Characterization of a Polyclonal Antibody to Human Thymidylate Synthase Suitable for the Study of Colorectal Cancer Specimens

Construction of pQE-hTS and pcDNA3/HA-hTS29

A human TS cDNA (pUC19.TS4) was obtained from D. Santi (University of California, San Francisco). This plasmid appeared to be derived from pDHTS-S1 (Davisson et al. 1989). The first 90 nucleotides of the coding region correspond to the changes in codon usage introduced by these workers to enhance bacterial expression. The resultant amino acid sequence is unchanged. From this plasmid, a 938-bp fragment was generated using PCR (forward primer GCGAGCTCGGAGCTGCC; reverse primer GCACCCTAAACAGCCATTTCC). This fragment, spanning nucleotides 25–942 of the hTS open reading frame and five nucleotides of the 3′ UTR, created a Sac I restriction site at the 5′ end. The fragment was digested with Sac I. An IPTG-inducible bacterial expression vector pQE-31 (Qiagen; Mississauga, Ontario, Canada) was digested with Sma I, T-tailed with Taq DNA polymerase/dTTP, and then digested with Sac I. The PCR fragment was ligated to this vector. On IPTG-induction, the construct (pQE-hTS) expressed recombinant hTS protein lacking the first five N-terminal amino acids (MPVAG) and containing 16 additional N-terminal amino acids (MRGSHHHHHHTDPHAS), which includes a (His)₆ tag. pQE-hTS was introduced into E. coli M-15 [pREP4] (Qiagen) and plated on LB-agar plates containing ampicillin (100 μg/ml) and kanamycin (25 μg/ml). Ten colonies were selected and screened by small-scale IPTG induction for the presence of a 36-kD recombinant protein on Coomassie Blue-stained SDS-PAGE. The clone showing the strongest induction was selected for large-scale hTS purification.

pcDNA3/HA-hTS29 is a pcDNA3-based (Invitrogen; Carlsbad, CA) construct that encodes a 29-kD truncated form of hTS into which a hemagglutinin (HA) tag was introduced at the N-terminus (Cowling et al. 1998).

Ni-NTA-purified (His)₆-tagged hTS

pQE-hTS-transformed M-15 [pREP4] cells were grown to an A₆₀₀ of 0.7 in 500 ml 2 × YT broth containing ampicillin (100 μg/ml) and kanamycin (25 νg/ml) with vigorous shaking at 37C and then induced with 2 mM IPTG for 5 hr. Cells were collected by centrifugation (5000 × g) and the cell pellet was dissolved directly in 30 ml GPT [6 M guanidinium chloride, 0.1 M sodium phosphate, 0.01 M Tris-HCl (pH 8)], then incubated for 1 hr at room temperature (RT). The mixture was cleared by centrifugation (11,000 × g) and the supernatant was loaded onto an Ni-NTA agarose column (Qiagen) (4 ml bed volume) pre-equilibrated with GPT. The column was washed sequentially with (a) 10 column volumes of GPT (b) 8 M urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl (pH 8.0) until the A₂₈₀ of the eluate was <0.01, then (c) 8 M urea, 0.1 M sodium phosphate (pH 6.3) until the A₂₈₀ of the eluate was < 0.01. Bound protein was eluted with SDS buffer (2% SDS, 10 mM CDTA, 0.1 M sodium phosphate, pH 7.0) in 1 ml fractions. CDTA is cyclohexanediamine tetraacetate (Sigma-Aldrich; Oakville, Ontario, Canada). Fractions were analyzed by SDS-PAGE (Laemmli 1970) and stained with Coomassie Blue. The estimated recovery of hTS protein was 8 mg.

Gel-purified hTS

His₆-tagged hTS protein (1 mg) recovered from the Ni-NTA column was electrophoresed on SDS-PAGE using a Bio-Rad Protean II apparatus (Bio-Rad; Mississauga, Ontario, Canada) and then stained with Coomassie Blue. The 36-kD band was cut from the gel and the protein recovered by electroelution using Bio-Rad Electro-Eluter Model 422 in 8 mM Trisbase, 4 mM sodium acetate, 0.1% SDS, 0.2 mM CDTA (pH 8) at 10 mA for 2 hr. The electroeluted protein was precipitated with 4 volumes ethanol (2 hr at −20C), redissolved in SDS buffer, and subjected to a second round of electrophoresis on SDS-PAGE as above. Yield of the pure hTS protein was estimated to be 40–50% and purity >99%.

