Table 1. According to symptoms and following the WHO criteria, 138 were classified as DF patients and 31 were classified as DHF patients. We observed a high number of females (60.7%) in the DHF group. No age differences were found ( \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} = 33.89 male, and \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} = 35.58 female). All patients enrolled in this study were infected by viral serotype 1, as demonstrated by RT-PCR. Patients classified as DHF presented grades I or II of severity as defined by WHO guidelines (47); 64 of DF patients were classified as primary infection and 74 as secondary infection, whereas of the 31 DHF patients, only 5 were classified as primary infection (Table 1).

Table 1.

Clinical Characteristics of Dengue Patients

	HD% (n = 304)	DF% (n = 138)	DHF% (n = 31)
Gender
Male	54.3 (165)	55.1 (76)	38.7 (12)
Female	45.7 (139)	44.9 (62)	61.3 (19)
Age	\documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} = 34.6	\documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} = 33.89	\documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} = 35.58
	SD = 15.1262	SD = 17.3847	SD = 15.1322
Days of evolution		\documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} = 5.5	\documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} = 6 = 6
		SD = 3.72	SD = 2.83
Primary infection		46.4 (64)	15.4 (5)
Secondary infection		53.6 (74)	84.6 (26)
Fever		75.4 (104)	96.8 (30)
Headache		96.4 (133)	90.3 (28)
Myalgia		87.0 (120)	96.8 (30)
Arthralgia		93.5 (129)	93.5 (29)
Retroocular pain		67.4 (93)	77.4 (24)
Abdominal pain		16.6 (23)	58.1 (18)
Nausea/vomiting		65.2 (90)	93.5 (29)
Metrorrhagia		0 (0)	6.5 (2)
Petequias		5.1 (7)	32.3 (10)
Gingivorrhages		0 (0)	45.2 (14)
Epistaxis		0 (0)	3.2 (1)
Rash		29.0 (40)	51.6 (16)
Hematuria		0 (0)	3.2 (1)
Hematemesis		0 (0)	3.2 (1)
Diarrhea		18.1 (25)	25.8 (8)

HD, healthy donors; DF, dengue fever; DHF, dengue hemorrhagic fever; \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\usepackage{upgreek}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document}$$\bar { \rm X}$$ \end{document} , mean; SD, standard deviation.

A control group of 304 individuals was analyzed to establish the allelic and genotypic frequency for all studied SNPs that were in Hardy–Weinberg equilibrium, with the exception of SNP CD209–336 A>G (rs4804803). For this SNP, neither homozygous GG nor heterozygous (AG) individuals were identified. Therefore, no associations were established for this SNP (Tables 2 and 3). No statistically significant differences were found between the control and experimental groups with either clinical forms (DF or DHF) (data not shown).

Table 2.

Genotypic Distribution of CD209, TNF, JAK1, FCGR2A, CTLA4, and IFNL3 Genetic Variants in Healthy Donors

SNP	Genotype	Frequency (%)
CD209 rs4804803	GG	0 (0)
	GA	0 (0)
	AA	304 (100)
	A	608 (100)
	G	0 (0)
TNF rs1800629	GG	275 (90.5)
	GA	29 (9.5)
	AA	0 (0)
	A	29 (4.8)
	G	579 (95.2)
JAK1 rs2780831	AA	100 (32.9)
	AG	132 (43.4)
	GG	72 (23.7)
	A	332 (54.6)
	G	276 (45.4)
FCGR2A rs1801274	AA	71 (23.4)
	AG	145 (47.7)
	GG	88 (28.9)
	A	287 (47.2)
	G	321 (52.8)
CTLA4 rs231775	AA	77 (25.4)
	AG	143 (47.0)
	GG	84 (27.6)
	A	297 (48.8)
	G	311 (51.2)
IFNL3 rs12979860	TT	72 (23.7)
	TC	158 (52.0)
	CC	74 (24.3)
	T	302 (49.7)
	C	306 (50.3)
IFNL3 rs8099917	TT	95 (31.3)
	TG	142 (46.7)
	GG	67 (22.0)
	T	332 (54.6)
	G	276 (45.4)

SNP, single-nucleotide polymorphism.

Table 3.

