IP3R and RyR channels are involved in traffic-related PM 2.5 -induced disorders of calcium homeostasis

Introduction

Fine particulate matter (PM_2.5) refers to a mixture of solid and liquid atmospheric particles with an aerodynamic diameter less than or equal to 2.5 µm (Falcon-Rodriguez et al., 2016). As is well known, PM_2.5 can deposit in the lower respiratory tract and reach pulmonary alveoli because of its ability to penetrate upper airways of the human respiratory tract (Araujo and Nel, 2009). PM_2.5 is mainly emitted from anthropogenic activities such as fossil fuel burning, motor vehicles, and municipal construction. As China’s urbanization progresses, traffic sources PM_2.5 gradually surpasses coal-fired sources as the main source of atmospheric PM_2.5 in some metropolitan areas. It is well known that PM_2.5 is composed of an inert carbonaceous core covered by multiple layers of chemicals such as sulfate, nitrate, organic chemicals (polycyclic aromatic hydrocarbons, PAHs), metals, and crustal elements (Cheng et al., 2015; Schwarze et al., 2006). Numerous studies have shown that PM_2.5 are closely related to respiratory and cardiovascular diseases (Xie et al., 2015), as well as cancer (Hamra et al., 2014) and immune function injury (Atkinson et al., 2015; Cesaroni et al., 2013).

Calcium (Ca²⁺) is an important second messenger that regulates various biological functions such as proliferation, differentiation, apoptosis, and other transcriptional programs in lymphocytes (Orrenius et al., 2003). The dynamic intracellular Ca^{2 +} concentration ([Ca²⁺]i) balance is the premise and basis for the normal structure and function of the cell. [Ca²⁺]i are changed by rapidly increasing the concentration of free Ca²⁺ by opening channels permeable to Ca²⁺ both in the surface of cell membranes and intracellular organelles containing high Ca²⁺ concentrations, namely the endoplasmic reticulum (ER) and sarcoplasmic reticulum (SR) (Reddish et al., 2017). Intracellular Ca²⁺ channels are located in ER and SR including inositol trisphosphate receptors (IP3 R) and ryanodine receptors (RyR), which can transport Ca²⁺ stored in the organelle to cytoplasm (Santulli and Marks, 2015). It was reported that traffic-related PM_2.5 can alter the conformation of Orai1 and activate the stored-operated Ca²⁺ channels on the cell membrane, thus increasing extracellular Ca²⁺ influx (Tong et al., 2015). A previous study has shown that diesel exhaust particles can evoke a protracted Ca²⁺ influx by activation of Ca²⁺ permeable transient receptor potential vanilloid family member 4 (TRPV4) ion channels in human airway epithelia (Li et al., 2011). Additionally, exposure to environmental pollutant (TOCP, DBP, chlorpyrifos, and endosulfan) also can interfere with Ca²⁺ homeostasis in cerebral cortex by activation of RyR or IP3 R Ca²⁺ channels or inhibition of the SERCA pump (Dusza et al., 2018). It may suggest that external pollutants can also disrupt intracellular Ca²⁺ homeostasis by affecting intracellular Ca²⁺ channels.

However, there have been few studies on whether traffic-related PM_2.5 can elevate [Ca²⁺]i by opening intracellular Ca²⁺ channels such as IP3 R and RyR on ER and SR. Therefore, this study was conducted to investigate whether IP3 R and RyRs are involved in traffic-related PM_2.5-mediated Ca²⁺ increase in Jurkat T cells and the possible mechanisms of PM_2.5-elicited [Ca²⁺]i overload.

