Effect of hexavalent chromium-treated sperm on in vitro fertilization and embryo development

Abstract

Hexavalent chromium (Cr(VI)) is an environmental contaminant that is associated with reproductive abnormalities in both humans and animals. In the present study, we evaluated the cytotoxic effect of Cr(VI) on sperm function and subsequent embryo development after in vitro fertilization (IVF). Sperm obtained from BDF1 male mice were treated with potassium dichromate (0, 3.125, 6.25, 12.5, 25, or 50 μM) for 3 h. Cr(VI) significantly decreased sperm viability and acrosome reaction with increasing dose. These Cr(VI)-treated sperms were further used for IVF of oocytes obtained from BDF1 female mice. Results showed that Cr(VI)-treated sperm caused a significant reduction in IVF success, higher developmental arrest at the two-cell stage of embryos, and delayed blastocyst formation with increasing dose. In particular, most blastocysts from the Cr(VI)-treated sperm resulted in hatching failure as well as decreased inner cell mass and trophectoderm (TE). Furthermore, blastocysts obtained from Cr(VI)-treated sperm showed lower expression of not only TE-associated genes (eomes, cdx2, and krt8) but also pluripotent marker genes (sox2, pou5f1, and klf4) that are responsible for further embryo development of blastocyst embryos. The results of our current study showed that Cr(VI)-treated sperm had negative effects on oocyte fertilization and subsequent embryo development.

Keywords

Chromium acrosome reaction embryo development gene expression

Introduction

Chromium (Cr) is a naturally occurring element that is mostly found in rocks, volcanic dust and gases, soils, as well as in animals and plants. It is extensively used in pigment and stainless steel production; leather tannery; wood processing; welding; cement manufacturing; chrome plating, textile, ceramic, glass, and photography industries; catalytic converters for automobiles; and cooling plant (Stohs et al., 2001). However, improper disposal of these kinds of industrial waste creates severe environmental pollution. In addition to occupational exposure of workers (via inhalation and skin contact), people are also exposed to Cr when it contaminates ground and surface water, agricultural land, and aquatic life. Cr can exist in a variety of oxidative states ranging from −2 to +6, among which the trivalent (III) and hexavalent (VI) forms have biological importance (Stoecker, 2004). Hexavalent Cr (Cr(VI)) can readily cross cellular membranes via nonspecific anion transporters, whereas the trivalent form, Cr(III), is poorly transported across membranes. Therefore, Cr toxicity is mainly attributed to Cr(VI).

Cr(VI) has been reported to cause allergic dermatitis as well as cytotoxic, genotoxic, immunotoxic, and carcinogenic effects in both humans and laboratory animals (Li et al., 2011; Stohs et al., 2001). Moreover, Cr(VI) exposure has also been reported to induce reproductive toxicity in both humans and laboratory animals (Danadevi et al., 2003; Li et al., 2001; Subramanian et al., 2006). In welding industries and chromate factories, workers exposed to Cr suffer from increased risk of reduced semen quality and sperm abnormalities that ultimately lead to infertility (Danadevi et al., 2003; Kumar et al., 2005). Additionally, decreased sperm count and increased numbers of abnormal spermatozoa have been reported in Cr-treated/exposed mice, rats, rabbits, and bonnet monkeys (Acharya et al., 2006; Li et al., 2001; Subramanian et al., 2006; Yousef et al., 2006). Women working in Cr industries or living around Cr-contaminated areas, who have high levels of Cr in blood and urine, experience irregular menses and complications during pregnancy and childbirth (Greene et al., 2010; Shmitova, 1980; Zhang et al., 1992). In addition, toxic effects on embryos and fetuses in laboratory animals exposed to Cr(VI) have also been reported (Junaid et al., 1996; Marouani et al., 2011). However, only a limited number of extensive in vitro studies has evaluated the effects of Cr(VI) on sperm parameters and sperm-fertilizing ability during in vitro fertilization (IVF) of oocytes as well as subsequent development of embryos.

Therefore, the objectives of the present study were to (i) determine the cytotoxic effect of Cr(VI) on sperm obtained from mice, (ii) evaluate the effect of Cr(VI) on sperm capacitation, (iii) assess the effect of Cr(VI) on sperm-fertilizing ability during IVF of oocytes and embryo development, (iv) understand the role of Cr(VI) on cell proliferation in blastocysts, and (v) explore the effect of Cr(VI) on inner cell mass (ICM) and trophectoderm (TE) cell-specific gene expression in blastocysts.