Genotypic and Allelic Distribution of CD209, TNF, JAK1, FCGR2A, CTLA4, and IFNL3 Genetic Variants in Dengue Patients

	Frequency (%)		DHF vs. DF
SNP	DF	DHF	OR (95% CI)	p-Value
CD209 rs4804803	GG	0 (0)	0 (0)
	GA	0 (0)	0 (0)
	AA	138 (100)	31 (100)
	G	0 (0)	0 (0)
	A	138 (100)	31 (100)
TNF rs1800629	GG	128 (92.8)	25 (80.7)
	GA	10 (7.2)	5 (16.1)
	AA	0 (0)	1 (3.2)	3.1 (1.023–9.223)	0.0374 ^a
	A	10 (3.6)	7 (11.3)
	G	566 (96.4)	55 (88.7)	3.4 (1.235–9.284)	0.0126 ^a
JAK1 rs2780831	AA	43 (31.2)	10 (32.3)
	AG	72 (52.2)	16 (51.6)
	GG	23 (16.7)	5 (16.1)	0.9 (0.3846–2.117)	0.8134
	A	158 (57.2)	36 (58.1)
	G	118 (42.8)	26 (41.9)	1.0 (0.5918–1.807)	0.9063
FCGR2A rs1801274	AA	31 (22.5)	8 (25.8)
	AG	73 (52.9)	13 (41.9)
	GG	34 (24.6)	10 (32.3)	0.7 (0.2789–1.594)	0.3599
	A	135 (48.9)	29 (46.8)
	G	141 (51.1)	33 (53.2)	1.1 (0.6273–1.892)	0.7607
CTLA4 rs231775	AA	33 (23.9)	4 (12.9)
	AG	62 (44.9)	18 (58.1)
	GG	43 (31.2)	9 (29.0)	2.1 (0.6916–6.507)	0.1804
	A	128 (46.4)	26 (41.9)
	G	148 (53.6)	36 (58.1)	1.2 (0.6859–2.091)	0.5257
IFNL3 rs12979860	TT	37 (26.8)	9 (29.0)
	TC	69 (50.0)	19 (61.3)
	CC	32 (23.2)	3 (9.7)	2.8 (0.8109–9.978)	0.0903
	T	143 (51.8)	25 (40.3)
	C	133 (48.2)	37 (59.7)	1.4 (0.7864–2.409)	0.3242
IFNL3 rs8099917	TT	46 (33.3)	7 (22.6)
	TG	60 (43.5)	17 (54.8)
	GG	32 (23.2)	7 (22.6)	1.7 (0.6876–4.274)	0.2436
	T	152 (55.1)	31 (50.0)
	G	124 (44.9)	31 (50.0)	1.2 (0.7061–2.128)	0.4838

The statistical analysis for genotypic distribution was performed considering the combined group of homozygotes of the allele previously associated to DHF as well as the group of heterozygotes and then compared with the group of homozygotes of the other allele. p-value was determined by χ ² test.

Boldface indicates statistical significance.

DF, dengue fever (n = 138); DHF, dengue hemorrhagic fever (n = 31); OR, odds ratio; CI, confidence interval.

For the SNP TNF −308 G > A (rs1800629) frequency distribution was significantly different in DF compared with DHF patients. GG, GA, and AA distributions were as follows: 92.8%, 7.2%, and 0% for DF patients versus 80.7%, 16.1%, and 3.2% for DHF patients, where frequencies for GA and AA genotypes were significantly higher in patients with DHF (OR: 3.1, CI: 1.023–9.223, p = 0.0374) (Table 2). Allelic analysis also showed an association between A-allele of rs1800629 and the risk of DHF (OR: 3.4, CI: 1.235–9.284, p = 0.0212) (Table 3) with a statistical power of 0.7799 (Table 4).

Table 4.

Statistical Power for the Association of the Polymorphisms with Dengue

SNP	Group	Sample size per group	Model of inheritance	Allele frequency	Incidence of dengue	Statistical power
CD209 rs4804803	HD	304	Additive
	DEN	169		1.00	0.4922	0.2484
	DHF	31		1.00	0.2338	0.3423
TNF rs1800629	HD	304	Additive
	DEN	169		0.08	0.4922	0.7156
	DHF	31		0.16	0.2338	0.7799
JAK1 rs2780831	HD	304	Additive
	DEN	169		0.46	0.4922	0.9991
	DHF	31		0.44	0.2338	0.9909
FCGR2A rs1801274	HD	304	Additive
	DEN	169		0.48	0.4922	0.9991
	DHF	31		0.47	0.2338	0.9933
CTLA4 rs231775	HD	304	Additive
	DEN	169		0.49	0.4922	0.9992
	DHF	31		0.44	0.2338	0.9911
IFNL3 rs12979860	HD	304	Additive
	DEN	169		0.49	0.4922	0.9992
	DHF	31		0.56	0.2338	0.9968
IFNL3 rs8099917	HD	304	Additive
	DEN	169		0.46	0.4922	0.9991
	DHF	31		0.50	0.2338	0.9946

For dengue, sample size corresponded to an unmatched case-control design (1:2) and for DHF, to an unmatched case-control design (1:4).