Materials and methods

Quantitative real-time PCR analysis

Gene expression levels were measured using the real-time reverse transcription polymerase chain reaction assay. RNA was extracted using RNAiso Plus (Takara, China) according to the manufacturer’s recommendations. The cDNA was generated using 500 ng of total RNA from the Jurkat T cells with PrimeScript® RT Enzyme Mix I (TaKaRa) according to the manufacturer’s protocol. Real-time quantitative PCR (RT-qPCR) was performed with a Bio-Rad iQ5 Real-Time PCR system (Bio-Rad, USA) using a SYBR® Premix Ex Taq™ II kit (TaKaRa) in a reaction volume of 25 µL with 2 µL of template complementary DNA (cDNA). The Real-time PCR (RT-PCR) reaction mix was denatured at 95°C for 30 s and then subjected to 40 amplification cycles (30 s of denaturation at 95°C, 30 s of annealing at 60°C, and 20 s of extension at 72°C). The forward and reverse primers for CAM and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used in this study were designed with the OligoPerfect^TM Designers software (Invitrogen, Carlsbad, CA); the sequences and product sizes are presented in Table 1. GAPDH was used as a housekeeping gene to normalize the data. The ΔCt was calculated by subtracting the ΔCt of GAPDH from the ΔCt of CAM for each sample. The ΔΔCt was calculated by subtracting the ΔCt of the control sample from the ΔCt of each treated sample. Fold change was determined using the equation, 2^{− ΔΔCt}. All of the real-time PCR experiments were performed in triplicate and data were expressed as the mean of at least three independent experiments.

OPEN IN VIEWER

Table 1.

The sequences and product sizes of all genes.

Gene	5′ (forward) primer	3′ (reverse) primer	Size (bp)
CAM	TGCAGGATATGATCAATGAGGTG	GGCGCGCTGATGTAGCCATTC	59
GAPDH	GCACCGTCAAGGCTGAGAAC	TGGTGAAGACGCCAGTGGA	138

CAM: calmodulin.

Results

Cytosolic Ca²⁺ measurements

To investigate the [Ca²⁺]i changes in Jurkat T cells induced by PM_2.5, the active Jurkat T cells were stimulated by different concentrations of PM_2.5 for 3 h, the [Ca²⁺]i levels in 100 µg/mL of PM_2.5 exposure group increased, whereas the [Ca²⁺]i levels in 200 µg/mL of PM_2.5 group decreased. There was no significant difference for [Ca²⁺]i levels among different groups of the resting cells (Figure 1(a)). Thus we chose 100 µg/mL of PM_2.5 to determine the role of PM_2.5 in intracellular Ca²⁺ regulation. We pretreated resting and active Jurkat T cells with 100 µg/mL of PM_2.5 for 1 h, 3 h, 6 h, 12 h, and there was no significant difference for [Ca²⁺]i levels between saline control groups of the resting and active cells in difference hours, but both the resting and active group the [Ca²⁺]i levels in 100 µg/mL PM_2.5 group at the peak of 3 h, the [Ca²⁺]i levels gradually decreased in a time-dependent manner (p < 0.05). Moreover, regardless of the resting and active groups, the [Ca²⁺]i levels at different times of 100 µg/mL PM_2.5 groups except for the 12 h of active group were significantly increased compared with their own control groups (p < 0.05) (Figure 1(b) and (c)). This result shows that PM_2.5 induces an increase of [Ca²⁺]i in Jurkat T cells at 3 h. We noted that compared to the resting groups, the active groups show a more pronounced stimulation induced by PM_2.5, which indicates that under the inflammation stimulation PM_2.5 can cause stronger effect of [Ca²⁺]i elevation on lymphocyte.

OPEN IN VIEWER

Figure 1.

Effects of PM_2.5 on [Ca²⁺]i in Jurkat T cells. (a) [Ca²⁺]i was measured after the resting and active cells exposed to 50 µg/mL, 100 µg/mL, and 200 µg/mL PM_2.5 for 3 h. (b and c) [Ca2+]i was measured after the resting and active cells exposed to 100 µg/mL PM_2.5 for 1, 3, 6, 12 h. All data (mean ± SD) shown in this figure were the average of triplicates determinants. *Indicates statistically significant differences from their respective saline control group. ^#Indicates statistically significant differences from the respective 3 h 100 µg/mL PM_2.5 group (p < 0.05 by SNK test). PDB: phorbol 12,13-dibutyrate; [Ca²⁺]i: intracelluar Ca^{2 +} concentration; Ca^{2 +}: calcium.

Intracellular Ca²⁺-Mg²⁺-ATPase activity

To investigate whether PM_2.5 can influence the activity of intracellular Ca²⁺-Mg²⁺-ATPase, resting and active Jurkat T cells were stimulated by different concentrations of PM_2.5. Although Ca²⁺-Mg²⁺-ATPase in 100 µg/mL of PM_2.5 group obviously decreased, there was no significant statistical difference with the normal saline groups (Figure 2). This result suggestss that the PM_2.5 may decrease the expression of the Ca²⁺-Mg²⁺-ATPase activity that leads to the increase of the cell membrane permeability to Ca²⁺, which may induce the increase of [Ca²⁺]i in Jurkat T cells.

