Toll-Like Receptor 2 Gene Polymorphisms in a Korean Population

Abstract

Objective. To investigate the role of single-nucleotide polymorphisms (SNPs) in the gene encoding Toll-like receptor (TLR) 2 in Korean patients with chronic rhinosinusitis (CRS) and controls.

Study Design and Setting. A case-control study.

Subjects and Methods. Subjects (N = 214) were all adults (>20 years old) and were divided into patients with CRS (n = 106) and controls (n = 108). Five SNPs (rs1898830, rs3804099, rs3804100, R677W, and rs5743708) were selected and genotyped in a case-control study with the single-base-pair primer extension (SNaPshot) assay.

Results. The case-control study revealed that 2 SNPs in TLR2, rs3804099 (odds ratio [OR] = 2.88; 95% confidence interval [CI] = 1.17-7.09; P = .022) and rs3804100 (OR = 3.76; 95% CI = 1.42-9.96; P = .008), showed significant differences in minor allele frequency between CRS patients and controls. These 2 SNPs were correlated with CRS risk in Korean patients.

Conclusions. Two SNPs in TLR2 may be associated with increased risk of CRS in Korean subjects.

Keywords

toll-like receptor polymorphism single-nucleotide polymorphism sinusitis

Although chronic rhinosinusitis is a common chronic disease, its pathogenesis remains unclear. Many previous studies have indicated an association between bacterial pathogens and chronic rhinosinusitis (CRS) and noted that gram-positive and gram-negative bacteria are the main pathogens involved in CRS.¹ The nasal epithelium is the first line of host defense against foreign organisms in inspired air but is also a target organ for infection.

The human immune system has two components: innate immunity and adaptive immunity. Immune responses against nonself pathogens are initiated by the innate immune response, which initially recognizes foreign pathogens, followed by the adaptive immune response that confers a specific response to the pathogens.² The initial recognition of foreign pathogens, such as bacteria, viruses, and fungi, by the nasal epithelium is made by the innate immune system, involving Toll-like receptors (TLRs), which is an important step for the subsequent inflammatory process and adaptive immunity.

Although the bacteria found in cases of CRS differ from those associated with acute rhinosinusitis, the most common bacteria associated with CRS are Staphylococcus aureus, coagulase-negative Staphylococcus, and anaerobic and gram-negative bacteria, and the initial recognition of these pathogens by the host is mediated by TLR2 and TLR4. TLR2 is the main receptor in the detection of S aureus, although it also recognizes fungi.^1-3

All human beings do not respond to certain foreign pathogens in the same manner, and these differences in responses to foreign pathogens in a cohort of affected patients compared with healthy controls may be explained by genetic variations, such as single-nucleotide polymorphisms (SNPs). Thus, the present study was performed to determine whether certain polymorphisms of the TLR2 gene are more prevalent in patients with CRS, as this may suggest a genetic role of TLR2 in the pathogenesis of CRS.

We hypothesized that varying responses to gram-positive bacteria, especially mediated by certain TLR2 SNPs, may result in a tendency to develop CRS in genetically susceptible subjects. To test this, we investigated the frequencies of representative SNPs in the human TLR2 gene between patients with CRS and normal controls as well as their relationships to adaptive immunity, using the multiple allergosorbent test (MAST).

Materials and Methods

Subjects

Patients with CRS and healthy subjects who attended St Vincent’s Hospital from June 2008 to October 2009 were prospectively selected for the study. All subjects were Korean and more than 20 years old.

All CRS patients were diagnosed according to the criteria of the American Academy of Otolaryngology—Head and Neck Surgery Foundation (2007)⁴ and were compared with the control group, who were diagnosed as lacking CRS based on symptom history, nasal endoscopy, and plain x-ray or paranasal sinus computed tomography (CT) scans during the same period. Individuals with mucocele, odontogenic sinusitis, postoperative cheek cysts, fungal sinusitis, inverted papilloma, trauma, tumors at other sites, or other intrinsic diseases, such as autoimmunity, endocrine diseases, and genetic diseases, were excluded.

Age, gender, and past medical and surgical history were obtained preoperatively and PNS CT and MAST were performed. MAST results greater than class 3 were regarded as positive.

