Abstract
Calcitonin gene-related peptide (CGRP) plays a crucial role in the modulation of orofacial pain, and we hypothesized that CGRP mediated a neuron-glia crosstalk in orofacial pain. The objective of this study was to elucidate the mechanisms whereby CGRP mediated trigeminal neuron-glia crosstalk in modulating orofacial pain. Orofacial pain was elicited by ligating closed-coil springs between incisors and molars. Trigeminal neurons and satellite glial cells (SGCs) were cultured for mechanistic exploration. Gene and protein expression were determined through immunostaining, polymerase chain reaction, and Western blot. Orofacial pain was evaluated through the rat grimace scale. Our results revealed that the expressions of CGRP were elevated in both trigeminal neurons and SGCs following the induction of orofacial pain. Intraganglionic administration of CGRP and olcegepant exacerbated and alleviated orofacial pain, respectively. The knockdown of CGRP through viral vector-mediated RNA interference was able to downregulate CGRP expressions in both neurons and SGCs and to alleviate orofacial pain. CGRP upregulated the expression of inducible nitric oxide synthase through the p38 signaling pathway in cultured SGCs. In turn, L-arginine (nitric oxide donor) was able to enhance orofacial pain by upregulating CGRP expressions in vivo. In cultured trigeminal neurons, L-arginine upregulated the expression of CGRP, and this effect was diminished by cilnidipine (N-type calcium channel blocker) while not by mibefradil (L-type calcium channel blocker). In conclusion, CGRP modulated orofacial pain through upregulating the expression of nitric oxide through the p38 signaling pathway in SGCs, and the resulting nitric oxide in turn stimulated CGRP expression through N-type calcium channel in neurons, building a CGRP-mediated positive-feedback neuron-glia crosstalk.
Keywords
Introduction
Orofacial pain, with a prevalence of 16% in the general population (Horst et al. 2015), is a constellation of painful conditions in the orofacial regions, including trigeminal neuralgia, dental pulp pain, migraine, headaches, temporomandibular joint disorders, and orthodontic pain (Long et al. 2013; Shinal and Fillingim 2007; Long et al. 2016; Long, Gao, et al. 2017). These debilitating and highly prevalent painful conditions pose significant burdens to those who suffer (de Siqueira et al. 2015). Although various pain-relieving modalities have been developed for orofacial pain (de Pedro et al. 2020) (i.e., physical, pharmacological, and surgical approaches), none of them has been reported to be fully effective. This justifies in-depth mechanistic studies that unravel the mechanisms underlying orofacial pain and offer new insights for pain-relieving targets.
It has been well documented that orofacial pain signals are first received by peripheral sensory endings, transmitted to trigeminal ganglia, relayed at the trigeminal nucleus caudalis, and finally projected to sensory cortex via thalamus (Long et al. 2016). In particular, trigeminal ganglia, possessing both peripheral processes (to the periphery) and central processes (to the trigeminal nucleus caudalis in medulla oblongata), play a cardinal role in the modulation of orofacial pain (Zhou et al. 2016; Guo et al. 2019). Upon activation by orofacial pain stimuli, neurons in the trigeminal ganglia release abundant neuropeptides to the periphery and change neuronal excitability, thereby promoting inflammatory response and facilitating pain transmission (Long et al. 2016). From a histological perspective, trigeminal ganglia are composed of both neurons and satellite glial cells (SGCs), with the latter being the majority (Costa and Neto 2015). It was previously believed that SGCs, surrounding neurons, mainly support neurons with nutrients and oxygen. However, recent insights shed light on the essential role of SGCs in the modulation of orofacial pain (Komiya et al. 2018; Zhang et al. 2018). The mechanisms whereby SGCs modulate pain involve glia-originated proinflammatory mediators that stimulate neurons (Afroz et al. 2019).
