Long non-coding RNA ENST00000414355 as a biomarker of cadmium exposure regulates DNA damage and apoptosis

Abstract

Human exposure to cadmium (Cd) may induce severe effects in different organs. Recent studies suggest that long non-coding RNAs (lncRNAs) are closely involved in the pathophysiological mechanisms of Cd-related diseases. This study evaluated the use of lncRNA (ENST00000414355) as an expression signature of Cd exposure and assessed its ability to modulate DNA damage and apoptosis by measuring the expression of ATM serine/threonine kinase (ATM) and mitochondrial membrane potential (ΔΨm) in Cd-exposed workers. A total of 139 (74 non-smokers and 65 smokers) participants from a Cd battery manufacturer were included in the study. Venous blood samples were collected to determine the blood Cd level and detect blood ENST00000414355 and its target gene (ATM) using real-time reverse transcription-polymerase chain reaction (qRT-PCR). Mitochondrial membrane potential was used to assess the Cd effect on mitochondrial permeability. Our results indicated a significant positive correlation between blood Cd level and lncRNA-ENST00000414355 and ATM expression and a significant negative correlation between blood Cd level and ΔΨm (p < 0.0001). Moreover, significant correlations were observed between the expression of lncRNA-ENST00000414355 and ATM expression and ΔΨm (p < 0.0001). Statistical significance was found in the blood Cd level, lncRNA-ENST00000414355 expression, ATM expression, and ΔΨm (p < 0.0001) between smokers and non-smokers. This study confirmed the upregulation of the lncRNA-ENST00000414355 expression, DNA damage-checkpoint-related gene (ATM), and decreased ΔΨm in Cd-exposed workers. Thus, lncRNA-ENST00000414355 may serve as a valuable biomarker for the exposure and toxicity of Cd.

Keywords

Cadmium human long non-coding RNA mitochondrial membrane potential biomarkers DNA damage

Introduction

Environmental pollution is considered to be one of the most dangerous threats affecting Egypt, being one of the most populous countries in Africa. The increase in population density, especially with the growing number of agricultural and industrial projects along the Nile river, is proportionately associated with heavy metal intoxication (Darwish et al., 2015).

Cadmium (Cd) is a heavy metal (the seventh most toxic heavy metal as per the Agency for Toxic Substances and Disease Registry ranking) that causes widespread environmental pollution, mostly from industrial operations and phosphate fertilizers (ATSDR, 2017; Jaishankar et al., 2014; Pinto et al., 2004). Therefore, acute and chronic human intoxication may result from occupational and environmental exposures with subsequent inhalation or ingestion of Cd (Faroon et al., 2012). Furthermore, cigarette smoking represents a great source of Cd exposure, with smokers having four to five times higher blood Cd levels than non-smokers (Rahimzadeh et al., 2017).

Based on experimental studies, definite evidence regarding Cd carcinogenicity following long-term and chronic exposures was obtained (Joseph, 2009, Waalkes et al., 1999a, 1999b, 2000).

The molecular mechanisms involved in Cd-related diseases have been widely investigated recently. Increasing evidence has demonstrated that oxidative stress, DNA methylation, apoptosis, and abnormal levels of non-coding RNA are associated with Cd toxicity. In this context, both microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) play crucial roles in Cd-induced multiple-organ toxicity by activating biological events and signaling cascades (Gu et al., 2020). In a study by Zhou et al. (2015), lncRNAs have been shown to contribute to the production of Cd-related tumors through a mechanism associated with DNA dysregulation.

The biological effects of these factors are the consequence of gene expression changes (Gomez and Hergovich, 2016). DNA damage checkpoints play essential roles in diseases, especially cancer and aging (Zhou et al., 2013). Zhou et al. (2015) studied lncRNA-ENST00000414355 based on bioinformatics analysis of differentially expressed lncRNAs/messenger RNAs (mRNAs). They reported that lncRNA-ENST00000414355 regulates 22 possible target mRNAs involved in DNA damage and repair, molecular transducer function, biological cycle, metabolism, and cell cycle progression. In addition, silencing lncRNA-ENST00000414355 in Cd-transformed cells reduced DNA damage and enhanced its repair by regulating different DNA damage and repair-related genes, including ATM.