All subjects provided written informed consent before blood sampling. The experimental protocol complied with the guidelines of the Declaration of Helsinki and was approved by the Ethics Committee of Clinical Study at St Vincent’s Hospital, the Catholic University of Korea, College of Medicine, Seoul, Republic of Korea.

SNP Selection

We evaluated a total of five SNPs in TLR2, and selection criteria were as follows:

Minor allele frequency (MAF) >5% in the Japanese and Chinese populations using genotype data from the National Center for Biotechnology Information (NCBI) dsSNP and the International Haplotype Mapping Project website (http://www.hapmap.org);

Tag SNPs were chosen by pairwise tagging to identify the common variation within these genes and the surrounding area, with a minimum coefficient of determination (r2) of 0.80; and

Ethnicity 3 SNPs (rs1898830, rs3804099, and rs3804100) were selected according to selection criteria 1 and 2. Two additional SNPs were force included for the following reasons: One (R677W) was added because its relationship with disease has been demonstrated in Korean patients with lepromatous leprosy, and the other (R753Q, rs5743708) was selected to confirm reliability of our study because its MAF is >5% primarily in Caucasian populations and is almost 0% in Asians.

Linkage disequilibrium blocks were constructed using the D′ method of Gabriel et al⁵ and were implemented in Haploview (Figure 1).⁶

Figure 1.

Linkage disequilibrium (LD) blocks for TLR2 to show positions of genotyped 3 single-nucleotide polymorphisms (SNPs). Squares are colored more reddish if the pairwise D′ values are high, which means LD is strong.

DNA Extraction

For the SNP assay, 4 mL of whole blood was sampled in vials containing EDTA and then transported to the laboratory. Peripheral blood lymphocytes were collected for DNA extraction. DNA was extracted from whole blood with a DNA extraction kit (Bioneer Co, Daejeon, Republic of Korea) according to the manufacturer’s instructions.

SNP Genotyping

The genotypes of the 2 groups were analyzed with the single-base-pair primer extension (SNaPshot) assay using an ABI SNaPshot Multiplex Kit according to the manufacturer’s instructions on an ABI PRISM 3730xl Genetic Analyzer (Applied Biosystems, Foster City, CA). The primers for TLR2 are summarized in Table 1 .

Table 1.

Summary of Primers

Single-Nucleotide Polymorphism	Allele (Major/Minor)	rs Number	Primer
−15607A/G	A/G	rs1898830	Forward: AAATGAATGAGCAAGCAAA Reverse: TGGCCTCCTGCTTATGT
S450S	T/C	rs3804100	Forward: CAGGAAACAGCTATGACCCCGATGAAAGTTTGTTTCAGG Reverse: TGTAAAACGACGGCCAGTGTTGCGGCAAATTCAAAGA
N199N	T/C	rs3804099	Forward: ACTTACCTTCCTTGAGGAACTTG Reverse: AACTTGTAACATCTACAAAAATCTCCA
R677W	T/A		Forward: AAGGAAGCCCAGGAAAGReverse: GCCACTCCAGGTAGGTCT
R753Q	G/A	rs5743708	Forward: AAGGAAGCCCAGGAAAGReverse: GCCACTCCAGGTAGGTCT

Statistical Analysis

Statistical analyses were performed with SAS software (SAS Institute, Cary, NC), and haplotypes and their frequencies were calculated using the Haploview program (http://www.broadinstitute.org/mpg/haploview). The population sample size could provide 69% power in detecting differences in MAF >0.1 between the case and control groups. Hardy-Weinberg equilibrium (HWE) in controls was analyzed for each SNP using the permutation test.

The χ² test with contingency tables was used to assess differences in allele frequency, and logistic regression analysis was performed with and without adjusting for age and gender as covariates between CRS patients and controls. Genotype-specific risks were calculated as odds ratios (ORs). In all analyses, P values <.05 were deemed to indicate statistical significance.

Results

Characteristics of the Study Population

The CRS group consisted of 106 patients (64 men, 42 women) with a mean ± SD age of 45.68 ± 13.49 years. The control group consisted of 108 healthy volunteers (71 men, 37 women) with a mean age of 36.26 ± 13.39 years. The difference in age between the patient and control groups was statistically significant, but there was no significant difference in gender ratio (χ² test; data not shown).