Materials and methods

Materials

Potassium dichromate (K₂Cr₂O₇; molecular weight 294.18 g mol⁻¹) was purchased from Duksan Company (South Korea). Sodium chloride (NaCl), potassium chloride (KCl), monopotassium phosphate (KH₂PO₄), calcium chloride (CaCl₂), magnesium sulfate (MgSO₄), sodium bicarbonate (NaHCO₃), glucose, and bovine albumin serum (BSA) were purchased from Sigma Aldrich (St Louis, Missouri, USA).

Animals

Male BDF1 (8–12 weeks old) mice were housed in wire cages at 22 ± 1°C with 70% humidity under a 12-h light/12-h dark cycle. Mice had access to food and water ad libitum. All experiments were performed with approval from the Institutional Animal Care and Use Committee at Konkuk University (IACUC approval no. KU11035), Seoul, Korea.

Sperm preparation and treatments

The cauda of the epididymis of male BDF1 mice (8–12 weeks old) were cut and squeezed; the collected fluid was then suspended in 200 mL of modified Whitten’s medium (118.5 mM NaCl, 4.7 mM KCl, 1.18 mM KH₂PO₄, 2.54 mM CaCl₂, 1.18 mM MgSO₄, 24.9 mM NaHCO₃, 5.56 mM glucose, and 3 mg/mL BSA). Subsequently, the suspension was incubated at 37°C in a humidified atmosphere of 5% carbon dioxide (CO₂) for 30 min. The sperm suspension was placed in the bottom of a 5-mL snap tube containing 1 mL of modified Whitten’s medium and incubated at 37°C in 5% CO₂ for 30 min to allow live spermatozoa to swim up. The sperm suspension was collected from the top of the tube and centrifuged at 3000 r/min for 5 min. The pellets were resuspended in modified Whitten’s medium. K₂Cr₂O₇ was dissolved in deionized water to prepare 1 mM stock solution. Approximately 2 × 10⁵ sperms were treated with different concentrations of K₂Cr₂O₇ (0, 3.125, 6.25, 12.5, 25, or 50 μM) and incubated for 3 h at 37°C in a humidified atmosphere of 5% CO₂.

Live/dead sperm detection by fluorescence microscopy and flow cytometry

Sperm viability was assessed using a LIVE/DEAD Sperm Viability Kit (Molecular Probes, Inc., Eugene, Oregon, USA). Briefly, the samples were incubated with 100 nM of SYBR 14 dye at 37°C for 10 min in the dark and then incubated with 12 μM of propidium iodide (PI) for 5 min at 37°C. The stained sperms were placed on a microscope slide coated with 0.1% poly-d-lysine (Sigma Aldrich) and covered with a cover glass. The sperms that showed bright green fluorescence were considered alive, whereas sperms that fluoresced red were considered dead. Sperm viability was calculated by the following formula: sperm viability = (number of live sperm × 100)/total sperm count. For flow cytometry analysis, 10,000 sperms per sample were analyzed for the log of their green fluorescence passing through a 525-nm band-pass filter (FL1) and red fluorescence passing through 575-nm band-pass filters (FL2). The generated data were then analyzed to determine the relative fluorescence of the FL1 and FL2 using the Coulter Histogram Analysis program (Coulter Corporation, Miami, Florida, USA).

Sperm acrosome reaction analysis by fluorescence microscopy and flow cytometry

The samples were centrifuged at 3000 r/min for 5 min, fixed with 2% paraformaldehyde for 10 min at room temperature, and then washed twice. Afterward, the samples were blocked with 1% BSA in phosphate-buffered saline (PBS) overnight, followed by washing with PBS. The pellet was resuspended in PBS and divided into two aliquots. The first aliquot was diluted 1:50 with fluorescein isothiocyanate –CD46 and incubated at 4°C for 30 min in the dark, followed by washing with PBS twice. Then the sample was incubated with 1:200 diluted secondary antibody for 30 min. After washing, sperms were placed on a microscope slide coated with 0.1% poly-d-lysine, covered with a cover glass, and then observed by a fluorescence microscope. The second aliquot samples were then analyzed by flow cytometry by taking the log of the green fluorescence passing through a 525-nm band-pass filter (FL1).