Another effect of Cd is its ability to induce apoptosis among different cell types, as proven by previous studies (Fujimaki et al., 2000; Kalariya et al., 2009; Tsangaris and Tzortzatou-Stathopoulou, 1998). Mao et al. (2007) demonstrated that Cd could induce embryonic kidney cell line (HEK293) apoptosis in humans through a mitochondrial pathway; Bcl-2 apoptosis regulator (Bcl-2) expression downregulation, which releases mitochondrial cytochrome c and apoptosis-inducing factor; and then caspase-3 activation and fragmentation of nuclear DNA. Cd could also directly affect the mitochondria causing increased permeability and decreased membrane potential, as well as mitochondrial swelling.

This study evaluated whether lncRNA-ENST00000414355 could serve as an expression signature of Cd exposure. It also assessed the effect of lncRNA-ENST00000414355 on the modulation of the expression of the DNA damage-checkpoint related gene (ATM) and mitochondrial membrane potential in Cd-exposed workers.

Materials and methods

Study design and population

In this cross-sectional study, 139 eligible participants, occupationally exposed to Cd, aged 20–59 years and employed at least 2 years in a Cd battery factory located in Giza, Egypt, were recruited from June to August 2019. Of the 139 participants, 74 were non-smokers (40 males and 34 females), and 65 were smokers (33 males and 32 females).

The included workers in the study were machine mechanics, product development staff, production workers, management professionals, and service, cleaning, and security workers. Additionally, the data sheet included age, sex, and smoking habit information from each subject.

Blood sample collection, treatment, and metal analysis

After fasting for 10–12 h, venous blood samples were taken and transferred into metal-free anticoagulant tubes to determine the blood Cd levels, ENST00000414355, and its target gene (ATM). Quantitative real-time PCR was employed to assess the expression of lncRNA-ENST00000414355 and its target gene.

The withdrawn blood (3 mL) was shipped in dry ice within 2–4 h of collection for further measurements of metal levels. First, blood was kept in heparinized tubes; then, it was digested by adding nitric acid and then heated to allow the metal to get out of the RBC. The blood Cd level was measured using a flame atomic absorption spectrophotometer with a deuterium background (thermo elemental M-6 type). After establishing the standard curves and testing the quality control materials, external calibrators were prepared via serial dilution of parent stock containing 1000 μL/mL of external calibrator using deionized water as a diluent. It was crucial to choose a proper wavelength for the reading and lamp current bandpass optimization for Cd. By plotting the standard curve, the reading of the absorbance of the sample and the calibrator was plotted on a semi-log curve; the concentration of Cd in the samples was interpreted from the standard curve. The wavelength for the AAS analysis was 228.8 nm (Welz and Sperling, 2008).

RNA extraction

Isolation using the NucleoSpin RNA Mini Kit (Macherey-Nagel GmbH and Co. KG. Germany) of total RNA was conducted according to the manufacturer’s instructions. Also, the assessment of RNA purity using Beckman dual spectrophotometer was conducted at 260–280 ultraviolet invisible wavelength (O’Connell, 2002).

Reverse transcription real-time PCR

According to the manufacturer’s instructions, the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem, USA) was used to reverse-transcribe total RNA into cDNA. Subsequently, we used the SYBR Green I PCR MasterMix (Fermentas) to amplify the cDNA using the StepOne instrument (Applied Biosystem, USA) as follows: 10 min at 95°C for enzyme activation, 15 s (40 cycles) at 95°C, 55°C for 20 s, and 72°C for 30 s for the amplification (O’Connell, 2002).

The expression changes for ENST00000414355 and ATM (target genes) were normalized in relation to the β-actin (housekeeping gene) mean critical threshold values using the ΔΔCt method. Table 1 presents the primer sequences used during the qRT-PCR.

Table 1.

Primer sequences specific for the genes.