Calcitonin gene-related peptide (CGRP), a neuropeptide consisting of 37 amino acids, plays a key role in the regulation of orofacial pain. It has been revealed that neurons in trigeminal ganglia released CGRP in the context of orofacial pain and that CGRP induced satellite glia to release signaling molecules that may in turn stimulate neurons (Mikuzuki et al. 2017; Afroz et al. 2019). This suggests that CGRP is a cardinal molecule that integrates neurons with SGCs in the modulation of orofacial pain. However, the exact mechanisms whereby CGRP induces neuron-glia crosstalk are still largely unknown, with the nitric oxide (NO) signaling pathway being a good candidate (Vause and Durham 2009). Therefore, in this study, we aimed to explore the exact mechanisms of CGRP-NO-mediated neuron-glia crosstalk underlying orofacial pain.
Materials and Methods
Animals and Orofacial Pain Induction
Male Sprague-Dawley rats (weighing 200 to 300 g) were purchased from the Animal Experimental Center of Sichuan University. They were provided with standard rat chow and water ad libitum and housed in an air-conditioned room at 21°C with a 12-h day-night cycle. This study was approved by the ethical committee of State Key Laboratory of Oral Diseases, Sichuan University (SKLODLL2013A020). This study adhered to the ARRIVE (Animal Research: Reporting In Vivo Experiments) guidelines for conducting animal research.
Orofacial pain was induced by ligating closed coil springs between incisors and molars in rats, to mimic orofacial pain induced by orthodontic tooth movement. The experimental group received a 40-g force while the sham group received a 0-g force. After rats were generally anesthetized with pentobarbital sodium (50 mg/kg), closed-coil springs were activated to deliver force (40 g). This orofacial pain rat model has been well documented by previous studies (Long et al. 2015; Horinuki et al. 2016; Guo et al. 2019).
Administration of Drugs into the Trigeminal Ganglia
The administration of drugs into the trigeminal ganglia (TG) of rats was performed according to our previous study (Long, Liao, et al. 2017). Briefly, after general anesthesia, rats were placed in lateral recumbency, and microinjection needles were injected mediocaudally between tympanic bulla and the posterior borders of the mandibular ramus.
Construction of Lentivirus Vector
The construction of lentivirus vector was performed according to our previous study (Long, Liao, et al. 2017). Briefly, a lentivirus vector encoding enhanced green fluorescence protein (EGFP) with ubiquitin promoter was recombined with a CGRP RNA interference (RNAi) sequence (TGGAGCAGGAGGAG GAACA). Then, the recombinant was amplified and its sequence confirmed through DNA sequencing. Viral vectors were packaged and harvested via transfecting 293T cells. Orofacial pain was elicited 1 wk following virus transduction.
Evaluation of Pain through the Rat Grimace Scale
Orofacial pain was evaluated through the rat grimace scale (RGS) according to our previous study (Liao et al. 2014). In brief, RGS scoring was conducted by examining the facial expression changes in the eyes, nose, ears, and whiskers of rats.
Cell Culture of Neurons and Satellite Glia of TG
Following the sacrifice of rats, TGs were dissected and obtained under microscope. After washing in cold phosphate-buffered saline (PBS) solution for 3 times, TGs were cut into small pieces and incubated in PBS solution containing 1% collagenase II at 37°C for 30 min. For neuron cultures, cells were rinsed with neurobasal medium (Invitrogen), centrifuged at 250 g for 4 min, and cultured in neurobasal medium containing 2% B27 at 37°C with 5% CO2. For glia cultures, cells were washed with L15 medium and centrifuged at 250 g for 4 min. Then, the supernatants were obtained, resuspended into L15 medium, and centrifuged at 500 g for 5 min. The pellets containing glial cells were resuspended and cultured in L15 medium at 37°C with 5% CO2.
Immunostaining
For immunocytochemistry, cells on coverslips were fixed in 4% paraformaldehyde for 15 min at room temperature and then incubated with primary antibodies overnight at 4°C. Then, after washing with PBS solution, cells were incubated with secondary antibodies at 37°C for 1 h and immunofluorescence was visualized by using a confocal microscope (FV1000; Olympus).