In vitro fertilization

Female BDF1 mice (6–8 weeks old) were superovulated by intraperitoneal injection of pregnant mare’s serum gonadotropin (10 units). After 48 h, they were injected by human chorionic gonadotropin (hCG; 10 units). Metaphase II oocytes with cumulus cells were collected from the oviductal ampulla after 12–14 h of hCG injection and then suspended in 50 μL of modified Whitten’s medium. Sperms from each Cr(VI) treatment were washed twice by centrifugation at 3000 r/min for 5 min. Then, sperm pellets were resuspended in 50 μL of modified Whitten’s medium and mixed with 50 μL of the above drop of modified Whitten’s medium containing the oocytes. The sperm and oocytes were then co-incubated for 6 h at 37°C in a humidified atmosphere of 5% CO₂. Subsequently, embryos were washed and cultured in vitro (IVC) in potassium simplex optimization medium (KSOM; Millipore, Rockville, Maryland, USA) for 96 h. IVF rate and embryo development were checked by light microscopic analysis.

ICM and TE cell analysis

After 96 h IVC, the blastocysts were collected and washed twice with PBS containing 1% BSA. The blastocysts were then fixed in 4% paraformaldehyde for 40 min at room temperature. Subsequently, embryos were washed twice and incubated with 1% BSA and 0.1% Triton-X 100 in PBS overnight at 4°C. The embryos were again washed twice (15 min each time) and incubated with mouse anti-CDX2 (1:50) and rabbit anti-OCT4 (1:100) antibodies for 1 h at room temperature. After incubation with primary antibody, embryos were washed three times (15 min each time). Then, embryos were incubated with secondary antibody (1:200) in the dark for 1 h at room temperature. After incubation, embryos were washed three times, mounted on slides, and observed with a fluorescent microscope. Immunostaining with anti-OCT4 and anti-CDX2 antibodies in blastocysts was performed to determine the amount of ICM and TE cells, respectively.

Gene expression analysis

Fifteen blastocysts per treatment were collected 96 h after fertilization and kept at −80°C. For total messenger RNA (mRNA) extraction, the mRNA from collected blastocysts was exacted by freezing in liquid nitrogen and thawing in 37°C water five times. Complementary DNA was synthesized by reverse transcription kit (Roche, Mannheim, Germany) in a final volume of 20 μL according to the manufacturer’s instructions. The quantification of all gene transcripts (sox2, pou5f1, klf4, eomes, cdx2, and krt8) was approved in three replicates by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) on a Lightcycler using Lightcycler®FastStart DNA Master SYBR Green I via an Applied Biosystems machine (Waltham, Massachusetts, USA). The primer sequences for each gene are shown in Table 1. The relative quantification of gene expression was analyzed by the 2-ddCt method. In all experiments, glyceraldehyde 3-phosphate dehydrogenase mRNA was used as an internal standard.

Table 1.

Primer sets used for real-time qRT-PCR.

Primer name	Primer sequence	Annealing	Size (bp)
GAPDH	F: AGGTCGGTGTGAACGGATTTG	57°C	123
GAPDH	R: TGTAGACCATGTAGTTGAGGTCA	57°C	123
Pou5f1	F:CTCCCTACAGCAGATCACTCACA	63°C	220
Pou5f1	R: AACCATACTCGAACCACATCCT	63°C	220
Sox2	F: CACAACTCGGAGATCAGCAA	60°C	190
Sox2	R: CTCCGGGAAGCGTGTACTTA	60°C	190
Klf4	F: CTGAACAGCAGGGACTGTCA	58°C	218
Klf4	R: GTGTGGGTGGCTGTTCTTTT	58°C	218
Cdx2	F: AGACAAATACCGGGTGGTGTA	60°C	153
Cdx2	R: CCAGCTCACTTTTCCTCCTGA	60°C	153
Eomes	F:GAGCTTCAACATAAACGGACTCAA	60°C	210
Eomes	R: CGGCCAGAACCACTTCCA	60°C	210
Krt8	F: ATCGAGATCACCACCTACCG	63°C	151
Krt8	R: TGAAGCCAGGGCTAGTGAGT	63°C	151

qRT-PCR: quantitative reverse transcription polymerase chain reaction; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.

Statistical analysis

Each experiment was performed at least three times and was subjected to statistical analysis. For statistical analysis, one-way analysis of variance was performed to determine whether there were differences within the groups (p < 0.01) and Dunnett’s t-test was performed to determine significance between treatment and control groups. A p value was considered significant as shown in Figures 1 to 3. Statistical tests were performed using StatView Version 5.0 (SAS Institute, Cary, North Carolina, USA).