OPEN IN VIEWER

Figure 2.

The activity of Ca²⁺-Mg²⁺-ATPase in Jurkat T cells after treated with 50 µg/mL, 100 µg/mL, and 200 µg/mL PM_2.5 for 3 h. Results are shown as the alternation in the activity of Ca²⁺-Mg²⁺-ATPase for triplicate samples. Data are presented as mean ± SD. Ca^{2 +}: calcium.

Ca²⁺ signal regulation of IP3 R and RyR channels

We examined the role of the IP3 R and RyR channels in the PM_2.5-induced Ca²⁺ signal response. Firstly, Jurkat T cells were pretreated with various concentrations of heparin (40, 80, 100, 120 µg/mL) and PM_2.5 (100 µg/mL) for 3 h. In resting Jurkat T cells, heparin at the concentrations of 100 µg/mL and 120 µg/mL significantly inhibited PM_2.5-stimulated Ca²⁺ elevation and caused a decrease of [Ca²⁺]i, which has a significant difference compared with the PM_2.5 group. When it comes to activated Jurkat T cells, the [Ca²⁺]i in Jurkat T cells induced by both concentrations of heparin were significantly lesser than that in the PM_2.5 control group (p < 0.01). Therefore, we chose 120 µg/mL heparin as the inhibitor dose to further determine the role of IP3 R in Ca²⁺ signal regulation. Figure 3(a) shows that no remarkable change on [Ca²⁺]i level was observed between saline and heparin + saline group, which means heparin has no effect on the original state of [Ca²⁺]i. Regardless of resting and activated Jurkat T cells, the [Ca²⁺]i level in the 100 µg/mL PM_2.5 group was significantly greater than that in the saline group (p < 0.01). [Ca²⁺]i level in the heparin + PM_2.5 group was lower than that of the PM_2.5 group. This finding suggests that IP3 R regulates the Ca²⁺ response of Jurkat T cells to PM_2.5. What’s more, to test whether RyR are involved in PM_2.5-elicited Ca²⁺ elevation, we used procaine, an antagonist of RyR, to observe the effect of PM_2.5 on RyR channels. Resting and active Jurkat T cells were incubated with saline and various concentrations of procaine (1, 2, 4, 6, 10 mmol/L) with PM_2.5 (100 µg/mL) for 3 h. [Ca²⁺]i decreased with increasing dose of procaine, both in the resting groups and active groups, so we chose the moderate dose of 6 mmol/L to verify the role of RyR in Ca²⁺ signal regulation. As suggested in Figure 3(b), there was no significant difference between saline and procaine groups both in resting and active Jurkat T cells. Compared to the saline group, PM_2.5 was significantly potent in increasing the level of [Ca²⁺]i; however, the [Ca²⁺]i level in the procaine + PM_2.5 groups was less than that of the PM_2.5 group in either resting or active Jurkat T cells, and inhibition of RyR can effectively reduce the increase of [Ca²⁺]i induced by PM_2.5. Thus, blocking these two channels in resting and active Jurkat T cells can obviously decrease the [Ca²⁺]i level, and the higher the dose of those two channels inhibitors was, the less the level of [Ca²⁺]i was. It shows a negative correlation between the concentration of inhibitors and [Ca²⁺]i. Therefore, we can confirm that both IP3 R and RyR channels play an important role in [Ca²⁺]i regulation. Under the stimulation of PM_2.5, the Jurkat cells start the calcium-ON mechanism, which promotes the Ca²⁺ transport from the organelle to the cytoplasm through the IP3 R and RyR channels.

OPEN IN VIEWER

Figure 3.

Effects of heparin and procaine on [Ca2+]i in Jurkat T cells. (a) [Ca2+]i was measured after the resting and active cells exposed to 0 µg/mL or 100 µg/mL of PM2.5 with or without 120 µg/mL heparin for 3 h. (b) [Ca2+]i was measured after the resting and active cells exposed to 0 µg/mL or 100 µg/mL of PM_2.5 with or without 6 µg/mL procaine for 3 h. Data are presented as mean ± SD. *Indicates statistically significant differences from their respective saline control group. ^#Indicates statistically significant differences from their respective 100 µg/mL PM_2.5 group (p < 0.05). Ca^{2 +}: calcium.