For immunohistochemistry, tissue samples were placed into liquid nitrogen and then cryosectioned with a crystat at a thickness of 10 µm and thaw-mounted on slides coated with poly-L-lysine. Following fixation in cold propanol for 15 min, tissue samples were rinsed in PBS 3 times and then incubated overnight at 4°C with primary antibodies. Afterward, tissue samples were incubated with secondary antibodies at 37°C for 1 h. All sections were observed through a fluorescence microscope (AX10 imager A2/AX10 cam HRC; Zesis) and photographed using ZEN Widefield software (Version 2012; Zesis).
Real-Time Polymerase Chain Reaction and Western Blotting
For real-time polymerase chain reaction (PCR), total RNA was extracted from TGs by using the Takara MiniBEST Universal RNA Extraction Kit (Takara) according to the manufacturer’s protocols. Then, complementary DNA (cDNA) was reverse transcribed by using the PrimeScript RT reagent kit with gDNA Erase (Takara), with the heating protocol being 37°C for 15 min and 85°C for 5 s. Real-time PCR (20 µL) was performed with the aforementioned cDNA (1 µL). The reference genes were β-actin (forward: GCTATGTTGCC CTAGACTTCGA; reverse: GATGCCACAGGATTCCATACC) or GAPDH (forward: ACTCCCATTCTTCCACCTTTG; reverse: CCCTGTTGCTGTAGCCATATT). Testing genes were CGRP (forward: CTGAGGGCTCTA GCTTGGACA; reverse: TTGGGGGAAGGTG TGAAACT) and inducible nitric oxide synthase (iNOS) (forward: GAGCTTCTACCTCAAGCT ATC; reverse: CCTGATGTTGCCATTGTTGGT). The heating protocol included initial denaturation at 95°C for 30 s and amplification for 40 cycles (95°C for 5 s and 60°C for 30 s).
For Western blotting, cells or tissue samples were homogenized with RIPA lysis buffer containing phenylmethanesulfonyl fluoride (PMSF; Sigma). Then, samples were separated by electrophoresis and proteins were transferred onto polyvinylidene fluoride (PVDF) membranes and incubated with primary antibodies against CGRP (Abcam), p-p38 (Abcam), β-actin (Abcam), or GAPDH (Pujian). Horseradish peroxidase–conjugated secondary antibodies were used for visualization of the proteins. The protein blot densities were analyzed through Image Pro Plus 6.0 (Media Cybernetics) with β-actin or GAPDH being the internal reference.
Statistical Analysis
One-way analysis of variance (Tukey post hoc test) was used to analyze the differences among different groups. Comparisons between 2 groups were analyzed through Student’s t test. All the statistical analyses were performed in SPSS 16.0 (SPSS, Inc.) and GraphPad Prism 8.0 (GraphPad Software). A P value less than 0.05 was considered statistically significant.
Results
Expression Patterns of CGRP in Trigeminal Ganglia following Orofacial Pain
As displayed in Appendix Figure 1, the expression levels of CGRP in trigeminal neurons were significantly higher in the force group (force magnitude: 40 g) than in the sham group (force magnitude: 0 g) (P < 0.001). Moreover, as shown in Appendix Figure 2, CGRP was barely expressed in SGCs of the sham group (10.7% ± 4.3%) while expressed in most of the SGCs in the force group (89.3% ± 4.4%) (P < 0.001).
