Adult Rat Odontoblasts Lack Noxious Thermal Sensitivity

Abstract

Dentin hypersensitivity is a common symptom treated in the dental clinic, yet the underlying cellular and molecular mechanisms are not clear. We hypothesized that odontoblasts detect noxious thermal stimuli by expressing temperature-sensing molecules, and investigated whether temperature-activated TRP channels (thermo-TRP channels), which are known to initiate temperature signaling, mediate temperature sensing in odontoblasts. mRNA expression of dentin sialophosphoprotein and collagenase type 1, odontoblast-specific proteins, was shown in acutely isolated adult rat odontoblasts by single-cell RT-PCR, while TRPV1, TRPV2, TRPM8, and TRPA1 were not detected. Application of noxious temperatures of 42°C and 12°C, as well as capsaicin, menthol, and icilin, agonists of thermo-TRP channels, failed to increase intracellular calcium concentration. Immunohistochemical study also revealed no expression of TRPV1. Thus, it is unlikely that odontoblasts serve as thermal sensors in teeth via thermo-TRP channels.

INTRODUCTION

Dentin hypersensitivity is a symptom in which individuals complain of sudden severe pain elicited by cold water, air blow, or even by light touch during dental treatment. It is one of the most frequent causes of persons visiting the dental clinic, yet attempts to understand its molecular causes have not been successful, and treatment is merely palliative. Elucidation of the molecular and cellular mechanisms involved in the generation of pain is key to the development of treatments specifically targeting underlying causes rather than just symptoms (Scholz and Woolf, 2002). Since Brännström proposed the so-called hydrodynamic theory, in which fluid movement in dentinal tubules induced by diverse stimuli, including temperature, elicits the firing of the tooth nerve to produce pain (Brännström et al., 1967; Brännström and Aström, 1972), many lines of evidence have been reported to support the hypothesis (Andrew and Matthews, 2000). However, it is not fully understood how such temperature changes are perceived as pain by the teeth, and it is still possible that dental primary afferents and/or odontoblasts play a more critical role than has been assumed. Thus, we previously proposed that temperature-activated transient receptor potential channels (thermo-TRP channels) expressed in dental primary afferent neurons contribute to tooth pain (Park et al., 2006).

TRP channels are a large family of non-selective cation channels which are activated by various physical and chemical stimuli. Subfamilies of TRP channels play critical roles in the transduction of temperature and pain sensation (Patapoutian et al., 2003). The thermo-TRP channels that respond to noxious temperature include TRPV1, TRPV2, TRPM8, and TRPA1; they are activated by ≥ 42°C, ≥ 52°C, ≤ 25°C, and ≤ 17°C, respectively (Patapoutian et al., 2003). They can also be activated by the exogenous ligands capsaicin (TRPV1), menthol (TRPM8), and icilin (TRPM8 and TRPA1) (Caterina et al., 1997; McKemy et al., 2002; Peier et al., 2002; Story et al., 2003). Given that thermo-TRPs are transducers of thermal information to electrical signals within the sensory nervous system, it is possible that thermo-TRPs expressed by odontoblasts participate in the transduction of tooth pain, especially that caused by noxious thermal stimulation.

Odontoblasts are cells that deposit a calcium matrix to form dentin during tooth development and throughout the lifetime for dentin repair. Odontoblasts constitute the outermost cell layer of the dental pulp, and this morphological advantage makes them the first cells to which outside temperatures might be transmitted. Considering the numerous reports on the sensory role of odontoblasts (Magloire et al., 2003; Shibukawa and Suzuki, 2003; Okumura et al., 2005; Allard et al., 2006), we hypothesized that odontoblasts express thermo-TRP channels and thereby contribute to the generation of tooth pain in response to noxious temperature stimuli, in a manner similar to that of dental primary afferent neurons.

MATERIALS & METHODS

All surgical and experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the School of Dentistry, Seoul National University.