LncRNA	Primer sequence: 5′–3′
ENST00000414355	F: CAGAAAGAAGCCAAACAAGGAG R: AACCACCAAACAGTCAGCAG

mRNAs	Primer sequence: 5′- 3′
ATM	F: TGCCAGACAGCCGTGACTTAC R: ACCTCCACCTGCTCATACACAAG
β Actin	F: ACAGAGCCTCGCCTTTGCCGAT R: CTTGCACATGCCGGAGCCGTT

Assessment of the Cd effect on mitochondrial membrane potential

A permeable dye to the mitochondria, which fluoresced according to the degree of the mitochondrial membrane potential (either red or green), was used to assess cell health. The healthy cell exhibited high mitochondrial membrane potential (ΔψM), whereas the unhealthy cell exhibited low mitochondrial membrane potential. The higher the mitochondrial membrane potential, the greater the polarization of the mitochondrial membrane. This was accomplished using the JC-1 kit (Cayman Chemical Co., Ann Arbor, Michigan, USA). The mononuclear cells of the whole blood samples were separated by the concentration gradient using Ficoll®-Paque Plus (GE17-1440-02; Merck, Germany). Approximately 105 cells/well were plated and then left for 24 h to adhere to the well bottom. Initially, exposure was done by removing growth media from each well and adding the treatment media with CdCl₂ (1 μM) or the vehicle (water) and then returning the cells to the incubator for 48 h at 37°C and 5% CO₂. According to the manufacturer’s instructions and after exposure, the cells were prepared, stained by adding 10-μL JC-1 dye, and incubated for 20 min. BioTek plate reader was used to measure the fluorescence intensity first at 535 ex/595 em for JC-1 aggregate measurement (green for healthy cells), followed by the second reading to measure JC-1 monomers (red for apoptotic/unhealthy cells) using 485 ex/535 em (Cambre et al., 2020).

Statistical analyses

Data were coded and entered using GraphPad Prism v.7. For quantitative data, mean and standard deviation were used, whereas categorical data were summarized using the frequency (count) and relative frequency (%). Non-parametric Kruskal–Wallis and Mann–Whitney tests were employed to compare the quantitative variables (Chan, 2003a).

For categorical data comparison, chi-squared (χ²) test was conducted. Fischer’s exact test was used when the expected frequency was less than 5 (Chan, 2003b). For quantitative variable correlations, Pearson’s correlation coefficient was employed. Statistical significance was defined as p < 0.05.

Ethical consideration

All procedures followed the principles outlined in the Declaration of Helsinki. The study was accepted by the Research Ethics Committee at Cairo University’s Kasralainy Faculty of Medicine. All subjects gave their informed consent, and the participants’ personal information was not disclosed.

Results

This study included 139 Cd-exposed workers, 74 non-smokers, and 65 smokers. The mean age for non-smokers was 45 ± 9.4 years and 44 ± 8.9 years for smokers. The distribution of study subjects by sex is presented in Table 2.

Table 2.

Sex distribution among study subjects.

		Non-smoker 74		Smoker 65		p value
		Count	%	Count	%	p value
Sex	Male	40	54.1	33	50.8	0.73
Sex	Female	34	45.9	32	49.2	0.73

Table 3 presents the correlations between blood Cd level and the biochemical markers of study subjects, where there were weak positive and good positive correlations between blood Cd level and lncRNA-ENST00000414355 and ATM expression, respectively (p < 0.0001, r = 0.37, and p < 0.0001, r = 0.6, respectively). Moreover, a weak negative correlation was observed between the blood Cd level and mitochondrial membrane potential (p < 0.0001, r = −0.48).

Table 3.

Correlation between blood Cd level with the studied biochemical markers in Cd-exposed subjects.

		All subject
LncRNA-ENST00000414355 expression	Correlation coefficient	0.37
LncRNA-ENST00000414355 expression	p-value	<0.0001*
ATM	Correlation coefficient	0.6
ATM	p-value	<0.0001*
Mitochondrial membrane potential (ΔΨm)	Correlation coefficient	0.48-
Mitochondrial membrane potential (ΔΨm)	p-value	<0.0001*

* p-value indicates statistical significance.