CGRP Participated in the Modulation of Orofacial Pain
As depicted in Appendix Figure 3, orofacial pain level was elevated in the force group in response to tooth movement (P < 0.001), while it was significantly higher in the CGRP + force group than in the force group and significantly lower in the olcegepant + force group than in the force group (P < 0.001). Then, we constructed lentivirus carrying CGRP short hairpin RNA (shRNA) sequences to silence the expressions of CGRP in trigeminal ganglia. The capacity of viral transduction was verified in 293T cells, and the results showed that almost all the 293T cells were transduced by lentivirus vectors (Fig. 1A, B). Moreover, the sequences of the viral vectors carrying CGRP shRNA were confirmed through DNA sequencing (Fig. 1C). The results showed that lentivirus vectors were detected in trigeminal ganglia 1 wk after virus transduction. Specifically, both neurons and SGCs were transduced (Fig. 1D–I). The results revealed that the transduction of lentivirus vectors containing CGRP shRNA sequences was able to downregulate the expression levels of CGRP in trigeminal ganglia (Fig. 1J–L). We found that the percentage of CGRP-positive SGCs was significantly lower in the lentivirus + force group (23.9% ± 3.5%) than in the force group (89.8% ± 3.1%) (P < 0.001) (Fig. 2). Moreover, we found that orofacial pain levels were significantly lower in the lentivirus + force group than in the force group (Fig. 1M).

Lentivirus transduction into trigeminal ganglia in rats. (

The comparison of calcitonin gene-related peptide (CGRP)–positive satellite glial cells (SGCs) between the lenti + force group (
CGRP Upregulated NO through p38 Pathway in SGCs
Our results revealed that the expression levels of iNOS in cultured trigeminal SGCs were elevated following the administration of CGRP in a dose-response pattern (Fig. 3A–C). Moreover, we found that CGRP was able to activate p38 signal pathway in trigeminal SGCs (P < 0.01) (Fig. 3D, E). The administration of p38 pathway inhibitor (SB203580) could inhibit CGRP-induced iNOS expressions in trigeminal SGCs (P < 0.01) (Fig. 3F, G).

The effects of calcitonin gene-related peptide (CGRP) on inducible nitric oxide synthase (iNOS) expression and p38 signaling pathway in satellite glial cells (SGCs). (
NO Participated in the Regulation of Orofacial Pain through Upregulating CGRP
As displayed in Figure 4A, B, our results revealed that orofacial pain level was significantly higher in the L-arginine group than in the saline group (P < 0.01) but was similar between the L-NAME (L-NG-Nitro arginine methyl ester) group and the saline group (P > 0.05). Moreover, pain level was significantly lower in the L-arginine + olcegepant group than in the L-arginine group (P < 0.01). As shown in Figure 4C–E, we found that intraganglionic administration of L-arginine could upregulate CGRP expression in trigeminal ganglia (P < 0.001) while the administration of L-NAME had no effect on CGRP expression (P > 0.05).

Nitric oxide exacerbates orofacial pain through upregulating the expression of CGRP in trigeminal neurons via N-type calcium channels. (
NO Upregulated CGRP through Calcium Channels in Neurons
In cultured trigeminal neurons, as presented in Figure 4F–H, L-arginine was able to upregulate the expression of CGRP, which could be attenuated by the Cacna 1b antagonist (cilnidipine) while not by the Cacna 1i antagonist (mibefradil).
Discussion
In this study, we found that CGRP was upregulated in trigeminal neurons and SGCs in rats following orofacial pain induced by orthodontic tooth movement. Both CGRP receptor antagonist and lentivirus vector carrying CGRP shRNA were able to mitigate orofacial pain. We found that CGRP was able to upregulate NO through the p38 pathway in SGCs and that NO could in turn upregulate CGRP through calcium channels in neurons.
