Wnt5a promotes Kupffer cell activation in trichloroethylene-induced immune liver injury

Abstract

Trichloroethylene (TCE) is a volatile, colorless liquid that is widely used as a chlorinated organic vehicle in industrial production and processing industries. Many workers exposed to trichloroethylene may develop trichloroethylene hypersensitivity syndrome (THS). However, the underlying mechanism of THS is still unclear, especially liver injury. The present study aimed to investigate whether Wnt5a/c-Jun N-terminal kinase (JNK) is involved in and regulates liver injury caused by TCE exposure and to provide new directions for the prevention and treatment in clinical settings of liver injury caused by TCE exposure. We used 6- to 8-week-old SPF-grade BALB/c female mice to establish a TCE sensitization model and explored the mechanism through inhibitor intervention. We found that the expression of Wnt5a/JNK was significantly elevated in the liver of TCE sensitization-positive mice. Inhibitors of Wnt Production 2 (IWP-2) are known antagonists of the Wnt pathway. TCE-sensitization mice treated with IWP-2 showed downregulated Wnt5a/JNK expression, reduced Kupffer cell activation, and decreased liver injury. At the same time, we found that phosphorylated JNK in TCE-sensitization mouse livers and extracted Kupffer cells showed a significant downward trend after inhibition of Wnt5a function. We also found that a specific JNK inhibitor, SP600125, decreased the secretion of cytokines and chemokines and decreased Kupffer cell activation. We demonstrated that Wnt5a/JNK was involved in the regulation of liver injury in TCE-sensitization mice and that it exacerbated liver injury by activating Kupffer cells and releasing chemokines. We therefore hypothesized that Kupffer cell activation was affected by JNK, which reduced chemokine and cytokine secretion and attenuated liver injury in TCE-sensitization mice.

Keywords

trichloroethylene liver injury Wnt5a C-Jun N-terminal kinase Kupffer cells

Introduction

Trichloroethylene (TCE) is a colorless, volatile organic vehicle that was widely used as an important industrial raw material in metalworking, electronics, dry cleaning, electroplating, organic synthesis, and other industrial applications (Jiao et al., 2022). Because of its large-scale production and use, as well as improper waste disposal, TCE had become a common environmental contaminant worldwide, resulting in widespread occupational exposures (Dorsey et al., 2023). While recent regulations restricted the use of TCE, they had not completely banned its use, especially in industrial and manufacturing processes; therefore, TCE causes occupational exposure and adverse effects on human health, such as multiple organ and system damage. Some occupational workers exposed to TCE will develop severe skin rashes. In addition to symptoms such as headache, dizziness, fatigue, nausea, and loss of appetite, skin lesions such as erythema, papules, and blisters may appear 3-4 weeks after exposure, mainly on the upper extremities, and progress to the trunk and lower extremities after a few days. The disease caused by occupational exposure to TCE was called occupational trichloroethylene rash-like dermatitis in China (Wang et al., 2021). Based on existing studies, THS was considered a T-cell-mediated type IV hypersensitivity reaction, where treatment with glucocorticoids was relatively effective and re-exposure to TCE caused relapses, but heavy steroid use produced greater side effects (Zhang et al., 2017), so the pathogenesis of THS was further investigated to seek more precise therapeutic loci.

Previous research found that exposure to TCE can cause severe liver damage (Valdiviezo et al., 2022). However, there is still no consensus on the mechanism of liver injury in clinical and basic research. In our earlier study, we found that Kupffer cell activation played an important role in liver injury induced by TCE (Zhang et al., 2020). Some studies found that Wnt proteins were mostly expressed in the liver and might play an important role in liver pathobiology through classical and nonclassical pathways (Zeng et al., 2007). In contrast, the liver Kupffer cell was an important source of Wnt protein (Yang et al., 2014). However, the mechanism by which Wnt protein affects liver injury through activation of Kupffer cells is unclear. TNF-α was found to be highly expressed in liver injury in TCE-sensitization mice (Zhang et al., 2021), and TNF-α is clinically used as a precise therapeutic site for TCE drug rash-like dermatitis. Studies had demonstrated that TNF-α induced increased secretion of Wnt5a (Li et al., 2018). Wnt5a is a representative ligand of the Wnt protein family that activates non-β-catenin-dependent signaling in the Wnt pathway, and it was found that Wnt5a induces macrophages to express proinflammatory cytokines in response to microbial stimulation as an atypical Wnt protein (Blumenthal A et al., 2006). Wnt5a could activate c-Jun N-terminal kinase (JNK) signaling during inflammation (Liu et al., 2020). JNK was a stress-activated kinase in the mitogen-activated protein kinase (MAPK) family (Kumar et al., 2015), and Ror2 was a member of the receptor tyrosine kinase Ror family and a receptor for Wnt5a. Ror2 activated JNKs and played a key role in establishing cell polarization during tissue development (Endo et al., 2012). However, the role of Wnt5a/JNK signaling in liver injury in TCE-sensitization mice has not been investigated.