Preparation of Odontoblasts

Extracellular saline (ECS) consisted of 140 mM NaCl, 3 mM KCl, 1 mM CaCl₂, 1 mM MgCl₂, and 10 mM HEPES, adjusted to pH 7.3–7.4 with NaOH. The standard enzyme solution consisted of collagenase IA (3 mg/mL) and protease I (0.25 mg/mL) in Ca²⁺- and Mg²⁺-free ECS. Odontoblasts were prepared from adult (200–400 g) Sprague-Dawley rats (Orient Bio Inc., Sungnam, Korea) according to modified methods described previously (Guo et al., 2000). Briefly, upper and lower incisors were extracted within 5-10 min of death and were kept in cold (3–5°C) ECS. After the surrounding soft tissues were removed, teeth were sectioned transversely with 500-μm thickness. Tooth slices were incubated in 2 mL standard enzyme solution for 30 min at 37°C, after which the suspension was triturated with a series of Pasteur pipettes. The triturated suspension was centrifuged at 200 g for 3 min, and the supernatant was replaced with fresh ECS and kept at 3–5°C until used.

Whole-Tissue and Single-Cell Reverse-Transcription Polymerase Chain-Reaction (scRT-PCR)

Trigeminal ganglion neurons were prepared as previously described (Park et al., 2006), and the pulp tissue was removed from incisal tooth slices with forceps under a microscope. mRNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and underwent RT-PCR with the inner primers from scRT-PCR. scRT-PCR was performed as previously described (Park et al., 2006). Briefly, the targeted cell was aspirated into a patch pipette with a tip diameter of about 20 μm, put into a reaction tube containing reverse-transcription reagents, and incubated for 1 hr at 37°C. Subsequently, cDNA was divided into 4 or 5 2-μL aliquots that were used in separate reactions. All PCR amplifications were performed with nested primers (Table). The first round was performed in 50 μL of PCR buffer containing 0.2 mM dNTPs, 0.2 μM “outer” primers, 4 μL RT product, and 0.2 μL platinum Taq DNA polymerase (Invitrogen). The second-round reaction buffer (20 μL) contained 0.2 mM dNTPs, 0.2 μM “inner” primers, 5 μL products from the first round, and 0.1 μL platinum Taq DNA polymerase. PCR products were visualized on ethidium-bromide-stained, 2% agarose gels.

Immunohistochemistry

Trigeminal ganglion neurons were prepared as a positive control as previously described (Kim et al., 2008). Rinses and incubations were performed in phosphate-buffered saline (PBS). Both odontoblast and trigeminal ganglion neuron samples were fixed in 4% paraformaldehyde for 10 min. After being rinsed for 15 min, cells were treated with blocking solution (2% BSA, 5% FBS, 0.1% PBST) for 1 hr at room temperature. Samples were then incubated overnight at 4°C with guinea pig anti-TRPV1 (1:500; Chemicon, Temecula, CA, USA), washed 3 times with PBS, then incubated with FITC-conjugated donkey anti-guinea pig IgG antibody (1:200; Jackson ImmunoResearch, West Grove, PA, USA) for 1 hr at room temperature. After being washed with PBS, samples were covered with Vectashield mounting media (Vector Laboratories, Inc., Burlingame, CA, USA) and visualized by confocal microscopy (LSM 5 PASCAL; Carl Zeiss, Oberkochen, Germany). Primary antibodies were omitted for negative control samples (data not shown).