Immunizations

Eight New Zealand White rabbits were used to test the effectiveness of immunization using different forms of Ni-NTA-purified hTS (240 μg per rabbit) administered by different routes. Preimmune serum was taken from all rabbits before the primary injection. Different methods of immunization were tested, of which the best results (based on ELISA titers) were achieved as follows. The protein was ethanol-precipitated, redissolved in 0.1 M NaOH, partially hydrolyzed (10–13-kD peptides as assessed by SDS-PAGE) by heating at 100C for 20 min, neutralized with acetic acid, and emulsified in an equal volume of complete Freund's adjuvant (Difco; Detroit, MI). Rabbits #7 and #8 received IM injections at two sites. The first bleed was 12 days after primary injections and the antisera were screened for reactivity towards Ni-NTA-purified hTS by ELISA. These same rabbits were boosted twice with the same form and amount of immunogen as used for the primary injections at 4–5-week intervals, except that incomplete Freund's adjuvant was used. Ten days after each boost, blood samples (second and third bleed) were collected and the antisera were assayed by ELISA and Western blotting. Rabbit #8 was exanguinated at the time of the third bleed (antiserum hTS8.3). Rabbit #7 was maintained for 8 months after the third bleed and then boosted a third time with 50 μg of gel-purified hTS protein in the presence of incomplete Freund's adjuvant (Difco). This rabbit was exsanguinated 10 days after the boost and the antiserum (hTS7.4) was assayed by ELISA for reactivity towards gel-purified hTS.

ELISA

Wells of a 96-well polystyrene microtiter plate were coated by adding 50 μl per well of 20 μg/ml gel-purified hTS in 0.1 N NaOH and incubating overnight at RT. Wells were washed three times with ELISA buffer (0.02 M Tris-HCl, pH 7.5, 0.15 M NaCl, 0.05% v/v Tween-20) and then blocked by incubating with 2% bovine serum albumin (BSA) for 2 hr. Appropriately diluted primary antibodies (rabbit TS antiserum or rabbit preimmune serum) in ELISA buffer (100 μl per well) were then added to both the TS-coated and non-coated wells for 1 hr at 37C. Wells were washed three times with ELISA buffer to remove unbound antiserum. Secondary antibody, 1:1000 diluted phosphatase-conjugated goat anti-rabbit IgG (Kirkegaard & Perry; Gaithersburg, MD) (100 μl per well) was added and incubated for 1 hr at 37C. Wells were washed three times with ELISA buffer, and 100 μl per well of substrate [1 mg/ml p-nitrophenyl phosphate (Sigma-Aldrich) in 10% v/v ethanolamine, 0.5 mM MgCl₂, pH 9.8] was added. The reaction was stopped after 20 min by addition of 100 μl of 0.1 M CDTA, and the absorbance of the reaction was measured at 405 nm in a Benchmark Microplate Reader (Bio-Rad). For correction of nonspecific binding, the absorbance of the noncoated wells was subtracted from the absorbance of corresponding TS-coated wells. Each assay was performed at least in triplicate.

Preadsorbed (hTS7.4p) and Affinity-purified (hTS7.4a) TS7.4 Antiserum

A total of 0.5 g of cyanogen bromide-activated Sepharose 4B (Pharmacia Biotech; Baie d′Urfe, Quebec, Canada) (preswollen and washed in 1 mM HCl) was incubated with 0.5 mg of gel-purified hTS in 2.5 ml coupling solution (0.1 M NaHCO₃, 0.5 M NaCl, pH 8.3) overnight at 4C. The beads were then washed with 2 vol coupling solution and the residual active groups were blocked with 4 vol 0.1 M Tris-HCl, pH 8.0, by incubation for 2 hr at RT. The beads were transferred to a column and washed for three cycles, alternating with 0.1 M sodium acetate, 0.5 M NaCl, pH 4.0, followed by 0.1 M Tris-HCl, 0.5 M NaCl, pH 8.0. The column was finally equilibrated with 0.01 M Tris-HCl (pH 7.5). Diluted hTS7.4 antiserum (1:10 in 1 ml of 0.01 M Tris-HCl, pH 7.5) was passed through the column a total of five times. The final flow-through was designated hTS7.4p. Antibody recovered from the column in 0.1 M glycine buffer at pH 2.5 was designated hTS7.4a; about 50% of the bound hTS7.4 was recovered, as determined by ELISA. As a control, diluted hTS7.4 antiserum was passed through a similar Sepharose 4B column to which BSA was coupled.