HWE for Genotyped TLR2 SNPs

In the controls, all genotyped SNPs were in HWE (P > .05) except R677W and R753Q (rs5743708), both of which had MAF = 0.

Association Studies of TLR2 SNPs Between CRS Patients and Controls

Table 2 summarizes the results of TLR2 SNP analyses. One SNP (rs3804100) showed a significant difference between the patient and control groups before adjusting for age and gender, but 2 SNPs (rs3804099, rs3804100) showed significant differences after adjusting for age and gender, with ORs of 2.88 and 3.76, respectively.

Table 2.

Analysis of TLR2 Gene SNP Minor Alleles^a

SNP	HWE	MAF (Control)	MAF (Case)	OR (95% CI)	P Value	OR (95% CI)^b	P Value^b
rs1898830	0.5662	0.4583	0.4198	1.15 (0.59, 2.23)	.683	1.08 (0.53, 2.2)	.829
rs3804099	0.6465	0.3102	0.3443	2.25 (0.96, 5.27)	.057	2.88 (1.17, 7.09)	.022^c
rs3804100	0.3536	0.2944	0.3491	2.92 (1.17, 7.32)	.018^c	3.76 (1.42, 9.96)	.008^c
rs5743706		0.0000	0.0000
rs5743708		0.0000	0.0000

Abbreviations: CI, confidence interval; CRS, chronic rhinosinusitis; MAF, minor allele frequency; OR, odds ratio; SNP, single-nucleotide polymorphism.

Minor allele frequencies of TLR2 in CRS patients and control adults. Only one SNP (rs3804100) showed a statistically significant difference between the 2 groups before adjustment for age and gender, but 2 SNPs (rs3804099 and rs3804100) showed significant differences after adjustment for age and gender (P < .05). Two SNPs (rs5743706 and rs5743708) showed no minor alleles, so their MAFs were zero in adult subjects.

Adjusted for age and gender.

P < .05.

Two SNPs (rs5743706, rs5743708) showed no minor alleles, and so their MAF values were zero. The MAF of rs5743708 was zero, which agreed with previous reports in Asian populations, but that of R677W (Arg677Trp) was also zero, which was not consistent with data reported previously for leprosy patients in a Korean population.

Haplotype Analysis of TLR2 Between CRS Patients and Controls

The results of TLR2 haplotype analysis between CRS patients and controls are summarized in Table 3 . Three haplotypes (C-C, T-T, A-C-C) for rs1898830, rs3804099, and rs3804100 showed significant differences between adult CRS patients and controls, suggesting the possibility that these haplotypes show close genetic linkage and are inherited together.

Table 3.

Haplotype Analyses of TLR2 (rs1898830, rs3804099, rs3804100) Between Adult CRS Patients and Controls

Haplotype		CRS	Control	P Value^a
C-C	C-C C-C	18 (16.98)	7 (6.54)	.012^b
	C-C other	37 (34.91)	49 (45.79)
	Other other	51 (48.11)	51 (47.66)
T-T	T-T T-T	50 (47.17)	50 (46.73)	.016^b
	T-T other	38 (35.85)	49 (45.79)
	Other other	18 (16.98)	8 (7.48)
A-C-C	A-C-C A-C-C	17 (16.04)	6 (5.61)	.007^b
	A-C-C other	37 (34.91)	46 (42.99)
	Other other	52 (49.06)	55 (51.4)

Abbreviation: CRS, chronic rhinosinusitis.

Adjusted for age and gender.

P < .05; P > .05 for other haplotypes (A-T-T, G-T-T).

Analysis of SNPs According to the Results of MAST

Previous studies have focused on the relationship between CRS and adaptive immunity. To evaluate the relationship between SNPs of TLR2 and adaptive immunity in CRS, SNPs were analyzed according to the results of MAST in CRS patients and controls. Our results showed no relationship between these SNPs and the results of MAST in the CRS group, indicating that none of the TLR2 SNPs genotyped in this study might affect the state of adaptive immunity ( Table 4 ).

Table 4.