DEN, the combined group of dengue fever and dengue hemorrhagic fever.

For JAK1 + 1421 A>G (rs2780831), FCGR2A +494 A>G (rs1801274), CTLA4 + 49 A>G (rs231775), IFNL3 T > C (rs12979860), and IFNL3 T > G (rs8099917), the frequency distributions of genotypes were similar between DF and DHF patients, with no significant differences between both groups and without association to severe dengue (Tables 2 and 3).

Discussion

The intricate mechanisms involved in dengue immunopathogenesis are not fully understood. The great number of epidemiological studies performed in patients with DF and DHF confirms that the progression and the outcome of the disease depends on a series of multiple factors, where the immunological state of the patients and the ethnicity play a crucial role in morbidity and clinical presentation (17,20,21,36).

Studies of SNPs association in genes encoding for molecules of the immune response such as DC-SIGN, TNF-alpha, JAK1, FcγRIIa, and CTLA-4 are available for other populations, but limited information is available for Mexican individuals.

In this work, we found that the A-allele of SNP rs1800629 in the TNF gene was associated with a higher risk for DHF when compared with DF patients in a cohort from the State of Veracruz, México. According to our results, a previous study from Cuba (33) has reported an association between A-allele of rs1800629 and increased risk of DHF when comparing with DF, but no association with HD, stating the importance of identifying molecular markers of progression to severe forms. In a study from Venezuela (11), the authors identified the association of rs1800629 with DHF when comparing only with HD. However, this study did not include DF patients. Other studies in the Indian population have not found associations between this SNP and DHF. Nevertheless, when analysis was done in association with HLA-DRB1⁄07/⁄15, an association with DHF for both DF and healthy controls was observed (2).

On the other hand, in a previous study analyzing a Mexican cohort from the State of Morelos (14), authors reported no association between the SNP rs1800629 and the development of severe forms of dengue. Likewise, no associations were found in a Brazilian pediatric cohort (48).

In addition, the meta-analysis performed by Xavier-Carvalho et al. (48) with the reports by Alagarasu et al. (2), Fernandez-Mestre et al. (11), and Garcia-Trejo et al. (14), which included a pool of 193 DHF cases and 422 DF cases, showed no association between DF and DHF cases. These cumulative results highlight the complexity of the relationship between the genetic background of the patient and the development of severe disease.

We also analyzed other polymorphisms, including rs4804803 (CD209), rs2780831 (JAK1), rs1801274 (FCGR2A), rs231775 (CTLA4), rs12979860, and rs8099917 (IFNL3), but no association was found between these SNPs and severe forms of dengue.

The frequency of the minor allele of SNP rs4804803 located in the promoter region of CD209 varies significantly around the world. In our cohort, we observe the absence of the G-allele, despite it being reported in the Mexican population (30). It has been demonstrated that this allele induces a higher expression of the protein (34). It has also been reported that the AG genotype induces higher expression of mRNA and cell surface protein expression in monocyte-derived dendritic cells stimulated with DENV. The AG genotype also induces lower viral replication and higher levels of TNF-α, IL-12p40, and IP-10 compared with genotype AA, suggesting that this variation can play an important regulatory role in the development of clinical forms of infection (43).

Studies in different populations report contrasting associations for rs4804803. In two Asian populations, the G-allele in SNP −336 in CD209 has been associated with DHF risk (34,43). Conversely, in a population from Brazil, an association between the GG genotype and protection against severe dengue has been reported (48). Our results are in agreement with such findings.

Meta-analysis has also been done for rs4804803. Interestingly, no associations between this SNP and severe dengue were observed. However, when the meta-analysis was performed including only studies in Asian populations, the results show an association between the G-allele and severity, whereas an association between this same allele and protection was obtained in Brazilian subjects (1,48). Other studies have shown that the heterozygous AG and the homozygous GG are associated with protection when comparing DF cases versus healthy controls; however, these same genotypes are associated with risk when comparing DF versus DHF patients (34).