Intracellular Calcium Imaging

Odontoblasts were plated on glass coverslips pre-coated with 0.01% poly-L-lysine. Cells were allowed to settle for 3 min at room temperature, then fura-2 AM (4 μM; Molecular Probes, Eugene, OR, USA) with 0.01% pluronic F-127 (Molecular Probes) in ECS was applied for 30 min at 37°C. Cells were rinsed 3 times with ECS and incubated for 30 min. Coverslips were mounted on an inverted microscope (Olympus IX70, JEOL, Tokyo, Japan) and perfused continuously at 2 mL/min in a bath solution containing 140 mM NaCl, 5 mM KCl, 2 mM CaCl₂, 1 mM MgCl₂, 10 mM HEPES, and 10 mM glucose, at 305 mOsm adjusted to pH 7.4 with NaOH. All measurements were made at 37°C (temperature controller PTC-20; ALA Scientific Instruments Inc., Westbury, NY, USA). Cells were illuminated with a 175-W xenon arc lamp, and excitation wavelengths (340/380 nm) were selected by a Lambda DG-4 monochromator wavelength changer (Sutter Instrument Co., Novato, CA, USA). The intracellular free calcium concentration ([Ca²⁺]_i) was measured by digital video microfluorometry with an intensified CCD camera (CasCade, Roper Scientific, Trenton, NJ, USA) coupled to a microscope and software (Metafluor, Universal Imaging Corp., Downingtown, PA, USA) on a Pentium 4 computer. Regions to be analyzed were selected only on the cell bodies. Intracellular calcium concentrations recorded during 1 min before the application of drugs and during the application of drugs were averaged and compared by paired Student t test for statistical significance. They were considered to be significantly changed if P was less than 0.05. All drugs were purchased from Sigma. Capsaicin and menthol were dissolved in ethanol and icilin in dimethyl sulfoxide (DMSO) to make stock solutions. Drugs were kept at −20°C until diluted to the final concentration.

RESULTS

Identification of Odontoblasts

Using enzymatic treatment followed by mechanical trituration, we obtained cuboidal cells with a long process (Fig. 1Aa). Staining with 4′,6-diamidino-2-phenylindole (DAPI) revealed a polarized nucleus (Figs. 1Ab, 1Ac ). Cells with cuboidal bodies ranging from 15 to 25 μm, a long cellular process, and a single polarized nucleus were considered to be odontoblasts. scRT-PCR analysis detected mRNA expression of dentin sialophosphoprotein (DSPP) and collagen type 1, dentin-specific proteins (Ritchie et al., 1994), in individual odontoblasts (n = 4; Fig. 1B).

Single-cell RT-PCR Analysis for Thermo-TRP Expression in Odontoblasts

Expression of 4 of the TRP channels, TRPV1, TRPV2, TRPM8, and TRPA1, which are activated by ≥ 42°C, ≥ 52°C, ≤ 25°C, and ≤ 17°C, respectively, was examined by scRT-PCR. None of the cells was found to express TRPV1 (n = 10), TRPV2 (n = 14), TRPM8 (n = 14), or TRPA1 (n = 13) mRNA, while DSPP was present in all odontoblasts analyzed (n = 51; Fig. 2A ). As expected, trigeminal ganglion neurons expressed TRPV1, TRPV2, TRPM8, and TRPA1, but not DSPP (Fig. 2A ). However, when whole pulp tissue was analyzed, TRPV1, TRPV2, TRPM8, and DSPP mRNA was detected, but not TRPA1 (Fig. 2B ).

Odontoblasts do Not Respond to Noxious Temperature and Thermo-TRP Ligands

Activation of thermo-TRP channels enhances intracellular calcium concentration ([Ca²⁺]_i) via calcium influx. Thus, using calcium imaging, we examined whether odontoblasts produced calcium responses to either thermo-TRP channel ligands, capsaicin, menthol, or icilin for TRPV1, TRPM8, and TRPA1, respectively, or noxious hot and cold temperature. Application of capsaicin (1 μM), menthol (1 mM), and icilin (10 μM) produced insignificant changes in the level of [Ca²⁺]_i, from 0.409 ± 0.009 to 0.410 ± 0.007 (n = 22, P = 0.809), from 0.506 ± 0.139 to 0.509 ± 0.136 (n = 81, P = 0.233), and from 0.450 ± 0.117 to 0.449 ± 0.119 (n = 15, P = 0.434), respectively. A small fraction (7 of 81) of odontoblasts showed minimal response to menthol (from 0.543 ± 0.093 to 0.558 ± 0.096, P = 0.007). No significant calcium responses to the application of noxious hot (42°C, from 0.450 ± 0.117 to 0.449 ± 0.119, P = 0.434) or cold temperature (12°C, from 0.567 ± 0.113 to 0.548 ± 0.136, P = 0.196) were observed (Figs. 3A, 3B, 3C ). The baseline level of [Ca²⁺]_i was slightly changed during temperature stimulation (Fig. 3C ). This may be due to technical artifacts following temperature change; however, such a change was still within a statistically insignificant range.