The signals of orofacial pain induced by tooth movement are received by periodontal sensory terminals, transmitted through trigeminal sensory systems, and perceived by the sensory cortex (Gao et al. 2016; Long et al. 2016). Among these sensory stations, trigeminal ganglia are of great importance to the modulation of orofacial pain. Trigeminal ganglia are composed of neurons (10%) and SGCs (90%). Numerous SGCs surround a neuron to form a functional unit through gap junctions and paracrine methods (Costa and Neto 2015). It has been revealed that the inhibition of the crosstalk between trigeminal neurons and SGCs was able to modulate pain (Wang et al. 2014). In our present study, we found that CGRP was upregulated in trigeminal neurons following orofacial pain. Interestingly, we found that CGRP was barely expressed in SGCs at baseline but was upregulated in SGCs following orofacial pain. This was consistent with that published previously, where the CGRP receptor was detected while CGRP was not expressed in SGCs at baseline (Eftekhari et al. 2010). The nonexpression of CGRP in SGCs at baseline was attributed to hypermethylation of the CGRP gene (Park et al. 2011). Moreover, it has been documented that gap junctions between neurons and SGCs permit molecules to pass through in response to sensory activations (Belzer and Hanani 2019). Thus, we suggest that CGRP expressed in SGCs following orofacial pain may originate from neurons, but the autocrine secretion of CGRP from glial cells cannot be neglected. Their (neuron and glia) differential contributions to CGRP expressions in glial cells in the context of orofacial pain are largely unknown.
Then, we revealed that the blockade of CGRP via antagonist in trigeminal ganglia was able to attenuate orofacial pain following tooth movement. Moreover, we found that in vivo knockdown of CGRP through lentivirus vectors in trigeminal ganglia was able to alleviate orofacial pain. These findings suggest that CGRP in trigeminal ganglia participates in the modulation of orofacial pain. The exact mechanisms whereby CGRP modulates orofacial pain in trigeminal ganglia remain elusive. Anterograde release of CGRP to target inflammation or injury sites may be one mechanism. As shown in our previous studies, in response to orofacial pain, CGRP was released to the periodontium to participate in pain modulation (Long et al. 2015; Long et al. 2019). Specifically, on one hand, CGRP released from trigeminal terminals could elicit vascular dilation that augments local inflammation by permitting more immune cells to be recruited to local inflammatory sites, so as to exacerbate local inflammation and pain (Long et al. 2016). On the other hand, the released CGRP was able to enhance local alveolar bone remodeling that could in turn release more inflammatory mediators exacerbating orofacial pain (He et al. 2016). Moreover, recent evidence shows that CGRP in trigeminal ganglia upregulates a variety of cytokines, and these cytokines could in turn upregulate and activate ion channels that directly participate in pain sensation and transmission (Afroz et al. 2019; Ding et al. 2019). Therefore, we suggest that CGRP in trigeminal ganglia plays an important role in the modulation of orofacial pain following orthodontic tooth movement.
As mentioned above, in trigeminal ganglia, CGRP modulates orofacial pain through upregulating a variety of cytokines. In particular, nitric oxide is one of the most prominent molecules that are crucial for the modulation of orofacial pain (Fan et al. 2012). Being a gaseous messenger, nitric oxide is produced by iNOS and acts as a neurotransmitter and second messenger that plays an important role in the nervous system (Cinelli et al. 2020). It was revealed that intraganglionic administration of CGRP was able to induce orofacial pain and that orofacial pain could be diminished by intraganglionic administration of olcegepant (CGRP receptor inhibitor) (Sugiyama et al. 2013). Consistently, we first confirmed the finding that CGRP was able to upregulate the expression of nitric oxide in SGCs. Then, we were curious about the underlying mechanisms whereby CGRP upregulated nitric oxide. It was reported previously that the expression of nitric oxide was dependent on the p38 pathway (Akaishi and Abe 2018; Koo et al. 2020). The p38 pathway is a classical signaling pathway that allows cells to respond to various extracellular signals by converting them into intracellular messages (Cuadrado and Nebreda 2010). Our results revealed that CGRP could activate the p38 signaling pathway and that CGRP-induced nitric oxide expression was mitigated by the p38 pathway inhibitor in SGCs. Thus, our findings suggest that CGRP was able to upregulate the expression of nitric oxide through activating the p38 signaling pathway in SGCs.