Western Blot Analysis

Cells were lysed in lysis buffer (0.5% Triton X-100, 1 mM CDTA, 1 mM PMSF, 1 mg/ml aprotinin, 20 mM MOPS, pH 7.2), incubated for 30 min on ice, and centrifuged at 14,000 × g for 20 min. Extracts were diluted in SDS sample buffer (2% SDS, 10% glycerol, 1% 2-mercaptoethanol, 0.0005% bromophenol blue, 125 mM MOPS, pH 6.8), and heated at 100C for 5 min. Protein was quantified by fluorescamine (Udenfriend et al. 1972) (Sigma-Aldrich), an amine-reactive fluorophore, as described elsewhere (De Vouge et al. 1994). Extracts were resolved on 12% discontinuous SDS-PAGE and elecrophoretically transferred to PVDF membranes (Millipore; Nepean, Canada) at 15 V for 18 hr in a solution of 3 mM Na₂CO₃, 10 mM NaHCO₃, and 10% methanol. The membranes were Ponceau S-stained to detect the standards, washed twice in TBST (10 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 8), and then blocked with BSA (1%) for 30–45 min. Primary antibodies were diluted in TBST and incubated with the membranes for 1 hr. The membranes were washed three times in TBST and then incubated for 1 hr with secondary antibody (alkaline phosphatase-linked goat anti-rabbit IgG) diluted 1:1000 in TBST. The membranes were washed three times in TBST and then developed by using either BCIP/NBT substrate (Sigma-Aldrich) or a chemiluminescent substrate, CSPD (Boehringer-Mannheim; Laval, Quebec, Canada).

Immunoprecipitation

HeLa cells (1.2 × 10⁶ in a 10-cm dish) were incubated for 6.5 hr in DMEM lacking l-methionine and l-cysteine and containing 100 μCi L-[³⁵ S]-methionine (Sigma-Aldrich). Cells were washed and lysed in 200 μl lysis buffer. After incubation for 30 min at 0°C, the lysate was clarified by centrifugation at 14,000 × g for 20 min. The supernatant was first incubated with preimmune serum (1:10) of rabbit #8 for 1 hr at 4C and then with protein A-Sepharose (Sigma-Aldrich) for 30 min at 4C. Beads were removed by centrifugation and the supernatant was incubated with fresh protein A-Sepharose for 30 min at 4C. After removing the beads, the supernatant was incubated with a 1:500 dilution of hTS-8.3 antiserum or with a 1:500 dilution of preimmune serum for 1 hr at 4C. The extracts were incubated with protein A-Sepharose for 1 hr at 4C and the beads collected by centrifugation. The beads were washed three times in lysis buffer and bound protein was recovered for PAGE analysis by boiling for 2 min in SDS sample buffer. An equal number of ³⁵ S counts taken from each of these fractions, as well as from the original nonimmunoprecipitated extract, were loaded on SDS-PAGE (12%). Radiolabeled proteins were visualized by exposure to Kodak XAR film for 3 days at −80C.

Immunofluorescence of Cultured Cells

HeLa or COS-1 cells (3 × 10⁴ per 3-cm dish) were grown on coverslips for 72 hr, washed four times with PBS, and fixed with methanol:acetone (1:1) for 5 min at RT. Fixed cells were then rinsed twice in PBS and incubated for 1 hr with primary antibodies (hTS7.4 antisera, preimmune rabbit sera, or mouse anti-HA (Boehringer-Mannheim) diluted in Ab buffer (0.05% Tween-20, 1% BSA, 5% goat serum, 150 mM NaCl, 50 mM Tris-HCl, pH 7.5). The cells were washed three times in PBS and then the rabbit antisera were detected with FITC-conjugated anti-rabbit IgG (Cedarlane; Hornby, Ontario, Canada) (1:500 dilution, 1-hr incubation), while the mouse monoclonal anti-HA antibody was reacted with biotinylated goat anti-mouse IgG (Cedarlane) (1:500 dilution, 1-hr incubation) and then stained with Texas Red-conjugated streptavidin (Cedarlane) (1:500 dilution, 1-hr incubation). After three washes with PBS, the slides were mounted and examined by fluorescence microscopy.