When the lncRNA-ENST00000414355 expression was further correlated with the mRNA expression of ATM and mitochondrial membrane potential, a good positive and weak negative correlation with ATM and mitochondrial membrane potential, respectively, (r = 0.61, p < 0.0001, and r = −0.44, p < 0.0001, respectively) (Table 4) was observed.

Table 4.

Correlation between LncRNA-ENST00000414355 with ATM expression and mitochondrial membrane potential in Cd-exposed subjects.

		All subject
ATM	Correlation coefficient	0.61
ATM	p-value	<0.0001*
Mitochondrial membrane potential (ΔΨm)	Correlation coefficient	0.44-
Mitochondrial membrane potential (ΔΨm)	p-value	<0.0001*

* p-value indicates statistical significance.

Table 5 presents a comparison between smokers and non-smokers regarding the studied biochemical markers; there were statistically significant differences in the blood Cd level, lncRNA-ENST00000414355 expression, ATM expression, and mitochondrial membrane potential (p < 0.0001).

Table 5.

Comparison between smokers and non-smokers regarding the studied biochemical markers.

	Non-smoker 74		Smoker 65		p-value
	Mean	Standard deviation	Mean	Standard deviation	p-value
Blood Cd level μg/dL	0.49	0.15	0.81	0.21	<0.0001*
LncRNA-ENST00000414355 expression (min–max) median	1.1 (0.21–3) 0.96	0.55	2.5 (0.49–11) 2.4	1.3	<0.0001*
ATM (min–max) median	0.25 (0.1–0.64) 0.23	0.12	2.8 (0.16–4.1) 3.2	0.83	<0.0001*
Mitochondrial membrane potential (ΔΨm)	4.1	0.67	2.2	0.66	<0.0001*

*p-value indicates statistical significance.

Discussion

Increasing evidence suggests that lncRNAs play a crucial biological role and are linked to disease progression. lncRNAs are emerging as potential disease diagnostic, therapeutic, and prognostic markers (Chen et al., 2013).

Few studies are concerned with the use of lncRNAs as novel biomarkers of Cd exposure and their role in Cd-related diseases. Therefore, this study evaluated the use of lncRNA-ENST00000414355 as an expression signature of Cd exposure. Furthermore, we evaluated its role in regulating the expression of the DNA damage-checkpoint-related gene (ATM) and ΔΨm.

In this study, the expression level of lncRNA-ENST00000414355 indicated a significant positive correlation with the blood Cd levels of the study participants. This indicates that blood ENST00000414355 could be a useful biomarker for human Cd exposure. Furthermore, our result is close to that of Zhou et al. (2015) who observed the same correlation between ENST00000414355 and blood Cd concentrations.

Our results indicated a good positive correlation between the blood Cd level and ATM expression. Additionally, there was a good positive correlation between ENST00000414355 expression and ATM, suggesting that lncRNA-ENST00000414355 factors in activating the signaling pathway of DNA damage and repair.

Similarly, Zhou et al. (2015) observed that the ATM mRNA expression in human bronchial epithelial cells progressively increased during the Cd-induced malignant transformation. They also detected that ENST00000414355 positively correlated significantly with the mRNA expression of ATM among Cd-exposed workers.

This study revealed a significant negative correlation between the blood Cd level and mitochondrial membrane potential. Mao et al. (2011) demonstrated the effect of Cd chloride examined on the permeability and potential of the mitochondrial membrane with markers of oxidative stress in mitochondria isolated from HEK293 cells; their results agree with those of this study. They found that Cd generated reactive oxygen species, which induced mitochondrial permeability transition with subsequent mitochondrial swelling and loss of ΔΨm that plays a critical role in Cd-induced apoptosis; also, the decrease in ΔΨm was dose-dependent.

The mean Cd blood level was significantly higher among smokers than among non-smokers. Similarly, Brockhaus et al. (1983) noticed that the Cd blood levels among smokers were three to four times greater than among non-smokers. Also, Bernhard et al. (2006) found that significantly higher serum Cd levels were present among smokers than among non-smokers. Richter et al. (2017) reported that repeated and prolonged Cd exposure caused by tobacco use is associated with high blood and urine Cd concentrations. Total tobacco Cd is transferred to mainstream tobacco smoke at a higher percentage than other toxic metals in tobacco. Bioaccumulation of inhaled Cd in the lungs is followed by distribution to other tissues, with one to two decades of total body biological half-life.