Results

Cytotoxic effect of Cr(VI) on spermatozoa

To determine the cytotoxic effect of Cr(VI) on sperm, sperms were exposed to 0, 3.125, 6.25, 12.5, 25, or 50 μM Cr(VI) for 3 h. Figure 1(a) shows a fluorescence microscopic image of living (stained with SYBR-14), dead (stained with PI), and moribund (stained with both SYBR-14 and PI) sperms shown in green, red, and yellow fluorescence, respectively. The number of dead and live sperms was calculated by counting the red and green fluorescence, respectively. Flow cytometry analysis (Figure 1(b)) also showed that the percentage of dead sperms progressively increased compared with nontreated sperms when sperms were exposed to increasing concentrations of Cr(VI). These results (Figure 1(c)) showed that Cr(VI) exposure significantly (p < 0.001) increased the percentage of dead sperms and decreased the percentage of live sperms with increasing Cr(VI) concentration compared with nontreated sperm.

Impact of Cr(VI) exposure on sperm acrosome reaction

Sperm acrosome reaction was determined by evaluating the sperm’s ability to undergo the acrosome reaction via CD46 immunofluorescence staining and flow cytometry (Figure 2). Cr(VI) exposure decreased sperm acrosome reaction, as evidenced by decreased CD46 immunofluorescence intensity with increasing Cr(VI) concentrations (Figure 2(a)). Flow cytometry analysis also indicated that Cr(VI) significantly reduced the percentage of acrosome-reacted (CD46-positive) spermatozoa in groups treated with 12.5 μM or more of Cr(VI) compared with the nontreated group (Figure 2(b) and (c)).

Effect of Cr(VI) exposure on sperm function and embryo development

To understand the effect of Cr(VI) exposure on sperm function and embryo development, sperms were treated with various concentrations of Cr(VI) (0, 3.125, 6.25, 12.5, 25, or 50 μM) for 3 h before IVF, and the results at 96 h after IVC are shown in Table 2. These results demonstrate that the percentage of unfertilized oocytes in the Cr(VI)-treated sperm groups significantly (p < 0.01) increased with increasing dose of Cr(VI) (26.4%, 32.0%, 36.0%, 50.4%, and 57.6%, respectively) compared with the nontreated group (19.2%). Interestingly, the percentage in the two-cell stage of the Cr(VI)-treated sperm was significantly (p < 0.01) higher (25.6%, 25.6%, 29.6%, 29.6%, and 34.4%, respectively) compared with the nontreated sperm (9.3%). Importantly, embryos derived from Cr(VI)-treated sperms were lately developed to expanded blastocyst stage and hatching blastocyst stage. In this study, the results showed that Cr(VI) treatment reduced sperm-fertilizing ability and had a negative effect on embryo development up to the blastocyst stage with increasing Cr(VI) dose.

Table 2.

Developmental competence of mouse oocytes 96 h after IVF.^a

Treatment	No. IVF	No. Unfertilized (%, ±SE)	No. embryos development to (%, ±SE)
Treatment	No. IVF	No. Unfertilized (%, ±SE)	2C	4C	8C	Mo	Early BL	Expanded BL	Hatching BL	Total BL
0 μM K₂Cr₂O₇	125	24	12	2	0	2	6	53	26	85
0 μM K₂Cr₂O₇	125	(19.2 ± 2.7)^b	(9.3 ± 1.3)^c	(1.6 ± 1.1)	(0.0 ± 0.0)	(4.8 ± 2.7)	(4.8 ± 2.7)	(42.4 ± 5.0)^d	(20.8 ± 4.8)^d	(68.0 ± 4.4)^d
3.125 μM K₂Cr₂O₇	125	33	32	3	2	3	7	36	9	45
3.125 μM K₂Cr₂O₇	125	(26.4 ± 3.6)^b,c	(25.6 ± 6.4)^d	(2.4 ± 1.0)	(1.6 ± 0.9)	(2.4 ± 1.6)	(5.6 ± 2.7)	(28.8 ± 5.5)^c	(7.2 ± 2.5)^c	(36.0 ± 6.2)^c
6.25 μM K₂Cr₂O₇	125	40	32	3	1	10	10	26	3	29
6.25 μM K₂Cr₂O₇	125	(32.0 ± 1.9)^c	(25.6 ± 4.3)^d	(2.4 ± 1.7)	(0.8 ± 0.8)	(8.0 ± 2.4)	(8.0 ± 3.5)	(20.8 ± 5.5)^b,c	(2.4 ± 1.0)^b,c	(23.2 ± 5.5)^b,c
12.5 μM K₂Cr₂O₇	125	45	37	2	2	15	11	13	0	13
12.5 μM K₂Cr₂O₇	125	(36.0 ± 3.8)^c	(29.6 ± 4.9)^d	(1.6 ± 1.1)	(1.6 ± 1.1)	(12.0 ± 4.2)	(8.8 ± 5.5)	(10.4 ± 5.4)^b,e	(0.0 ± 0.0)^b	(10.4 ± 5.9)^b,e
25 μM K₂Cr₂O₇	125	63	37	3	3	11	6	2	0	8
25 μM K₂Cr₂O₇	125	(50.4 ± 6.0)^d	(29.6 ± 4.4)^d	(2.4 ± 1.0)	(2.4 ± 1.4)	(8.8 ± 5.4)	(4.8 ± 4.8)	(1.6 ± 1.1)^e	(0.0 ± 0.0)^b	(6.4 ± 4.5)^e,f
50 μM K₂Cr₂O₇	125	72	43	0	0	7	2	1	0	3
50 μM K₂Cr₂O₇	125	(57.6 ± 5.0)^d	(34.4 ± 4.3)^d	(0.0 ± 0.0)	(0.0 ± 0.0)	(5.6 ± 4.1)	(1.6 ± 1.1)	(0.8 ± 0.6)^e	(0.0 ± 0.0)^b	(2.4 ± 1.5)^d