Immunohistochemistry of Fixed Cells

Cultures of human fibroblasts (2.5 × 10⁵ per 3-cm dish containing a sterile glass coverslip) were grown to confluency and then incubated for a further 2 days. Areas of the confluent monolayer culture were wounded with a sterile pipette tip to disrupt the monolayer and then cells were incubated for an additional 18 hr. The coverslips were washed four times with PBS and fixed in GenoFix, a methanol-based tissue fixative (DNA GenoTek; Montreal, Quebec, Canada) for 15 min at RT. Fixed cells were rinsed four times with PBS and incubated in suppressor solution (20% normal goat serum, 4% BSA, 1% normal swine serum, 0.1% NP-40, and 10% sucrose in PBS). After 20 min, primary antibodies (hTS7.4 or hTS7.4p) were diluted 1:300 in antibody diluent (1% BSA, 0.1% NP-40, and 10% sucrose in PBS) and added to the cells. After 1-hr incubation, the primary antibody was removed by washing three times in PBS and the cells were incubated with biotin-conjugated goat anti-rabbit IgG (Vector; Burlingame, CA) for 20 min. Cells were washed three times in PBS and incubated with horseradish peroxidase-conjugated avidin D (Vector). After 20 min, cells were washed three times in PBS and incubated with diaminobenzidine substrate (0.5 mM diaminobenzidine, 7 mM hydrogen peroxide) for 10 min. The cells were finally washed three times in distilled H₂O, dehydrated three times in ethanol, cleared three times in toluene, and mounted to glass slides using Permount (Fisher; Fair Lawn, NJ).

Immunohistochemistry of Human Tissue

Colorectal cancer specimens were from the Ottawa Colorectal Cancer Bank; most were fixed in GenoFix, a methanol-based tissue fixative (DNA GenoTek). Four- μm sections were deparaffinized and hydrated by standard methods. Slides were heated in 10 mM citrate buffer (pH 6) in a microwave oven, blocked with suppressor solution, exposed overnight at RT to 1:300 dilution of hTS7.4 antiserum, then to peroxidase-linked anti-rabbit/anti-mouse immunoglobulin antibody (polymer from DAKO; Carpinteria, CA) for 30 min. Avidin-based detection was avoided because high tissue biotin-like material was encountered in many colorectal samples. Color development used diaminobenzidine substrate and sections were counterstained with hematoxylin. Human tonsil tissue, fixed in formalin, was similarly treated using 1:150 dilution of hTS7.4 or 1:20 dilution of 1 mg/ml anti-TS monoclonal antibody TS106 (Chemicon International).

TS Activity Assay

Extracts of bacterial cells containing the inducible expression vector, pQE-hTS, were tested for inducible TS activity. Two 50-ml 2 × YT cultures (containing ampicillin and kanamycin) were inoculated with an overnight culture of pQE-hTS in M-15 (pREP4). When the A600 reached 0.7, one culture was incubated with 2 mM IPTG (induced) and the other without (uninduced) for 3 hr. Cells were harvested, lysed by sonication in sonication buffer [300 mM NaCl/50 mM sodium phosphate (pH 7.8)] and centrifuged at 11,000 × g for 10 min at 4C. The supernatant (soluble fraction) was removed and the pellet was suspended in 5 ml of sonication buffer and resonicated (insoluble fraction). Both fractions were analyzed for TS enzymatic activity using a spectrophotometric assay based on the oxidation of CH₂THF to dihydrofolate, detected as an increase in absorbance at 340 nm (Reyes and Heidelberger 1965). Reaction mixtures (1.0 ml) contained 10 μg of protein, 200 μM tetrahydrofolate (Sigma-Aldrich), 3.3 mM formaldehyde, and 50 mM β-mercaptoethanol in 0.1 M phosphate buffer (pH 6.7). After 10-min preincubation at 37C, the initial A₃₄₀ was measured, after which the reaction was started by adding 100 nmol dUMP; control reactions lacking dUMP were carried out in parallel. After 20 min incubation at 37C, the A₃₄₀ was again measured. ΔA₃₄₀ is the difference between A₃₄₀ (final) and A₃₄₀ (initial). The corrected ΔA₃₄₀ is the difference between test and control reactions. One enzyme unit was defined as the formation of 1 μmol of dihydrofolate per min, which equals a corrected ΔA₃₄₀ of 6.4 (Reyes and Heidelberger 1965).