The mRNA and protein expression of CAM in Jurkat T cells

The mRNA and protein expression of CAM in Jurkat T cells were detected with RT-PCR and Western blotting. Figure 4(a) shows that regardless of the resting or active Jurkat T cells, the mRNA expression of CAM was the least in the 100 µg/mL of PM_2.5 groups and there shown a significantly difference compared with the saline group (p < 0.05). Figure 4(b) and (c) shows that under the same exposure condition, protein expression of CAM gradually decreased with elevated PM_2.5 concentrations, which presented a dose-dependent relationship. Compared with the resting cells group, the effect of the active cells groups is more pronounced. Therefore, we speculate that PM_2.5 may reduce the expression of CAM at the gene level and interfere with translocation, and then affect the balance of [Ca²⁺]i homeostasis. Therefore, Ca²⁺ may lose the chance of binding to CAM, thus resulting in an increase of [Ca²⁺]i and eventually leading to Ca²⁺ overload.

OPEN IN VIEWER

Figure 4.

Effects of PM_2.5 on CAM expression in Jurkat T cells. (a) CAM mRNA expression was measured after the resting and active cells were exposed to 50 µg/mL, 100 µg/mL, and 200 µg/mL PM_2.5 for 3 h. (b and c) The expression of CAM protein in Jurkat T cells after 50 µg/mL, 100 µg/mL, and 200 µg/mL PM_2.5 exposure for 3 h. Data are presented as mean ± SD. *Indicates statistically significant differences from their respective saline control group (p < 0.05). CAM: calmodulin; PDB: phorbol 12,13-dibutyrate.

Discussion

In order to establish a model of active T lymphocytes for further investigating the effects of PM_2.5 on T lymphocytes under inflammatory stimuli activated state, we chose the phorbol 12,13-dibutyrate (PDB) and ionomycin (Ion) in our experiments with the purpose of simulating the activation of T lymphocytes. PDB belongs to protein kinase C (PKC) activators, is a nonphysiological diacylglycerol (DAG), and can pass through the cell membrane freely, thus simulating the DAG function and directly activating protein kinase signaling pathways (Sun et al., 2000). Ion is a calcium ionophore and can enable extracellular Ca²⁺ influx and intracellular Ca^{2 +} release from intracellular Ca²⁺ stores, leading to an increase of the [Ca²⁺]i (Morgan and Jacob, 1994). Studies have shown that only the Ca²⁺ ionophore, such as A23187 and ionomycin, cannot activate T lymphocytes (Truneh et al., 1985), whereas the PDB and Ion synergies can induce gene activation and proliferate responses; they will induce resting T cells to secrete IL-2 and IFN-γ to modulate their immune functions and proliferation status (Wang et al., 2015). The current study suggests that PM_2.5 tended to induce higher [Ca²⁺]i in T lymphocyte and exacerbate the Ca²⁺ homeostasis imbalance in the case of inflammatory condition. Our data show that, after 1 to 3 h exposure to PM_2.5, the [Ca²⁺]i increased, which is consistent with the previous study (Lin et al., 2006), but as time went on, the [Ca²⁺]i decreased at 6–12 h. Indeed, the investigator suggests that most of the Ca²⁺ released into the cytosol will be re-uptaken by the Ca²⁺ pump back into the ER and SR to maintain the Ca²⁺ concentration in it. Moreover, Ca²⁺-Mg²⁺-ATPase and Na⁺/Ca²⁺ pumps on the cell membrane further transport intracellular Ca²⁺ out of cells and reduce [Ca²⁺]i levels (Berridge et al., 2000).