Analysis of SNPs between CRS Patients With and Without Positive MAST Results

SNP		CRS/MAST (+)	CRS/MAST (−)	P Value
rs1898830	AA	7 (30.43)	33 (41.77)	.320
	GA	11 (47.83)	31 (39.24)
	GG	5 (21.74)	15 (18.99)
rs3804099	TT	10 (43.48)	36 (45.57)	.538
	CT	10 (43.48)	28 (35.44)
	CC	3 (13.04)	15 (18.99)
rs3804100	TT	10 (43.48)	37 (46.84)	.538
	CT	10 (43.48)	27 (34.18)
	CC	3 (13.04)	15 (18.99)

Abbreviations: CRS, chronic rhinosinusitis; MAST, multiple allergosorbent test; SNP, single-nucleotide polymorphism.

Discussion

Previous studies have primarily focused on the relationship between CRS and adaptive immunity. However, recent studies have suggested an association between innate immunity and CRS.

Dong et al⁷ reported that TLR2 and TLR4 mRNAs are expressed in nasal epithelial cells and that their levels of expression are significantly higher in patients with CRS than in control subjects. Wang et al⁸ reported that the innate immune response (especially TLR3) mediated strong proinflammatory effects in primary nasal polyp epithelial cells and suggested that it contributed to the exaggeration of CRS and nasal polyps during viral infection.

There have been many studies for the associations between SNPs and susceptibility to certain diseases and also between SNPs in components of innate immunity and susceptibility to certain diseases. Some of these studies indicated that SNPs in genes encoding certain components of the innate immune system are related to certain disease traits.

For example, the Asp299Gly and Thr399Ile polymorphisms of TLR4 and the Arg753Gln and Arg677Trp polymorphisms of TLR2 are associated with many pathological states, including asthma,⁹ lepromatous leprosy,¹⁰ tuberculosis,¹¹ and preterm birth.¹² Moreover, the levels of induction of IL-10 and IL-12 expression after stimulation are reduced in leprosy patients with the Arg753Gln and Arg677Trp polymorphisms of TLR2,¹³ suggesting that certain SNPs affect susceptibility to infection.

Susceptibility to certain diseases may be explained by hygiene theory, which suggests that if there are insufficient stimuli to boost Th1-mediated responses, the balance between Th1- and Th2-mediated responses is disrupted and shifted toward Th2-mediated responses, leading to an increase in the prevalence of Th2-mediated diseases.^14,15

The effect of environment on susceptibility to certain diseases is another important aspect that should be considered along with genetic components. Vercelli¹⁶ reported that genes and the environment are intertwined in complex nonlinear relationships, such that the same genetic background may result in the expression of different phenotypes in different environments. Thus, the frequencies of SNPs may be affected differently by factors such as race, geographical location, and lifestyle. For example, some SNPs that are prevalent in Caucasians are very rare in the Korean population.^17-19 However, the reverse is also possible. Tewfik et al²⁰ reported no significant association with CRS could be detected in 11 of 12 TLR2 SNPs, which did not support a role of TLR2 SNPs in the pathogenesis of CRS. Three of their 11 genotyped SNPs were the same as those genotyped in the present study.²⁰ However, although they reported that they had gathered information regarding ethnicity, the ethnic composition of their study population in Canada was not clearly described in their article. Thus, differences in ethnic composition between their study population and ours may have been responsible for the differences in the results.

Another study of a TLR2 SNP (753Q) performed in Germany indicated that although the detection rate of S aureus was increased in nasal polyp specimens compared with turbinate mucosa from controls, this SNP was not related to nasal polyp pathology, which was similar to our findings.²¹ However, these 2 studies should be considered separately from this study due to the differences in ethnicity of the subjects.

The findings of the present study suggest that 2 of the 5 TLR2 SNPs examined may affect susceptibility to bacterial infection, which could lead to the development of CRS in Asian patients, especially in Koreans. However, when some pediatric patients were included (n = 15 in the CRS group, n = 15 in the control group), these results yielded different outcomes (data not shown); the MAFs of 2 SNP (rs3804099, rs3804100) did not show significant differences after adjustment for age and gender (P < .088 and .053, respectively). Thus, further studies including larger numbers of pediatric subjects are necessary.

Authors acknowledge that this study had some limitations. First, the CRS group may have been heterogeneous (eg, the presence or absence of nasal polyps, pathology of CRS or nasal polyps). Second, pediatric subjects were excluded from this study because the pathogenesis of CRS may be different between children and adults. Third, the statistical power of this study was low due to the small study population size and MAFs of genotyped SNPs <0.1. Thus, further evaluations with more detailed stratification of the CRS group, including pediatric subjects, and with larger numbers of subjects are needed.