Cell Lines Employed

All cell lines were grown in DulbeccO's modified Eagle's medium (DMEM) plus 10% fetal calf serum (GIBCO BRL; Burlington, Ontario, Canada) in a humidified atmosphere of 5% CO₂/95% O₂ at 37C. Log phase cultures were used throughout except where otherwise indicated. Cell lines of human origin used in this study include HeLa, HL-60, and 293T cells (from ATCC; Rockville, MD). Human neutrophils were isolated as described (Cowling and Birnboim 1994). COS-1 cells (ATCC) are of African green monkey origin. rOSE 199 cells are rat ovarian surface epithelium (Adams and Aversperg 1985) (obtained from B. Vanderhyden). MC17-51 are a mouse fibrosarcoma line (Wilkinson et al. 1995). Where indicated, cell transfections were carried out using Lipofectamine (GIBCO BRL).

Purification of Immunogen

Recombinant human thymidylate synthase (hTS) expressed in E. coli was used to prepare a rabbit polyclonal antibody. The protein was expressed with six histidine residues at the N-terminus to allow it to be purified on an Ni²⁺ column. After induction with IPTG, the bacteria showed increased expression of a 36-kD protein, corresponding to the molecular mass of hTS monomer (Figure 1, Lanes 1 and 2). A prominent 35-kD band was seen in the absence of induction with IPTG, making it difficult to assess whether there was some “leaky” production of the 36-kD recombinant protein. To confirm that the induced protein was indeed thymidylate synthase, extracts of IPTG-induced and noninduced bacterial cells were analyzed for TS enzymatic activity (Table 1). The IPTG-induced culture showed 14-fold higher TS activity than the noninduced culture, confirming that the induced protein was indeed TS. TS enzymatic activity was also confirmed using a radioactive TS assay (Calvert et al. 1980) (not shown). Whole cells from IPTG-induced cultures were solublized and His₆-hTS was then purified by Ni²⁺ -affinity chromatography. Peak A₂₈₀ fractions eluted from the column were pooled and showed predominantly (>95%) a single 36-kD band, corresponding to hTS (Figure 1, Lane 3).

Generation of Anti-TS Antiserum

Of four protocols tested in eight rabbits injected with recombinant hTS, the highest ELISA titer after the first injection was obtained by the procedure described in Materials and Methods. Immunization was continued in those two rabbits. Antisera collected 10 days after the third injection (hTS7.3 and hTS8.3) were titered by ELISA and Western blots. The highest dilution detectable by ELISA was 1:100,000 for both antisera. The highest dilution of both antisera that could detect a 36-kD protein band on a Western blot of a HeLa cell extract was 1:10,000 (not shown).

OPEN IN VIEWER

Figure 1

SDS-PAGE stained with Coomassie blue to detect recombinant hTS. Four μg of protein from bacterial cell extracts transformed with pQE-hTS plasmid was loaded in each lane. Bacterial cells were either not induced (Lane 1) or IPTG-induced (Lane 2) to express a 36-kD His₆-tagged hTS protein that was affinity-purified by Ni-NTA (Lane 3) and by gel purification (Lane 4).