Immunohistochemical Analysis of TRPV1 Expression in Odontoblasts

scRT-PCR and calcium imaging analysis strongly suggested that thermo-TRP channels are not expressed in odontoblasts. However, because there has been a report of functional expression of TRPV1 in odontoblasts (Okumura et al., 2005), expression of TRPV1 at the protein level was examined. Immunohistochemical analysis revealed that immunoreactivity to TRPV1 was barely detected in odontoblasts (Figs. 3Da, 3Db). In contrast, TRPV1 was preferentially stained in small-to-medium trigeminal ganglion neurons (Figs. 3Dc, 3Dd ).

DISCUSSION

In an effort to elucidate the molecular origin of dentin hypersensitivity, in the present study we examined whether odontoblasts express thermo-TRP channels. Our results indicate that odontoblasts do not express noxious-temperature-sensitive TRP channels such as TRPV1, TRPV2, TRPM8, and TRPA1. In addition, actual temperature stimuli and chemical agonists of thermo-TRPs failed to elevate [Ca²⁺]_i in odontoblasts. Thus, we propose that odontoblasts are not likely to serve as temperature sensors in teeth via thermo-TRP channels.

The acutely isolated cells exhibited morphological characteristics of odontoblasts, such as a long cellular process and polarized nucleus (Guo et al., 2000), and they were further confirmed to be odontoblasts by mRNA expression of the odontoblast-specific proteins DSPP and collagenase type 1 (Ritchie et al., 1994). As previously described (Guo et al., 2000), the cells could not be maintained under conventional culture conditions. However, when they were kept at 3–5°C, cellular viability could be maintained, as verified by the robust calcium response to ionomycin, a representative calcium ionophore (Millard et al., 1988). Thus, we considered these cells to be appropriate for further experiments.

Thermo-TRP channels have been found to initiate thermal transduction in sensory neurons (Patapoutian et al., 2003). We previoulsy demonstrated that dental primary afferent neurons express thermo-TRP channels (Park et al., 2006). However, our results argue against a role for thermo-TRP channels as the temperature sensor in odontoblasts, at least over the noxious temperature range tested in acutely isolated adult rat odontoblasts. First, mRNA expression of 4 noxious thermo-TRP channels, TRPV1, TRPV2, TRPM8, and TRPA1, could not be detected by scRT-PCR. We ruled out the possibility of ‘mal-fabricated’ primers by using trigeminal ganglion neurons as positive controls, and these expressed all 4 kinds of thermo-TRP channels, but not DSPP. Second, functional data from calcium imaging were consistent with the scRT-PCR data. The intracellular calcium concentration in odontoblasts was not elevated by capsaicin, menthol, icilin, noxious heat, or cold temperature. Only a small proportion showed a minimal response to menthol. However, because no evidence of TRPM8 mRNA expression was detected, this response might be mediated by other mechanisms such as TRPV3, as has been suggested (Macpherson et al., 2006). Because odontoblasts were kept at 3–5°C before experimentation, it is possible that the cold-sensitive TRP channels might have become desensitized. However, lack of response to menthol and icilin suggests that this is not the case. Moreover, the robust ionomycin response during calcium imaging showed full recovery of the odontoblasts. Third, immunohistochemical analysis also failed to detect TRPV1, further corroborating the scRT-PCR and calcium imaging data.