It is reported that Ca²⁺-Mg²⁺-ATPase is a special protein that embeds in the cell membrane lipid bilayer (Takakuwa and Kanazawa, 1982). Its activity has a very close relationship with cellular energy metabolism and the physiological processes of signal transduction. Under normal circumstances, the [Ca²⁺]i is approximately 100 nmol/L, but the extracellular Ca²⁺ concentration is 10,000 times that of [Ca²⁺]i (Galione and Churchill, 2002). The main substance that maintains the low intracellular Ca²⁺ level is the Ca²⁺-Mg²⁺-ATPase. The primary role of Ca²⁺-Mg²⁺-ATPase is to pump Ca²⁺ out of the cell to maintain the Ca²⁺ homeostasis environment inside and outside the cell. We observed that exposure to 100 µg/mL of PM_2.5 caused Ca²⁺-Mg²⁺-ATPase activity to appear declining trend, which may explain the results that the [Ca²⁺]i was the highest in the 100 µg/mL PM_2.5 group. A relevant study described that the Ca²⁺-Mg²⁺-ATPase activity decreased with the elevated Pb⁺, Na⁺, and Ca²⁺ concentrations in the cells (Sun et al., 2007). Recent study shows that exposure to Al causes the decrease of Ca²⁺-Mg²⁺-ATPase activity, which leaving Ca²⁺-Mg²⁺-ATPase unable to keep up with the Ca²⁺ transport needs and further aggravating Ca²⁺ overload (Cao et al., 2018). Previous report also indicates that Ca²⁺ overload disrupts the structure and function of mitochondria, impedes cellular energy metabolism, and reduces ATP production (Zhu et al., 1995). Therefore, decreasing Ca²⁺-Mg²⁺-ATPase activity of cell membrane results in a decline of Ca²⁺ active outflow, and thus causes an increase of [Ca²⁺]i, which leads to a vicious circle that may give rise to cytotoxicity or apoptosis.

The IP3 R and RyR channels, which regulate intracellular Ca²⁺ signal release and many physiological functions, usually localize in intracellular Ca²⁺ stores such as ER, SR, mitochondria of the cells (Santulli et al., 2018). The distributions of these two receptors systems vary with tissues (Gambardella et al., 2018). Our finding shows that 120 µg/mL heparin can significantly inhibit elevated [Ca²⁺]i stimulated by the PM_2.5 both in resting and activated Jurkat T cells, indicating that IP3 R channels are involved in the regulation of Ca²⁺ levels stimulated by PM_2.5 in Jurkat T cells. In accord with our present findings, a recent study found that augmenters of liver regeneration inhibited IP3R-mediated Ca²⁺ release and thus maintained the cytosolic Ca²⁺ at a physiological level, protecting the cells from the apoptosis caused by ER stress (Xiao et al., 2018). Additionally, several studies have also shown that cytosolic-free Ca²⁺ concentrations can be increased by IP3-sensitive Ca²⁺ pools (Dusza et al., 2018; Santulli et al., 2017). Interestingly, our findings revealed that when resting and active Jurkat T cells were incubated with 6 µg/mL of procaine + saline, the [Ca²⁺]i level almost had no change. It indicates that the procaine blocker has no effect on Jurkat T cells normal [Ca²⁺]i. However, the [Ca²⁺]i elevating effect induced by PM_2.5 was prevented by pretreatment with procaine, and it may indicate that RyR may have been involved in Ca²⁺ signal responses elicited by PM_2.5. As reported earlier, the BaP metabolite, 7,8-benzo(a)pyrene quinone, can induce human B cell lines, human blood mononuclear cells, and mouse spleen lymphocytes to increase intracellular Ca²⁺ levels by the RyR-dependent pathway (Gao et al., 2005). According to the component analysis of PM_2.5 in this study affiliated in online supplemental material, there were 13 common PAHs detected in PM_2.5, and the mass of PAHs accounts for about 0.55% of particulates. Thus we consider that traffic-related PM_2.5 can induce disorders of [Ca²⁺]i homeostasis, and IP3 R and RyR channels play important roles in Ca²⁺ signal responses.

Calmodulin (CAM), a widely existing Ca²⁺ receptor and versatile regulatory protein in all eukaryotes, is the core of metabolic modulation of the second messenger Ca²⁺ (Gillespie and Hodge, 2013). The CAM and Ca²⁺ were combined to form Ca²⁺-CAM complexes, which ensures the accurate combination of CAM and target enzyme/protein so as to regulate their activities (Sanabria et al., 2008). As shown in our results, traffic-related PM_2.5 induced a decline of Jurkat T cells CAM expression, so that the Ca²⁺ signal cannot be fully passed on downstream protein molecules, which may cause toxic effects on cellular immune functions eventually. The ability of CAM regulation Ca²⁺ attenuated when the expression of CAM reduced. Meanwhile, increased [Ca²⁺]i could produce cytotoxic effects (Seales et al., 2006). It was reported that cadmium could increase free Ca²⁺ concentration in spleen lymphocytes of LACA mouse and reduce the expression of CAM (Xiao et al., 2008). Therefore, PM_2.5 may decrease the expression of CAM and reduce its ability to regulate Ca²⁺ and further disrupt the Ca²⁺ homeostasis.