OPEN IN VIEWER

Figure 2

Western blot analysis of HeLa cell extracts and purified His₆-hTS protein. (A) HeLa cell extracts (5 μg protein per Lane) were probed with hTS7.3 (Lane 1), hTS7.4 (Lane 2), hTS7.4p (Lane 3), and hTS7.4a (Lane 4) antisera. (B) Extracts (5 μg protein per lane) from HeLa cells, either not treated (Lane 2) or treated with 10 μM FUdR for 24 hr (Lane 1), were probed with hTS7.4. (C) His₆-chromodomain (5 μg), bovine serum albumin (4 μg), and His₆-hTS (0.5 μg) proteins were Ponceau S-stained (Lane 1) and probed with hTS7.4 (Lane 2). Blots were detected with BCIP/NBT.

OPEN IN VIEWER

Table 1

Thymidylate synthase (TS) enzymatic activity in soluble and insoluble fractions of uninduced and induced E. coli cells expressing putative recombinant hTS a

	TS activity (10−3 U/mg protein)
Fraction	Uninduced cells	Induced cells	Induced/Uninduced
Soluble	3.6 ± 0.3	4.2 ± 0.9	1.2
Insoluble	2.1 ± 0.1	30.2 ± 0.8	14.3

^aActivity assay and cell fractionation are described in Materials and Methods. The activity represents the mean ± SEM of two independent experiments.

Both hTS7.3 and hTS8.3 antisera showed a low level of crossreactivity with proteins other than 36-kD TS protein. The following strategy was devised to further increase the specificity of the antiserum. Eight months after the third injection, rabbit #7 was injected with gel-purified hTS (Figure 1, Lane 4) and antiserum hTS7.4 was taken 10 days later. hTS7.4 was similar to hTS7.3 and hTS8.3 in that both detected recombinant hTS on ELISA up to 1:100,000 dilution and both detected a 36-kD band on Western blots of HeLa extracts up to 1:10,000 dilution (not shown). However, a Western blot comparing hTS7.3 and hTS7.4 at 1:1000 dilution produced a significantly lower background for the latter (Figure 2A; compare Lanes 1 and 2).

hTS7.4 Antiserum Specifically Detects TS on Western Blots

To confirm that the 36-kD band on Western blots of HeLa cell extracts (Figure 2A, Lane 2) was TS, hTS7.4 antiserum was depleted of hTS-specific antibodies by passing it through a column to which recombinant hTS was immobilized. hTS7.4p (preadsorbed hTS7.4) did not detect a 36-kD band (Figure 2A, Lane 3) and showed a 94% lower signal on ELISA compared to hTS7.4 (not shown). hTS7.4a (affinity-purified hTS7.4) produced similar results to hTS7.4 on Western blots (Figure 2A; compare Lanes 2 and 4). To show that the hTS affinity column was binding hTS7.4 specifically, hTS7.4 antiserum was passed through a column to which albumin was immobilized; the flow-through was identical to the untreated antiserum on a Western blot and in ELISA (not shown).

As an independent test of the identity of the 36-kD protein in HeLa cell extracts, cells were incubated with FUdR for 24 hr and cell lysates were probed on Western blots with hTS7.4 antiserum. A band shift, corresponding to the formation of a stable ternary complex of TS protein, FdUMP and CH₂THF, was seen (Figure 2B), as described earlier (Johnston et al. 1991).

Because hTS7.4 antiserum was raised using hTS tagged with six histidine residues at its amino terminus, there was the possibility that the antiserum might detect the His₆ tag. This was tested by Western blotting against an unrelated His₆-tagged protein (His₆-chromodomain protein) (Figure 2C, Lane 2). No His₆-chromodomain was detected, even though tenfold the amount of the 63-kD protein as His₆-hTS was loaded.

hTS7.4 was compared to an anti-TS monoclonal antibody (TS106) that has recently become commercially available. Western blots of HeLa cell extracts probed with hTS7.4 and TS106 produced similar results. However, a fairly high concentration of TS106 (10 μg/ml; 1:100 of the 1 mg/ml solution supplied by Chemicon) was required to produce a 36-kD TS protein band of similar intensity to a 1:10,000 dilution of hTS7.4 antiserum (not shown).