In contrast to our results, another group has reported TRPV1 expression in odontoblasts (Okumura et al., 2005). This discrepancy might be due to the developmental stage, because they used tooth slices from neonatal rats, not adult rats. Notably, we also found that all thermo-TRP channels, except for TRPA1, were expressed in whole pulpal tissue. Therefore, the possibility of contamination by cells other than odontoblasts in their studies cannot be excluded. Moreover, the different capsaicin concentrations used might contribute to these inconsistent results.

There have been many reports suggesting the excitability of odontoblasts, such as the expression of voltage-gated sodium channels (Allard et al., 2006) and TREK-1 channels (Magloire et al., 2003). However, our results suggest that odontoblasts are not excitable by noxious thermal stimuli. One possible explanation is that odontoblasts are excitable by other types of stimuli, such as mechanical stretch, as in the hydrodynamic theory. In fact, odontoblasts were recently reported to express primary cilia (Magloire et al., 2004), which were proposed to play an important role in the sensation of fluid flow in bone cells (Malone et al., 2007). TREK-1 channels expressed in odontoblasts are also a candidate molecule for mechanosensitive channels (Maingret et al., 1999). Moreover, odontoblasts express store-operated calcium channels (Shibukawa and Suzuki, 2003). Considering that TRPC1 is a key component of both store-operated calcium channels (Ambudkar, 2007) and stretch-activated cation channels (Maroto et al., 2005), it is possible that odontoblasts respond to stretch caused by fluid movement through dentinal tubules via TRPC1. Indeed, we have observed TRPC1 expression in a subset of odontoblasts (unpublished observations). Our ongoing work will help improve understanding of the molecular mechanisms underlying odontoblast mechanosensitivity.

In summary, it is unlikely that odontoblasts serve as temperature sensors in teeth. However, although in the present work odontoblasts were shown not to express temperature-sensitive TRP channels, excitability of odontoblasts should not be ruled out, because of their mechanosensitivity, which might be more critical than thermosensitiviy for their sensory function. The movement of fluid within dentinal tubules following external thermal stimuli may result in excitability via the activation of mechanosensitive channels (Magloire et al., 2008).

Table.

List of Primers Used

Target Gene (Product Length)	Outer Primers	Inner Primers	GenBank No.
GAPDH (316 bp)	AGGTCATCCCAGAGCTGAACG  CACCCTGTTGCTGTAGCCATAT	N/A	NM_017008 (1307 bp)
β-actin (456 bp, 316 bp)	CCCAGATCATGTTTGAGACC  AGGATTCCATACCCAGGAAG	AGGCTGTGTTGTCCCTGTAT  CAGCTCATAGCTCTTCTCCA	NM_031144 (1296 bp)
DSPP (452 bp, 408 bp)	GCTGAGGTGACACCAAGCATT  ACTTTTGTTGCCCGTGCTG	GGAAGGTGCTGGTTTGGATAAT  ACCTTCGGTTTCTAATCCCTGA	NM_012790 (4457 bp)
Col1 (394 bp, 301 bp)	TTTGGAGAGAGCATGACCGAT  TCCATTCCGAATTCCTGGTCT	TCCAGTTCGAGTATGGAAGCG  GGTCTTGGTGGTTTTGTATTCG	NM_053304 (5843 bp)
TRPV1 (519 bp, 329 bp)	ACCGTCAACAAGATTGCACA  TGGTTCCCTAAGCAGACCAC	TGACTACCGGTGGTGTTTCA  TGATCCCTGCATAGTGTCCA	NM_031982 (2847 bp)
TRPV2 (280 bp, 231 bp)	GAATTCTCAGGACCGTACCAGC  GCAACGACGGTGAAGATGAAC	CCCGAAAGTTTACTGAGTGGTG  ATGTAGACCAAGTAGCAGGCGA	NM_017207 (2768 bp)
TRPM8 (331 bp, 266 bp)	CTGTGGCCTCGTATCGTTTAGG  GCCGGAATACAATACCCGCTAT	AAGAAGCCCATTGACAAGCAC  GTCCATAACGTTCCATAGGTCG	NM_134371 (4184 bp)
TRPA1 (364 bp, 289 bp)	AATGCAGTCGATGGCAATCAG  CCCTGCCTACAAGCATAATGGA	CCTGCTTCACAGAGCCTCATT  CCATCACCAGCTCCTTGATGT	NM_207608 (3378 bp)

Figure 1.