The G-allele in rs4804803 frequency varies greatly from population to population as demonstrated in a Brazilian report, where this allele is present in 28% of the population from Rio de Janeiro and 38% in that from Salvador (48). In our cohort, the absence of this genotype could be attributed to multiple factors, including sample size. However, the presence of this allele in other populations in México (30) warrants the inclusion of this SNP in future studies, including other Mexican ethnicities.

Association of the GG genotype of SNP rs2780831, located in intron 2 of JAK1 with DHF, was first described by Silva et al. (37). In the study, multiple IFN-regulated genes were under-expressed in patients with severe dengue, suggesting that regulatory polymorphisms in JAK1 affect the activation cascade in severe dengue. In our study, however, no association was observed.

SNP rs1801274, located in FCGR2A, and its association with dengue was first reported by Loke et al. (26). They found that the frequency of genotype RR (GG) was higher in patients with DF. These findings were further confirmed by García et al. (13), where genotype RR showed to be protective against DHF. We found that the frequency of the allele coding for Arginine was slightly increased in DHF patients, although no statistical difference was observed. Our results are consistent with findings made by Noecker et al. (30) and Dettogni et al. (8), showing that alleles coding for Histidine are protective. Further studies are needed to define the role of SNP rs1801274 in DENV infection.

SNP rs231775, located in exon 1 of CTLA4, showed frequency trends similar to those previously reported for other Latin American populations (10), where the A-allele was increased in patients with DF. Similarly, we found an increase of the G-allele in patients with DHF as was previously described in the Taiwanese population (not statistically significant). These results suggest that CTLA-4 may not be directly involved in the pathogenesis of DHF (5).

Finally, the SNPs rs12979860 and rs8099917, located near IFNL3, have been associated to various illnesses and viral infections (3) but showed no association with DHF in our study.

Severe dengue-related disease varies greatly among populations (4). The contrasting findings in the various reports of several populations of the world can be a result of other interacting genetic factors in a highly heterogeneous genetic background, epigenetics, and environmental variables (30). Besides genetic variation such as SNPs and indels, we should consider differences in genetic background, age, gender, and viral serotype, among others, that may also affect different aspects of the immune response (38). It is important to mention that the ethnic origins of the populations included in most studies are not clearly identified, which, in turn, can result in discrepancies. The variation among the Mexican populations might be indicative of their significant genetic heterogeneity (15), affecting the susceptibility to infectious agents.

Conclusions

Our results show an association between the A-allele in the TNF SNP rs1800629 and DHF, confirming its participation in the development of severe dengue-related disease.

Footnotes

Acknowledgments

The authors would like to thank Dr. M. T. Horn-Copeland for the helpful English language review of this article. This work was supported by Fondo Sectorial de Investigación en Salud y Seguridad Social SS-IMSS-ISSSTE-CONACYT Grant 2011-C01-161716.

Author Disclosure Statement

No competing financial interests exist.

References

Alagarasu

, Damle

, Bachal

, et al. Association of promoter region polymorphisms of CD209 gene with clinical outcomes of dengue virus infection in Western India. Infect Genet Evol, 2013; 17:239–242.

Alagarasu

, Mulay

, Singh

, et al. Association of HLA-DRB1 and TNF genotypes with dengue hemorrhagic fever. Hum Immunol, 2013; 74:610–617.

Ank

, West

, Bartholdy

, et al. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo. J Virol, 2006; 80:4501–4509.

Carabali

, Hernandez

, Arauz

, et al. Why are people with dengue dying? A scoping review of determinants for dengue mortality. BMC Infect Dis, 2015; 15:301.

Chen

, Wang

, Cheng

, et al. Combination of CTLA-4 and TGFbeta1 gene polymorphisms associated with dengue hemorrhagic fever and virus load in a dengue-2 outbreak. Clin Immunol, 2009; 131:404–409.

Chien

, Liao

, Shu

, et al. Development of real-time reverse transcriptase PCR assays to detect and serotype dengue viruses. J Clin Microbiol, 2006; 44:1295–1304.

Chu

. Tumor necrosis factor. Cancer letters, 2013; 328:222–225.