Our results indicated that in smokers, there was a significantly higher expression of lncRNA-ENST00000414355 and ATM and lower mitochondrial membrane potential than in non-smokers. These findings were supported by previous research; Bi et al. (2015) found that hundreds of lncRNAs in healthy smokers were differentially expressed in the lung tissue compared with non-smokers, denoting the role of cigarette smoking in regulating the lncRNA expression. With regard to ATM, its expression level was increased, as shown by Jiang et al.’s (2007) study in esophageal cancer tissues associated with tobacco smoke exposure. They concluded that the ATM expression could be used as a biomarker for the early detection of tobacco use and esophageal cancer in patients. Also, studies demonstrated a decrease in ΔΨm with smoking; Banzet et al. (1999) found that increasing tobacco smoke concentrations induced a significant decrease in ΔΨm, leading to complete collapse at high concentrations of tobacco smoking. Also, Zeineh et al. (2019) observed the collapse of ΔΨm following all time points of cigarette smoke exposure.

Conclusion

Conclusively, this study confirmed the upregulation of lncRNA-ENST00000414355 expression and the DNA damage-checkpoint-related gene (ATM) in Cd-exposed workers, which may factor in regulating DNA repair epigenetic mechanisms and apoptosis. Therefore, the lncRNA-ENST00000414355 may serve as a valuable biomarker for the exposure and toxicity of Cd for occupational and environmental risk assessments in humans. However, further studies should be designed in detail with more facilities and comprehensive results to better understand and compare the mechanisms of Cd toxicity.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

Asmaa Mohammad Moawad

References

ATSDR (2017) ATSDR’s substance priority list. Agency for toxic substances and disease registry. Available at: https://www.atsdr.cdc.gov/SPL/ (accessed 10 December 2020).

Banzet

François

Polla

(1999) Tobacco smoke induces mitochondrial depolarization along with cell death: effects of antioxidants. Redox Report 4(5): 229–236.

Bernhard

Rossmann

Henderson

, et al. (2006) Increased serum cadmium and strontium levels in young smokers: effects on arterial endothelial cell gene transcription. Arteriosclerosis, Thrombosis, and Vascular Biology 26(4): 833–838.

Zhou

, et al. (2015) Microarray analysis of long non-coding RNAs in COPD lung tissue. Inflammation Research 64(2): 119–126.

Brockhaus

Freier

Ewers

, et al. (1983) Levels of cadmium and lead in blood in relation to smoking, sex, occupation, and other factors in an adult population of the FRG. International Archives of Occupational and Environmental Health 52(2): 167–175.

Cambre

Holl

Wang

, et al. (2020) Cytotoxicity of NiO and Ni (OH) 2 nanoparticles is mediated by oxidative stress-induced cell death and suppression of cell proliferation. International Journal of Molecular Sciences 21(7): 2355.

Chan

(2003a) Biostatistics 102: quantitative data–parametric & non-parametric tests. Blood Pressure 44(24.08): 391–396.

Chan

(2003b) Biostatistics 103: qualitative data-tests of independence. Singapore Medical Journal 44(10): 498–503.

Chen

Jia

, et al. (2013) Silencing of long noncoding RNA AK139328 attenuates ischemia/reperfusion injury in mouse livers. Plos One 8(11): e80817.

10.

Darwish

Hussein

El-Desoky

, et al. (2015) Incidence and public health risk assessment of toxic metal residues (cadmium and lead) in Egyptian cattle and sheep meats. International Food Research Journal 22(4): 1719.

11.

Faroon

Ashizawa

Wright

, et al. (2012) Toxicological Profile of Cadmium. Atlanta GA: Agency for Toxic Substances and Disease Registry (US).

12.

Fujimaki

Ishido

Nohara

(2000) Induction of apoptosis in mouse thymocytes by cadmium. Toxicology Letters 115(2): 99–105.