Mo: morula; BL: blastocysts; IVF: in vitro fertilization; 2C: 2 cell; 4C: 4 cell; 8C: 8 cell; ANOVA: analysis of variance; K₂Cr₂O₇: potassium dichromate; SE: standard error.

^aDifferent superscripts denote significant differences (ANOVA: Duncan’s multiple range test, p < 0.01).

Effect of Cr(VI)-exposed sperm on cell proliferation in blastocysts

To further determine the effects of Cr(VI)-exposed sperm on proliferation of embryos, differential staining, followed by cell counting was performed to assess cell proliferation in blastocysts, at 96 h after IVC. Immunostaining with anti-oct4 and anti-cdx2 antibodies was performed in blastocysts to determine ICM (red) and TE (green) cells, respectively (Figure 3(a)). The results showed that Cr(VI)-exposed sperms were able to block the proliferation of cells in the blastocyst stage of embryos compared with nontreated sperm (Table 3). Blastocysts derived from 6.25, 12.5, and 25 μM of Cr(VI)-exposed sperm groups caused a significant (p < 0.01) reduction of both ICM and TE cell proliferation compared with nontreated sperm (Table 3). In addition, a significant reduction in total number of cells was observed in Cr(VI)-exposed groups compared with the nontreated group. However, in 50 μM Cr(VI) treatment group, we did not get sufficient number of blastocysts (as shown in Table 2) to count the ICM and CE cells.

Table 3.

TE and ICM cell counts in blastocysts at 96 h after IVC via oct4 and cdx2 expression analysis.^a

Treatment	No. of blastocysts	No. of total cells (mean ± SE)	No. of TE cells (mean ± SE)	No. of ICM cells (mean ± SE)
0 μM K₂Cr₂O₇	15	87.9 ± 3.0^b	68.5 ± 2.6^b	19.4 ± 2.4^b
3.125 μM K₂Cr₂O₇	15	78.7 ± 3.1^b	62.1 ± 3.2^b,c	16.5 ± 2.4^b,c
6.25 μM K₂Cr₂O₇	15	68.3 ± 3.2^c	53.8 ± 2.9^c,d	14.5 ± 3.1^c,d
12.5 μM K₂Cr₂O₇	14	63.3 ± 2.2^c	49.9 ± 2.0^d,e	13.4 ± 3.6^d
25 μM K₂Cr₂O₇	10	49.4 ± 2.9^c	38.4 ± 2.7^d	11.0 ± 2.5^d

TE: trophectoderm; ICM: inner cell mass; IVC: in vitro culture; ANOVA: analysis of variance; K₂Cr₂O₇: potassium dichromate; SE: standard error of mean.

^aDifferent superscripts denote significant differences (ANOVA: Duncan’s multiple range test, p < 0.01).