Detection of TS in Other Cell Types by Western Blotting with hTS7.4

hTS7.4 was used to assess the TS levels in extracts of various human cells (Figure 3A). HeLa cells, 293T cells, and log-phase primary human skin fibroblasts had similar TS levels (Figure 3A, Lanes 1–3); HL-60 cells had about two times higher levels (Figure 3A, Lane 5). TS was barely detectable in 48-hr postconfluent fibroblasts (Figure 3A, Lane 4), and none was detectable in primary human peripheral blood neutrophils (Figure 3A, Lane 7). HL-60 cells that were treated for 3 days with retinoic acid to cause differentiation into a neutrophil-like cell type still showed high hTS levels (Figure 3A, Lane 6), but the expected disappearance of TS signal (as in neutrophil extracts) was not seen. The membrane was stripped and re-probed with anti-β-tubulin antibody as a loading control. Although neutrophils showed little β-tubulin, they did show other proteins when the membrane was stained with Ponceau S (not shown). 293T cells were transiently transfected with a construct (pcDNA3/HA-hTS29) expressing a truncated hTS protein tagged with hemagglutinin (HA) at the N-terminus. The 29-kD recombinant protein was detected by both HA and hTS7.4 antibodies on Western blots (Figure 3B, Lanes 2 and 4). These signals were absent in control (pcDNA3-transfected) 293T cells (Figure 3B, Lanes 1 and 3). Both the endogenous 36-kD hTS protein and the truncated 29-kD HA-hTS29 protein could be detected by hTS7.4 antiserum on the same blot (Figure 3B, Lanes 3 and 4).

hTS7.4 antiserum also detected TS protein in nonhuman species (Figure 3C). A band of the expected size for TS from that species (indicated by the arrows) was detected in extracts of proteins from E. coli (Figure 3C, Lane 1), rat cells (Figure 3C, Lane 2), mouse cells (Figure 3C, Lane 3) and African green monkey cells (Figure 3C, Lane 4), as well as HeLa cells (Figure 3C, Lane 5).

Immunocytochemistry with hTS7.4

We next addressed whether hTS7.4 could detect hTS protein in cultured cells. Immunofluorescence staining of fixed HeLa cells with 1:1000 hTS7.4 antiserum (Figure 4B) gave a cytoplasmic signal that was significantly higher than that seen using preimmune serum (Figure 4A). To further confirm that the antiserum was in fact detecting hTS in fixed cells, immunofluorescence was carried out on COS-1 cells transiently transfected with pcDNA3/HA-hTS29, the construct that expressed HA-tagged truncated hTS (Figures 4C-4E). These cells gave a very strong cytoplasmic signal with both anti-HA antibody (Figure 4C) and hTS7.4 (Figure 4D). COS-1 cells transfected with pcDNA3 vector did not stain with either hTS7.4 or anti-HA antibodies (not shown).

OPEN IN VIEWER

Figure 3

Western blot analysis of different cells with hTS7.4 antiserum. (A) Cell extracts (20 μg protein per lane) from HeLa (Lane 1), 293T (Lane 2), log-phase primary human skin fibroblasts (Lane 3), 48-hr postconfluent fibroblasts (Lane 4), HL-60 (Lane 5), HL-60 cells treated with 1 μM all- trans-retinoic acid for 3 days (Lane 6), and neutrophils (Lane 7) were probed with hTS7.4 (upper panel) or anti-tubulin (lower panel) antibody. (B) Five μg protein from extracts of 293T cells transiently transfected with pcDNA3-alone (Lanes 1 and 3) or pcDNA3/HA-hTS29 (Lanes 2 and 4) was probed with either anti-HA antibody (Lanes 1 and 2) or hTS7.4 (Lanes 3 and 4). (C) Extracts (5 μg protein per Lane) from E. coli SURE cells (Lane 1), rat OSE cells (Lane 2), mouse MC17-51 cells (Lane 3), African green monkey COS-1 cells (Lane 4), and human HeLa cells (Lane 5) were probed with hTS7.4. Arrows indicate the expected size of TS for the species. Blots were detected with CSPD (A) or BCIP/NBT (B,C).