Dettogni

, Tristao-Sa

, Dos Santos

, et al. Single nucleotide polymorphisms in immune system genes and their association with clinical symptoms persistence in dengue-infected persons. Hum Immunol, 2015; 76:717–723.

Fang

, Hu

, Shang

, et al. Genetic polymorphisms of molecules involved in host immune response to dengue virus infection. FEMS Immunol Med Microbiol, 2012; 66:134–146.

10.

Fernandez-Mestre

, Sanchez

, Balbas

, et al. Influence of CTLA-4 gene polymorphism in autoimmune and infectious diseases. Hum Immunol, 2009; 70:532–535.

11.

Fernandez-Mestre

, Gendzekhadze

, Rivas-Vetencourt

, et al. TNF-alpha-308A allele, a possible severity risk factor of hemorrhagic manifestation in dengue fever patients. Tissue Antigens, 2004; 64:469–472.

12.

Gagnon

, Mori

, Kurane

, et al. Cytokine gene expression and protein production in peripheral blood mononuclear cells of children with acute dengue virus infections. J Med Virol, 2002; 67:41–46.

13.

Garcia

, Sierra

, Perez

, et al. Asymptomatic dengue infection in a Cuban population confirms the protective role of the RR variant of the FcgammaRIIa polymorphism. Am J Trop Med Hyg, 2010; 82:1153–1156.

14.

Garcia-Trejo

, Falcon-Lezama

, Juarez-Palma

, et al. Tumor necrosis factor alpha promoter polymorphisms in Mexican patients with dengue fever. Acta Trop, 2011; 120:67–71.

15.

Gorodezky

, Alaez

, Vazquez-Garcia

, et al. The genetic structure of Mexican Mestizos of different locations: tracking back their origins through MHC genes, blood group systems, and microsatellites. Hum Immunol, 2001; 62:979–991.

16.

Guzman

, Kouri

. Dengue haemorrhagic fever integral hypothesis: confirming observations, 1987–2007. Trans R Soc Trop Med Hyg, 2008; 102:522–523.

17.

Halstead

. Dengue. Lancet, 2007; 370:1644–1652.

18.

Kotenko

. IFN-lambdas. Curr Opin Immunol, 2011; 23:583–590.

19.

Kouki

, Sawai

, Gardine

, et al. CTLA-4 gene polymorphism at position 49 in exon 1 reduces the inhibitory function of CTLA-4 and contributes to the pathogenesis of Graves' disease. J Immunol, 2000; 165:6606–6611.

20.

Kouri

, Guzman

, Valdes

, et al. Reemergence of dengue in Cuba: a 1997 epidemic in Santiago de Cuba. Emerg Infect Dis, 1998; 4:89–92.

21.

Kurane

. Dengue hemorrhagic fever with special emphasis on immunopathogenesis. Comp Immunol Microbiol Infect Dis, 2007; 30:329–340.

22.

Langhans

, Kupfer

, Braunschweiger

, et al. Interferon-lambda serum levels in hepatitis C. J Hepatol, 2011; 54:859–865.

23.

Limon-Flores

, Perez-Tapia

, Estrada-Garcia

, et al. Dengue virus inoculation to human skin explants: an effective approach to assess in situ the early infection and the effects on cutaneous dendritic cells. Int J Exp Pathol, 2005; 86:323–334.

24.

Lisker

. Estructura Genética de la Población Mexicana [Mexican]. Salvat. México, 1981.

25.

Littaua

, Kurane

, Ennis

. Human IgG Fc receptor II mediates antibody-dependent enhancement of dengue virus infection. J Immunol, 1990; 144:3183–3186.

26.

Loke

, Bethell

, Phuong

, et al. Susceptibility to dengue hemorrhagic fever in vietnam: evidence of an association with variation in the vitamin d receptor and Fc gamma receptor IIa genes. Am J Trop Med Hyg, 2002; 67:102–106.

27.

Mohsin

, Mahmood

, Amar

, et al. Association of FcgammaRIIa polymorphism with clinical outcome of dengue infection: first insight from Pakistan. Am J Trop Med Hyg, 2015; 93:691–696.

28.

Munoz-Jordan

. Subversion of interferon by dengue virus. Curr Top Microbiol Immunol, 2010; 338:35–44.

29.

Navarro-Sanchez

, Altmeyer

, Amara

, et al. Dendritic-cell-specific ICAM3-grabbing non-integrin is essential for the productive infection of human dendritic cells by mosquito-cell-derived dengue viruses. EMBO Rep, 2003; 4:723–728.