Effect of Cr(VI)-exposed sperm on ICM- and TE-specific gene expression

In this study, the effects of Cr(VI)-exposed sperm on TE/ICM-specific gene expression in blastocysts were examined by qRT-PCR as shown in Figure 3(b). The pluripotent marker genes (sox2, pou5f1, and klf4) in blastocysts from Cr(VI)-exposed sperms showed significant downregulation with increasing Cr(VI) dose. Additionally, TE-associated genes, such as Cdx2, showed significant downregulation in both 12.5 and 25 μM Cr(VI)-exposed groups. Other TE-associated genes, such as eomes and krt8, only showed significant downregulation in the 25 μM Cr(VI)-exposed group. However, in 50 μM Cr(VI) treatment group, we did not get sufficient number of blastocysts (as shown in Table 2) to measure the ICM- and TE-specific gene expression. Thus, our study clearly demonstrated that Cr(VI) not only decreased the expression of pluripotent genes but also that of TE-associated genes with high doses of Cr(VI) exposure.

Discussion

This study was undertaken to determine in vitro cytotoxic effects of Cr(VI) on sperm viability and function, sperm-fertilizing ability during IVF of oocytes, and subsequent embryo development. To achieve this, sperms obtained from male BDF1 (8–12 weeks old) mice were treated with Cr(VI) at doses of 3.125, 6.25, 12.5, 25, or 50 μM for 3 h, and the treated sperms were then co-incubated with oocytes obtained from female BDF1 mice (6–8 weeks old) for 6 h, followed by embryo IVC for 96 h.

Our results showed that Cr(VI) exposure significantly decreased the percentage of live sperms and sperm viability with increasing dose, thereby confirming its cytotoxic effects. These results are also supported by previous reports in which authors have shown that occupational exposure to Cr(VI) led to reduction in sperm count in workers (Li et al., 2001). Additionally, K₂Cr₂O₇ exposure also significantly reduced the epididymal sperm count in laboratory animals (Chandra et al., 2007; Marouani et al., 2012).

After mammalian sperms are removed from the epididymis, they undergo several essential physiological changes to be able to fertilize an oocyte, and this process is called capacitation. Capacitation helps the sperm to gain the ability to (i) develop hyperactivated motility, (ii) bind to the zona pellucida (ZP), (iii) undergo the acrosome reaction, and (iv) fuse with the oolemma and fertilize the egg (Rahman et al., 2014a, 2014b; Rodriguez et al., 2005). Capacitation can be inferred by the sperm’s ability to undergo the acrosome reaction, and the detection of membrane cofactor protein (CD46) is a reliable marker of acrosome-reacted spermatozoa (Clift et al., 2009; Johnson et al., 2007). Our results showed that Cr(VI) exposure significantly decreased sperm acrosome reaction (CD46-negative) with increasing dose, thereby demonstrating its negative impact on fertility.

In IVF, sperm must bind to the ZP, undergo the acrosome reaction, penetrate the ZP, and then fuse with the oolemma. Therefore, the fertilization rate is correlated with the number of sperms bound to the ZP. Among the several aspects of sperm that facilitate the sperm–ZP interaction, normal sperm morphology, increased sperm concentration, motility, and viability are most important (Park et al., 2012; Rahman et al., 2013; Suarez, 2008). It has been reported that K₂Cr₂O₇ exposure significantly decreased the epididymal sperm count/viability and motility as well as increased sperm abnormality in laboratory animals (Chandra et al., 2007; Devi et al., 2012; Marouani et al., 2012). In the present study, we evaluated the IVF rate and blastocyst development of oocytes fertilized by Cr(VI)-treated sperm after IVC. We observed that Cr(VI) treatment of sperm had a negative effect on oocyte fertilization and subsequent embryo development, as evidenced by the increased two-cell population as well as late development to expanded blastocyst and hatching blastocyst stages with increasing Cr(VI) concentrations.

The TE cells arising from the trophoblast at the blastocyst stage develops a sphere of epithelial cells surrounding the ICM and blastocoel. These TE cells are required for the development of the embryonic portion of the placenta and mammalian conceptus (Cross, 2005; Kunath et al., 2004). Moreover, the ICM is a group of pluripotent cells that gives rise to the embryonic tissue that comprises the ectoderm, endoderm, and mesoderm (Marikawa and Alarcon, 2009). Our results showed that Cr(VI)-exposed sperm not only significantly inhibited the ICM/TE cell proliferation in blastocysts but also downregulated the ICM/TE-associated genes, which play crucial roles in ICM and TE cell formation, reflecting a negative effect on embryo development.