OPEN IN VIEWER

Figure 4

Immunocytochemical analysis of cultured cells using hTS7.4 and anti-HA antibodies. Indirect immunofluorescence of HeLa cells with preimmune serum (A) or hTS7.4 antiserum (B) using FITC-labeled secondary antibody (magnification × 400). (C-E) Double indirect immunofluorescence of COS-1 cells transiently transfected with pcDNA3/HA-hTS29 and stained with anti-HA antibody (Texas Red-streptavidin-biotin secondary) and hTS7.4 antiserum (FITC-labeled secondary antibody). The same field was viewed under red fluorescence (C), green fluorescence (D), or phase-contrast (E) (magnification × 200). (F-I) Immunohistochemical analysis with hTS7.4 using biotinylated secondary/peroxidase-avidin/DAB on 48-hr postconfluent human fibroblasts that were undisturbed (F,H) or wounded to disrupt confluency (G,I) (magnification × 100 for F and G and × 400 for H and I).

hTS7.4 was able to distinguish the higher level of TS in proliferating primary human fibroblasts compared to the very low levels in nonproliferating, confluent fibroblasts. Immunohistochemistry was carried out on a monolayer of 48-hr postconfluent fibroblasts that had been scratched to disrupt confluency and to permit cells in the region of the wound to begin cycling (Figures 4F-4I). Cells in the untouched, confluent area of the monolayer showed very little staining (Figure 4F and 4H), whereas there was relatively high cytoplasmic staining of cells near the wound that had been stimulated to enter the cell cycle (Figure 4G and 4I). This finding is consistent with the Western blot showing very low TS levels in confluent cells compared to dividing cells (Figure 3A).

Immunoprecipitation of [³⁵ S]-TS from HeLa Cell Extracts

Antiserum hTS8.3 was tested for its ability to immunoprecipitate native TS from [³⁵ S]-methionine-labeled HeLa cell extracts. As shown in Figure 5, a clear 36-kD band was seen when hTS8.3 was used (Figure 5, Lane 3), whereas none was seen when preimmune serum was used (Figure 5, lane 2). The total HeLa cell extract (Figure 5, lane 1) showed no distinct band of this size because the amount of [³⁵ S]-methionine incorporated into TS represented only a very small fraction of the total. Most of the background [³⁵ S]-methionine-labeled proteins seen in Figure 5, Lanes 2 and 3, was due to nonspecific binding to the protein A-Sepharose beads.

Immunohistochemistry of Paraffin-embedded Tissue Samples

An application of hTS7.4 will be the assessment of TS levels in human tumor samples. To determine the utility of the antiserum for this purpose, clinical samples from the Ottawa Colorectal Tumor Bank were examined immunohistochemically. An example of a colorectal cancer specimen that showed intense staining with hTS7.4 (Figure 6A and 6B) with faint or no staining with hTS7.4p (Figure 6D and 6E) is presented. Normal colon mucosa (Figure 6C) showed weak staining with hTS7.4 and faint staining with hTS7.4p (Figure 6F). Other cases of colorectal cancer showed intermediate levels of staining (not shown).

OPEN IN VIEWER

Figure 5

Immunoprecipitation of [³⁵ S]-hTS from HeLa cell extracts with hTS8.3 antiserum. Autoradiograph of [³⁵ S]-methionine-labeled HeLa proteins before (Lane 1) and after immunoprecipitation with either preimmune serum (Lane 2) or hTS8.3 antiserum (Lane 3). An equal amount of radioactivity was loaded per lane.

As another application of hTS7.4 antiserum, paraffin-embedded human tonsil tissue sections were stained for TS (Figure 7). B-lymphocytes present in the germinal centers of tonsil tissues are known to be proliferating (Siegel 1979). These cells stained positively with 1:150 diluted hTS7.4 antiserum (Figure 7A). A monoclonal antibody to TS (TS106) has recently become commercially available. To compare the two directly, a serial section was stained with TS106. At the supplier's recommended dilution for TS106 (1:50 to 1:100 of 1 mg/ml), TS was not detected. At a dilution of 1:20, staining by TS106 (Figure 7B) was similar to hTS7.4.

OPEN IN VIEWER

Figure 6

Immunohistochemical analysis of human malignant (A,B,D,E) and normal (C,F) colon tissues with hTS7.4 (A-C) or hTS7.4p (D-F) antiserum.

OPEN IN VIEWER

Figure 7

Comparison of polyclonal antibody hTS7.4 (A) and monoclonal antibody TS106 (B) for immunohistochemical staining of TS in human tonsil tissue. Details as described in Materials and Methods.