30.

Noecker

, Amaya-Larios

, Galeana-Hernandez

, et al. Contrasting associations of polymorphisms in FcgammaRIIa and DC-SIGN with the clinical presentation of dengue infection in a Mexican population. Acta Trop, 2014; 138:15–22.

31.

Oliveira

, Lima

, Azevedo Rdo

, Mendonca

, Rodrigues

, Carvalho

, et al. Polymorphism of DC-SIGN (CD209) promoter in association with clinical symptoms of dengue fever. Viral Immunol, 2014; 27:245–249.

32.

Panorama epidemiológico de fiebre por dengue y fiebre hemorrágica por dengue, retrieved from www.epidemiologia.salud.gob.mx/doctos/panodengue/PANORAMAS_2015/Pano_dengue_sem_52_2015.pdf (accessed on February 21, 2017 ).

33.

Perez

, Sierra

, Garcia

, et al. Tumor necrosis factor-alpha, transforming growth factor-beta1, and interleukin-10 gene polymorphisms: implication in protection or susceptibility to dengue hemorrhagic fever. Hum Immunol, 2010; 71:1135–1140.

34.

Sakuntabhai

, Turbpaiboon

, Casademont

, et al. A variant in the CD209 promoter is associated with severity of dengue disease. Nat Genet, 2005; 37:507–513.

35.

Serrano-Sánchez

. Mestizaje e historia de la población de México (con un esbozo antropológico de los lacandones de Chiapas). In: Martín Municio

, García Barreno

, eds. Polimorfismo Génico (HLA) en Poblaciones Hispanoamericanas. Madrid: Real Academia de Ciencias Exactas, Físicas y Naturales, 1996.

36.

Sierra

, Alegre

, Perez

, et al. HLA-A, -B, -C, and -DRB1 allele frequencies in Cuban individuals with antecedents of dengue 2 disease: advantages of the Cuban population for HLA studies of dengue virus infection. Hum Immunol, 2007; 68:531–540.

37.

Silva

, Blanton

, Parrado

, et al. Dengue hemorrhagic fever is associated with polymorphisms in JAK1. Eur J Hum Genet, 2010; 18:1221–1227.

38.

Sole-Violan

, Garcia-Laorden

, Marcos-Ramos

, et al. The Fcgamma receptor IIA-H/H131 genotype is associated with bacteremia in pneumococcal community-acquired pneumonia. Critic Care Med, 2011; 39:1388–1393.

39.

Suppiah

, Moldovan

, Ahlenstiel

, et al. IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet, 2009; 41:1100–1104.

40.

Tanaka

, Nishida

, Sugiyama

, et al. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet, 2009; 41:1105–1109.

41.

Tassaneetrithep

, Burgess

, Granelli-Piperno

, et al. DC-SIGN (CD209) mediates dengue virus infection of human dendritic cells. J Exp Med, 2003; 197:823–829.

42.

Thomas

, Thio

, Martin

, et al. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature, 2009; 461:798–801.

43.

Wang

, Chen

, Liu

, et al. DC-SIGN (CD209) Promoter −336 A/G polymorphism is associated with dengue hemorrhagic fever and correlated to DC-SIGN expression and immune augmentation. PLoS Neglected Trop Dis, 2011; 5:e934.

44.

Wang

, Zhao

, Giscombe

, et al. A CTLA-4 gene polymorphism at position −318 in the promoter region affects the expression of protein. Genes Immun, 2002; 3:233–234.

45.

Warmerdam

, van de Winkel

, Vlug

, et al. A single amino acid in the second Ig-like domain of the human Fc gamma receptor II is critical for human IgG2 binding. J Immunol, 1991; 147:1338–1343.

46.

Wilson

, di Giovine

, Blakemore

, et al. Single base polymorphism in the human tumour necrosis factor alpha (TNF alpha) gene detectable by NcoI restriction of PCR product. Hum Mol Genet, 1992; 1:353.

47.

World Health Organization. Dengue Haemorrhagic Fever: Diagnosis, Treatment, Prevention and Control. Geneva: World Health Organization, 1997:12–23.

48.

Xavier-Carvalho

, Gibson

, Brasil

, et al. Single nucleotide polymorphisms in candidate genes and dengue severity in children: a case-control, functional and meta-analysis study. Infect Genet Evol, 2013; 20:197–205.