Isolation and identification of odontoblasts. (Aa) A representative odontoblast obtained by acute isolation from adult rats (arrow). Scale bar indicates 20 μm. (Ab) Nucleus stained with 4′,6-diamidino-2-phenylindole (DAPI). (Ac) Merged image reveals a polarized nucleus (triangle). (B) Typical single-cell RT-PCR gels from 4 individual odontoblasts (Od) showing expression of odontoblast-specific proteins, dentin sialophosphoprotein (DSPP), and collagen type 1 (Col1). Lane 5 is a negative control (NC) obtained from control pipettes that did not harvest cell contents, but were submerged in bath solution. Predicted product sizes: 408 bp (DSPP), 301 bp (Col1), 316 bp (β-actin). M: 100-bp marker.

Figure 2.

Single-cell RT-PCR and whole-tissue analysis of thermo-TRP expression. (A) Typical single-cell RT-PCR gels from 3 individual odontoblasts showing expression of DSPP, but no thermo-TRP channels. Lane 1 is a negative control (NC), and lane 5 is with trigeminal ganglion neurons used as a positive control. Predicted product sizes: 329 bp (TRPV1), 231 bp (TRPV2), 266 bp (TRPM8), 289 bp (TRPA1). (B) RT-PCR result of whole pulpal tissue obtained with the same primers as single-cell RT-PCR. GAPDH was used as the positive control, and -RT indicates negative control. M = 100-bp marker; Col1 = collagen type 1; DSPP = dentin sialophosphoprotein.

Figure 3.

Calcium imaging analysis of odontoblast response to thermo-TRP ligands and thermal stimuli. (A) Capsaicin (Cap) 1 μM (n = 22), (B) menthol 1 mM (n = 81), and (C) icilin 10 μM (n = 15), as well as noxious hot temperature (A) of 42°C (n = 22) and cold temperature (B) of 12°C (n = 31), failed to increase intracellular calcium concentration. Ionomycin, a calcium ionophore, was used to confirm cellular viability at the end of each experiment. (D) Immunohistochemical study showed no expression of TRPV1 in odontoblasts (Da, Db), while subsets of trigeminal ganglion neurons were prominently stained (Dc, Dd). Scale bar indicates 20 μm.

Footnotes

Notes

+

authors contributing equally to this work;

Acknowledgements

This research was supported by a Korea Research Foundation Grant funded by the Korean Government (MOEHRD) (KRF-2007-313-E00465), a grant (R0A-2008-000-20101-0) from the National Research Laboratory Program, and a grant (M103KV 10015-08K2201-01510) from the Brain Research Center of the 21st Century Frontier Research Program funded by the Ministry of Science and Technology, Republic of Korea.

References

Allard B, Magloire H, Couble ML, Maurin JC, Bleicher F -2006-. Voltage-gated sodium channels confer excitability to human odontoblasts: possible role in tooth pain transmission. J Biol Chem 281:29002–29010.

Ambudkar IS -2007-. TRPC1: a core component of store-operated calcium channels. Biochem Soc Trans 35-Pt 1-:96–100.

Andrew D, Matthews B -2000-. Displacement of the contents of dentinal tubules and sensory transduction in intradental nerves of the cat. J Physiol 529-Pt 3-:791–802.

Brännström M, Aström A -1972-. The hydrodynamics of the dentine; its possible relationship to dentinal pain. Int Dent J 22:219–227.

Brännström M, Lindén LA, Aström A -1967-. The hydrodynamics of the dental tubule and of pulp fluid. A discussion of its significance in relation to dentinal sensitivity. Caries Res 1:310–317.

Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D -1997-. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389:816–824.

Guo L, Berry JE, Somerman MJ, Davidson RM -2000-. A novel method to isolate odontoblasts from rat incisor. Calcif Tissue Int 66: 212–216.

Kim HY, Park CK, Cho IH, Jung SJ, Kim JS, Oh SB -2008-. Differential changes in TRPV1 expression after trigeminal sensory nerve injury. J Pain 9:280–288.

Macpherson LJ, Hwang SW, Miyamoto T, Dubin AE, Patapoutian A, Story GM -2006-. More than cool: promiscuous relationships of menthol and other sensory compounds. Mol Cell Neurosci 32:335–343.

10.

Magloire H, Lesage F, Couble ML, Lazdunski M, Bleicher F -2003-. Expression and localization of TREK-1 K+ channels in human odontoblasts. J Dent Res 82:542–545.

11.

Magloire H, Couble ML, Romeas A, Bleicher F -2004-. Odontoblast primary cilia: facts and hypotheses. Cell Biol Int 28:93–99.

12.

Magloire H, Allard B, Couble ML, Maurin JC, Bleicher F -2008-. Mechanosensitive ion channels in odontoblasts. In: Mechanosensitive ion channels. Kamkin A, Kiseleva I, editors. The Netherlands: Springer, pp. 147–156.

13.

Maingret F, Patel AJ, Lesage F, Lazdunski M, Honore E -1999-. Mechano-or acid stimulation, two interactive modes of activation of the TREK-1 potassium channel. J Biol Chem 274:26691–26696.

14.

Malone AM, Anderson CT, Tummala P, Kwon RY, Johnston TR, Stearns T, et al. -2007-. Primary cilia mediate mechanosensing in bone cells by a calcium-independent mechanism. Proc Natl Acad Sci USA 104:13325–13330.

15.

Maroto R, Raso A, Wood TG, Kurosky A, Martinac B, Hamill OP -2005-. TRPC1 forms the stretch-activated cation channel in vertebrate cells. Nat Cell Biol 7:179–185.

16.

McKemy DD, Neuhausser WM, Julius D -2002-. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416:52–58.

17.

Millard PJ, Gross D, Webb WW, Fewtrell C -1988-. Imaging asynchronous changes in intracellular Ca2+ in individual stimulated tumor mast cells. Proc Natl Acad Sci USA 85:1854–1858.

18.

Okumura R, Shima K, Muramatsu T, Nakagawa K, Shimono M, Suzuki T, et al. -2005-. The odontoblast as a sensory receptor cell? The expression of TRPV1 -VR-1- channels. Arch Histol Cytol 68:251–257.

19.

Park CK, Kim MS, Fang Z, Li HY, Jung SJ, Choi SY, et al. -2006-. Functional expression of thermo-transient receptor potential channels in dental primary afferent neurons: implication for tooth pain. J Biol Chem 281:17304–17311.

20.

Patapoutian A, Peier AM, Story GM, Viswanath V -2003-. ThermoTRP channels and beyond: mechanisms of temperature sensation. Nat Rev Neurosci 4:529–539; erratum in Nat Rev Neurosci 4:691, 2003.

21.

Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA, Story GM, et al. -2002-. A TRP channel that senses cold stimuli and menthol. Cell 108:705–715.

22.

Ritchie HH, Hou H, Veis A, Butler WT -1994-. Cloning and sequence determination of rat dentin sialoprotein, a novel dentin protein. J Biol Chem 269:3698–3702.

23.

Scholz J, Woolf CJ -2002-. Can we conquer pain? Nat Neurosci 5-Suppl-:1062–1067.

24.

Shibukawa Y, Suzuki T -2003-. Ca2+ signaling mediated by IP3-dependent Ca2+ releasing and store-operated Ca2+ channels in rat odontoblasts. J Bone Miner Res 18:30–38.

25.

Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, Hricik TR, et al. -2003-. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell 112:819–829.