Our results revealed that orofacial pain was exacerbated by intraganglionic administration of L-arginine (NO donor), suggesting that nitric oxide in trigeminal ganglia contributes to orofacial pain, which is in accordance with results published previously (Schmidtko 2015; Jia et al. 2019). Moreover, we found that pain exacerbation caused by L-arginine could be diminished by olcegepant and that L-arginine was able to upregulate the expression of CGRP in trigeminal ganglia. These findings suggest NO modulated orofacial pain through upregulating the expression of CGRP. Then, we were curious about the mechanisms whereby nitric oxide induces the upregulation and release of CGRP in trigeminal neurons. It has been well documented that the expression of CGRP in neurons is controlled by calcium channels (Baillie et al. 2012). Calcium channels, once activated, permit calcium ions to pass through and elicit changes in nerve membrane potentials and a variety of intracellular responses (Catterall 2011). A large body of evidence shows that calcium channels play important roles in orofacial pain (Li et al. 2014; Cui et al. 2020). Both N-type calcium channels (encoded by Cacna 1b) and T-type calcium channels (encoded by Cacna 1i) are involved in the regulation of CGRP expression and release (Amrutkar et al. 2011). However, our results showed that the N-type channel inhibitor (cilnidipine) but not the T-type channel inhibitor (mibefradil) could reverse NO-induced CGRP upregulation. This inconsistency could be attributed to different stimuli that induce the upregulation and release of CGRP: CGRP release was induced by potassium in the study reported earlier (Amrutkar et al. 2011) but by nitric oxide in our present study. Thus, we suggest that NO was able to modulate orofacial pain and upregulate the expression of CGRP through the N-calcium channel in neurons.
Considering the complex regulatory mechanisms of orofacial pain, other neuropeptides, receptors, and inflammatory mediators may participate in the regulatory pathway of CGRP, and future in-depth mechanistic studies are warranted to unravel the underlying mechanisms. The crosstalk between neurons and glial cells was tested indirectly in our present study, and future studies aiming at demonstrating their direct crosstalk are called for. Moreover, other regulatory pathways than the autocrine secretions of NO (neurons to neurons) and CGRP (glia to glia) may exist.
Conclusion
Taken together, as depicted in Figure 5, we suggest that CGRP modulates orofacial pain through upregulating the expression of nitric oxide through the p38 signaling pathway in SGCs, and the resulting nitric oxide in turn stimulates CGRP expression through the N-type calcium channel in neurons, building a CGRP-mediated positive-feedback neuron-glia crosstalk.

A schematic illustration of calcitonin gene-related peptide (CGRP)–mediated neuron-glia crosstalk in a positive feedback mode. In response to orofacial pain, CGRP is upregulated in trigeminal neurons and upregulates the expression of nitric oxide in satellite glial cells (SGCs) through the p38 signaling pathway. The resulting nitric oxide in turn upregulates CGRP through the N-type calcium channel in neurons. In this way, CGRP mediates a positive feedback between neurons and SGCs.
Supplemental Material
DS_10.1177_0022034520950296 – Supplemental material for CGRP Modulates Orofacial Pain through Mediating Neuron-Glia Crosstalk
Supplemental material, DS_10.1177_0022034520950296 for CGRP Modulates Orofacial Pain through Mediating Neuron-Glia Crosstalk by H. Liang, H. Hu, D. Shan, J. Lyu, X. Yan, Y. Wang, F. Jian, X. Li, W. Lai and H. Long in Journal of Dental Research
Footnotes
A supplemental appendix to this article is available online.
This work was supported and funded by the National Natural Science Foundation of China (contracts 81571004, 81500884, and 81400549), Applied and Fundamental Research Program funded by Department of Science and Technology of Sichuan Province (contract 2018JY0558), the Fundamental Research Fund for the Central Universities from Northwest Minzu University, China (contract 31920160052), and Research Grant of Health Commission of Sichuan Province (contracts 19PJ233 and 20PJ090).
The authors declare no potential conflicts of interest with respect to the authorship and/or publication of this article.
References
Supplementary Material
Please find the following supplemental material available below.
For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.
For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.