From our results, we suspect that Cr(VI) affects embryo implantation. In particular, most of the blastocysts that were formed with Cr(VI)-treated sperm resulted in hatching failure as well as decreased ICM and TE development. Lundin et al. (2001) and Bos-Mikich et al. (2001) suggested that a high number of early cleaving embryos become good quality embryos and significantly facilitate high pregnancy, implantation, and birth rates. Several studies have previously administered Cr(VI) to rats and mice via drinking water and found effects on the placental and fetal development, leading to implantation failure (Elsaieed and Nada, 2002; Junaid et al., 1995, 1996; Kanojia et al., 1998).

Cr(VI)-induced oxidative stress has been established to be a major factor that leads to male infertility (Acharya et al., 2004; Aruldhas et al., 2005; Chandra et al., 2007). Under physiological conditions, after entering into the cell, Cr(VI) is reduced by hydrogen peroxide, glutathione (GSH) reductase, ascorbic acid, and GSH to produce reactive intermediates, including Cr(V), Cr(IV), reactive oxygen species, and ultimately Cr(III). Any of these species can attack intracellular macromolecules, including DNA, proteins, and membrane lipids, thereby disrupting cellular integrity and inducing toxic as well as mutagenic effects (Mattia et al., 2004).

In conclusion, Cr(VI) is a potential cytotoxic agent for sperm and exerts adverse effects, possibly through the induction of oxidative stress and DNA damage. Furthermore, Cr(VI)-treated sperm reduces the IVF success rate, delays subsequent blastocyst formation, and downregulates the genes responsible for embryo development. Our current in vitro study will provide further mechanistic insights into the effects of Cr(VI) on mammalian sperm function.

Footnotes

Acknowledgments

The authors thank Dasom Kim and Min-Hee Kang for their technical assistance.

Authors’ note

TY and JD contributed equally to this work.

Conflict of interest

The authors declared no conflicts of interest.

Funding

TY and RP were supported by the Royal Golden Jubilee (RGJ) PhD program of Thailand Research Fund. This work was supported by Woo Jang-Choon Project (PJ007849) from the Rural Development Administration (RDA), Republic of Korea.

References

Acharya

Mishra

. (2004) Potential role of vitamins in chromium induced spermatogenesis in Swiss mice. Environmental Toxicology and Pharmacology 15(2–3): 53–59.

Acharya

Mishra

Tripathy

. (2006) Testicular dysfunction and antioxidative defense system of Swiss mice after chromic acid exposure. Reproductive Toxicology 22(1): 87–91.

Aruldhas

Subramanian

Sekar

. (2005) Chronic chromium exposure induced changes in testicular histoarchitecture are associated with oxidative stress: study in a non-human primate (Macaca radiata Geoffroy). Human Reproduction 20(10): 2801–2813.

Bos-Mikich

Mattos

Ferrari

(2001) Early cleavage of Human embryos: an effective method for predicting successful IVF/ICSI outcome. Human Reproduction 16(12): 2658–2661.

Chandra

Chatterjee

Ghosha

. (2007) Effect of curcumin on chromium-induced oxidative damage in male reproductive system. Environmental Toxicology and Pharmacology 24(2): 160–166.

Clift

Andrlikova

Frolikova

. (2009) Absence of spermatozoal CD46 protein expression and associated rapid acrosome reaction rate in striped field mice (Apodemus agrarius). Reproductive Biology and Endocrinology 16(7): 29.

Cross

(2005) How to make placenta: mechanisms of trophoblast cell differentiation in mice–a review. Placenta 26: 3–9.

Danadevi

Rozati

Reddy

. (2003) Semen quality of Indian welders occupationally exposed to nickel and chromium. Reproductive Toxicology 17(4): 451–456.

Devi

Mosheraju

Reddy

(2012) Curcumin prevents chromium induced sperm characteristics in mice. IOSR Journal of Pharmacy 2(2): 312–316.

10.

Elsaieed

Nada

(2002) Teratogenicity of hexavalent chromium in rats and the beneficial role of ginseng. Bulletin of Environmental Contamination and Toxicology 68(3): 361–368.

11.

Greene

Riederer

Marcus

. (2010) Associations of fertility and pregnancy outcomes with leather tannery work in Mongolia: a pilot study. International Journal of Occupational and Environmental Health 16(1): 60–68.

12.

Johnson

Clift

Andrlikova

. (2007) Rapid sperm acrosome reaction in the absence of acrosomal CD46 expression in promiscuous field mice (Apodemus). Reproduction 134(6): 739–747.

13.

Junaid

Murthy

Saxena

(1995) Chromium fetotoxicity in mice during late pregnancy. Veterinary and Human Toxicolology 37(4): 320–323.