Conclusions

Our results suggested that 2 SNPs in TLR2 may be associated with genetic susceptibility to CRS in Korean patients, especially in adults.

Author Contributions

Chan-Soon Park, initial conception, study design, analysis, data collection, writing, revision, and approval; Jin-Hee Cho, data collection; Yong-Jin Park, final approval.

Disclosures

Sponsorships: None.

Funding source: Emeritus Professor Hee-Rho Yoon, the Catholic University of Korea, St Vincent’s Hospital, Suwon, Korea.

References

Cummings

Flint

Harker

. Cummings Otolaryngology: Head and Neck Surgery. 4th ed. Philadelphia, PA: Elsevier Mosby; 2004.

Turvey

Hawn

. Toward subtlety: understanding the role of toll-like receptor signaling in susceptibility to human infections. Clin Immunol. 2006;120:1-9.

Weber

Moreillon

Tuomanen

. Innate sensors for gram-positive bacteria. Curr Opin Immunol. 2003;15:408-415.

Rosenfeld

Andes

Bhattacharyya

. Clinical practice guideline: adult sinusitis. Otolaryngol Head Neck Surg. 2007;137(suppl):S1-S31.

Gabriel

Schaffner

Nguyen

. The structure of haplotype blocks in the human genome. Science. 2002;296:2225-2229.

Barrett

Fry

Maller

Daly

. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21:263-265.

Dong

Yang

Wang

. Expression of TLR2 and TLR4 messenger RNA in the epithelial cells of the nasal airway. Am J Rhinol. 2005;19:236-239.

Wang

Matsukura

Watanabe

. Involvement of toll-like receptors in the immune response of nasal polyp epithelial cells. Clin Immunol. 2007;124:345-352.

Eder

Klimecki

. Toll-like receptor 2 as a major gene for asthma in children of European farmers. J Allergy Clin Immunol. 2004;113:482-488.

10.

Kang

Chae

. Detection of Toll-like receptor 2 (TLR2) mutation in lepromatous leprosy patients. FEMS Immunol Med Microbiol. 2001;31:53-58.

11.

Ben-Ali

Barbouche

M-R

Bousnina

. Toll-like receptor 2 Arg677Trp polymorphism is associated with susceptibility to tuberculosis in Tunisian patients. Clin Diagn Lab Immunol. 2004;11:625-626.

12.

Krediet

Wiertsema

Vossers

. Toll-like receptor 2 polymorphism is associated with preterm birth. Pediatr Res. 2007;62:474-476.

13.

Kang

Yeum

Kim

. Differential production of interleukin-10 and interleukin-12 in mononuclear cells from leprosy patients with a Toll-like receptor 2 mutation. Immunology. 2004;112:674-680.

14.

Verceli

. Mechanisms of the hygiene hypothesis—molecular and otherwise. Curr Opin Immunol. 2006;18:733-737.

15.

Romagnani

. Coming back to a missing immune deviation as the main explanatory mechanism for the hygiene hypothesis. J Allergy Clin Immunol. 2007;119:1511-1513.

16.

Vercelli

. Genetics, epigenetics, and the environment: switching, buffering, releasing. J Allergy Clin Immunol. 2004;113:381-386.

17.

Kim

Hwang

Kim

. Rarity of TLR4 Asp299Gly and Thr399Ile polymorphisms in the Korean population. Yonsei Med J. 2008;49:59-62.

18.

Kim

Rahman

. Analysis of single nucleotide polymorphisms in toll-like receptor 4 show no association with ankylosing spondylitis in a Korean population. Rheumatol Int. 2008;28:627-630.

19.

Yoon

Choi

Kim

. Lack of toll-like receptor 4 and 2 polymorphisms in Korean patients with bacteremia. J Korean Med Sci. 2006;21:979-982.

20.

Tewfik

Bosse

Hudson

. Assessment of Toll-like receptor 2 gene polymorphisms in severe chronic rhinosinusitis. J Otolaryngol. 2008;37:552-558.

21.

Sachse

Becker

Rudack

. Incidence of staphylococcal colonization and of the 753Q Toll-like receptor 2 variant in nasal polyposis. Am J Rhinol Allergy. 2010;24(1):e10-e13.