13.

Gomez

Hergovich

(2016) Cell-cycle control and DNA-damage signaling in mammals. In: Kovalchuk

Kovalchuk

(eds), Genome Stability. Academic Press, pp. 227–242.

14.

Dai

, et al. (2020) Emerging roles of microRNAs and long noncoding RNAs in cadmium toxicity. Biological Trace Element Research 195(2): 481–490.

15.

Jaishankar

Tseten

Anbalagan

, et al. (2014) Toxicity, mechanism and health effects of some heavy metals. Interdisciplinary Toxicology 7(2): 60–72.

16.

Jiang

Liang

, et al. (2007) Ataxia‐telangiectasia mutated expression is associated with tobacco smoke exposure in esophageal cancer tissues and benzo [a] pyrene diol epoxide in cell lines. International Journal of Cancer 120(1): 91–95.

17.

Joseph

(2009) Mechanisms of cadmium carcinogenesis. Toxicology and Applied Pharmacology 238(3): 272–279.

18.

Kalariya

Wills

Ramana

, et al. (2009) Cadmium-induced apoptotic death of human retinal pigment epithelial cells is mediated by MAPK pathway. Experimental Eye Research 89(4): 494–502.

19.

Mao

W-P

J-L

Guan

Z-B

, et al. (2007) Cadmium induces apoptosis in human embryonic kidney (HEK) 293 cells by caspase-dependent and-independent pathways acting on mitochondria. Toxicology in Vitro 21(3): 343–354.

20.

Mao

Zhang

Zhou

, et al. (2011) Cadmium directly induced mitochondrial dysfunction of human embryonic kidney cells. Human & Experimental Toxicology 30(8): 920–929.

21.

O’Connell

(2002) The basics of RT-PCR. In: King

O’Connell

(eds), RT-PCR Protocols. Humana Press, pp. 19–25.

22.

Pinto

Mota

De Varennes

, et al. (2004) Influence of organic matter on the uptake of cadmium, zinc, copper and iron by sorghum plants. Science of the total environment 326(1–3): 239–247.

23.

Rahimzadeh

Kazemi

, et al. (2017) Cadmium toxicity and treatment: an update. Caspian journal of internal medicine 8(3): 135–145.

24.

Richter

Faroon

Pappas

(2017) Cadmium and cadmium/zinc ratios and tobacco-related morbidities. International Journal of Environmental Research and Public Health 14(10): 1154.

25.

Tsangaris

Tzortzatou-Stathopoulou

(1998) Cadmium induces apoptosis differentially on immune system cell lines. Toxicology 128(2): 143–150.

26.

Waalkes

Anver

Diwan

(1999a) Carcinogenic effects of cadmium in the noble (NBL/Cr) rat: induction of pituitary, testicular, and injection site tumors and intraepithelial proliferative lesions of the dorsolateral prostate. Toxicological Sciences 52(2): 154–161.

27.

Waalkes

Anver

Diwan

(1999b) Chronic toxic and carcinogenic effects of oral cadmium in the Noble (NBL/Cr) rat: induction of neoplastic and proliferative lesions of the adrenal, kidney, prostate, and testes. Journal of Toxicology and Environmental Health A 58(4): 199–214.

28.

Waalkes

Rehm

Cherian

(2000) Repeated cadmium exposures enhance the malignant progression of ensuing tumors in rats. Toxicological Sciences 54(1): 110–120.

29.

Welz

Sperling

(2008) Atomic Absorption Spectrometry. Wiley VCH.

30.

Zeineh

Nagler

Gabay

, et al. (2019) Effects of cigarette smoke on TSPO-related mitochondrial processes. Cells 8(7): 694.

31.

Zhou

Liu

Wang

, et al. (2015) Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology. Scientific Reports 5: 15293.

32.

Zhou

Wang

Liu

, et al. (2013) Cadmium induced cell apoptosis, DNA damage, decreased DNA repair capacity, and genomic instability during malignant transformation of human bronchial epithelial cells. International Journal of Medical Sciences 10(11): 1485–1496.