14.

Junaid

Murthy

Saxena

(1996) Embryo-toxicity of orally administered chromium in mice: exposure during the period of organogenesis. Toxicology Letters 84(3): 143–148.

15.

Kanojia

Junaid

Murthy

(1998) Embryo and fetotoxicity of hexavalent chromium: a long-term study. Toxicology Letters 95(3): 165–172.

16.

Kumar

Sathwara

Gautam

. (2005) Semen quality of industrial workers occupationally exposed to chromium. Journal of Occupational Health 47(5): 424–430.

17.

Kunath

Strumpf

Rossant

(2004) Early trophoblast determination and stem cell maintenance in the mouse–a review. Placenta 25: 32–38.

18.

Randak

(2011) Evaluating the toxicity of environmental concentrations of waterborne chromium(VI) to a model teleost, Oncorhynchus mykiss: a comparative study of in vivo and in vitro. Comparative Biochemistry and Physiology. Toxicology and Pharmacology 153(4): 402–407.

19.

Chen

. (2001) Effect of Cr(VI) exposure on sperm quality: human and animal studies. The Annals of Occupational Hygiene 45(7): 505–511.

20.

Lundin

Bergh

Hardason

(2001) Early embryo cleavage is strong indicator of embryo quality in human IVF. Human Reproduction 16(12): 2652–2657.

21.

Marikawa

Alarcon

(2009) Establishment of trophectoderm and inner cell mass lineages in the mouse embryo. Molecular Reproduction and Development 76(11): 1019–1032.

22.

Marouani

Tebourbi

Mahjoub

. (2012) Effects of hexavalent chromium on reproductive functions of male adult rats. Reproductive Biology 12(2): 119–133.

23.

Marouani

Tebourbi

Mokni

. (2011) Embryotoxicity and fetotoxicity following intraperitoneal administrations of hexavalent chromium to pregnant rats. Zygote 19(3): 229–235.

24.

Mattia

Bravi

Laurenti

. (2004) Impairment of cell and plasma redox state in subjects professionally exposed to chromium. American Journal of Industrial Medicine 46(2): 120–125.

25.

Park

Kwon

. (2012) Fertility-related proteomic profiling bull spermatozoa separated by percoll. Journal of Proteome Research 11(8): 4162–4168.

26.

Rahman

Kwon

Pang

(2014a) Calcium influx and male fertility in the context of the sperm proteome: an update. Biomed Research International 2014: 841615.

27.

Rahman

Kwon

Lee

. (2014b) Sodium nitroprusside suppresses male fertility in vitro. Andrology 2(6): 899–909.

28.

Rahman

Lee

Kwon

. (2013) Sperm proteomics: road to male fertility and contraception. International Journal of Endocrinology 2013: 360986.

29.

Rodriguez

O’Flaherty

Beconi

. (2005) Nitric oxide induces acrosome reaction in cryopreserved bovine spermatozoa. Andrologia 37(5): 166–172.

30.

Shmitova

(1980) Content of hexavalent chromium in the biological substrates of pregnant women and women in the immediate postnatal period engaged in the manufacture of chromium compounds. Gigiene Truda i Professional’nye Zabolevaniia (2): 32–35.

31.

Stohs

Bagchi

Hassoun

. (2001) Oxidative mechanism in the toxicity of chromium and cadmium ions. Journal of Environmental Pathology, Toxicology and Oncology 20(2): 77–88.

32.

Stoecker

(2004) Chromium. In: Merian

Anke

Ihnat

Stoeppler

(eds) Elements and their Compounds in the Environment. 2nd ed. Weinheim, Germany: Wiley-Vch Verlag GmbH & Co, pp. 709–729.

33.

Suarez

(2008) Control of hyperactivation in sperm. Human Reproduction Update 14(6): 647–657.

34.

Subramanian

Rajendiran

Sekhar

(2006) Reproductive toxicity of chromium in adult bonnet monkeys (Macaca radiata Geoffrey). Reversible oxidative stress in the semen. Toxicology and Applied Pharmacology 215(3): 237–249.

35.

Yousef

El-Demerdash

Kamil

. (2006) Ameliorating effect of folic acid on chromium(VI)-induced changes in reproductive performance and seminal plasma biochemistry in male rabbits. Reproductive Toxicology 21(3): 322–328.

36.

Zhang

Cai

Lee

(1992) Occupational hazards and pregnancy outcomes. American Journal of Industrial Medicine 21(3): 397–408.