In the current study, our results suggest that PM_2.5 can trigger [Ca²⁺]i increase adjusted by intracellular stores, and CAM and Ca²⁺-Mg²⁺-ATPase may have involved in Ca²⁺ signal regulation. Moreover, PM_2.5 appeared to have more approaches to alter the [Ca²⁺]i in T cells. Relative study has shown that PM can elicit the high [Ca²⁺]i through the channels on cytomembrane such as Orail1 in Jurkat T cells and TRPV4 in human respiratory epithelial cells (Li et al., 2011; Tong et al., 2015). Ca²⁺ is an important second messenger, it can promote critical signal transduction and functional events, such as oxidative stress (OS), apoptosis, inflammatory reaction, immune function, and other signal molecules. It was noted that soluble metals (e.g. Fe, Vi, Ni, and Zn) and PAHs absorbed in PM can contribute to the reactive oxygen species (ROS) generation (Al Hanai et al., 2019). For instance, alveolar macrophages could produce large amounts of ROS when exposed to PM_2.5. OS can damage biofilm Ca²⁺ channels in cytomembranes, ER/SR and Ca²⁺ pumps, then increasing Ca²⁺ influx and bring about lipid peroxidation of biofilms, which can impair cell membrane functions and change its permeability (Schmidt et al., 2004). Furthermore, OS can interfere with the cytokine secretion and eventually leads to immune system dysfunction (Clemens and Lowell, 2019). With higher [Ca²⁺]i levels than the physiological state in cells, Ca²⁺ can trigger further generation of ROS (Tiwari et al., 2017) and activate Nrf2, NF-κB, and MAPK pathways (Al Hanai et al., 2019) to regulate inflammatory responses. Simultaneously, the increased [Ca²⁺]i can activate caspase-3, trigger Fas ligand, and inhibit the gap junctional intercellular communication (Ji et al., 2018) to induce apoptosis. Further, oxygen stress also can trigger mitochondria-mediated apoptosis (Tiwari et al., 2017). Additionally, the increased [Ca²⁺]i can activate MMP-1 in vitro (Li et al., 2011) and CAN-NFAT signaling pathway in Jurkat T cells, upregulate the expression of TNF and IL-2, and regulate cellular immune function (Tong et al., 2015). Collectively, high levels of [Ca²⁺]i elicited by PM_2.5 can be immunotoxic to lymphocytes and affect the function and survival status of lymphocytes.

Because of the complexity of PM_2.5, in this study we only considered PM_2.5 as a whole with a preliminary discussion on its effect on Ca²⁺ signaling responses in T lymphocytes. Currently, more and more studies have begun to study the mechanisms of toxicity of PM_2.5 components from a microscopic perspective (Chen et al., 2018; Li et al., 2019; Zou et al., 2016). Thus further studies are needed to determine which components are involved in IP3 R and RyR channels opening. Additionally, we measured the Ca²⁺-Mg²⁺-ATPase activity using a visible light spectrophotometer. Although we have repeated trails, and limited to experimental conditions, the data are highly variable. Therefore, a stable measuring method is requires to assure the stability of data. Similarly, intracellular Ca²⁺ changes are very rapid, and we have only selected four time periods for research, which limits our study of the opening mechanisms of Ca²⁺ channels, whereas real-time Ca²⁺ response monitoring by flow cytometry can provide more Ca²⁺ regulation information. Hence, we suggest further advanced methods to investigate the Ca²⁺ signal regulation of specific component of PM_2.5.

In summary, our results revealed that traffic-related PM_2.5 can induce a disorder of Ca²⁺ homeostasis of Jurkat T cells. The intracellular IP3 R and RyR channels are involved in Ca²⁺ efflux from ER/SR, which results in increased [Ca²⁺]i, accompanied by reduced CAM expression, as well as possible decreased Ca²⁺-Mg²⁺-ATPase activity.

Supplemental material