In this study, we aimed to investigate the role of Wnt5a/JNK signaling-regulated Kupffer cell activation in liver injury induced by TCE. Thus, we established a mouse model of TCE sensitization and used the Wnt5a-specific antagonist IWP-2 and the JNK-specific antagonist SP600125 to observe the activation of Wnt5a/Ror2 signaling and the alteration of chemokine secretion. The specific objectives were to investigate the mechanisms by which Wnt5a and its receptor Ror2 regulated chemokine secretion from Kupffer cells during TCE sensitization to mediate immune liver injury, to further exploration of the pathogenesis of immune liver injury in THS patients, and to provide a theoretical basis for potential targets for precision clinical treatment.

Material and methods

Reagents

TCE, Freund’s complete adjuvant (FCA) and 4,6-diamidino-2-phenylindole (DAPI) were purchased from Sigma (St. Louis, MO, USA). Acetone and olive oil were acquired from Shanghai Chemical Reagent (Shanghai, China). Primary antibodies: anti-mouse Wnt5a antibody, anti-mouse JNK antibody, anti-mouse CXCL-1 antibody, anti-mouse CXCL-10 antibody, anti-mouse CCL3 antibody, anti-mouse MCP-1 antibody, and CXCL-1 antibody, were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Secondary antibodies: goat anti-mouse lgG H&L (Alexa Fluor 488) (ab150113), goat anti-rabbit lgG H&L (Alexa Fluor 555) (ab150078), goat anti-rabbit lgG H&L (Alexa Fluor 488) (ab150077), and goat anti-rat lgG H&L (Alexa Fluor 594) (ab150168) were from Abcam (Cambridge, UK). Immunohistochemistry kits were purchased from Zhong Shan Jin Qiao Company (Beijing, China). RPMI 1640 medium was purchased from Thermo Fisher Scientific (Thermo, Massachusetts, USA).

Animals

Eighty 6- to 8-week-old female SPF mice, BALB/c strain, were purchased from Anhui Medical University and weighed approximately 17 ± 1.2 g. The mice were housed in clean cages at 25°C and 50% humidity, with alternating 24 h of light and darkness, and were provided with standard chow and clean drinking water. The experimental design and animal use protocol were approved by the Biomedical Ethics Committee of Anhui Medical University (animal ethical committee number: 20220917).

Animal models and groupings

A mouse model of percutaneous sensitization to trichloroethylene was established based on a previous study (Wang et al., 2015). On day 1, 50 μL of 50% TCE (TCE: olive oil: acetone = 5:2:3) and 50 μL of FCA mixture was injected subcutaneously into the backs of mice in the TCE-treated group for the first stimulation. On days 4, 7, and 10, mice were pretreated by shaving their backs and sensitization by evenly applying 100 μL of 50% TCE. On days 17 and 19, 100 μL of 30% TCE (TCE: olive oil: acetone = 3:2:5, 100 μL) was applied to stimulate the skin on the backs of mice. The blank control group did not undergo any treatment. The solvent substance group was treated with 100 μL of a mixture of acetone and olive oil (olive oil:acetone = 2:3) as a control. The inhibitor group was injected intraperitoneally with IWP-2 or SP600125 two hours before the terminal excitation on days 17 and 19. On day 20, the skin on the back of the mice was scored: 0, no reaction; 1, mild, scattered redness; 2, moderate, diffuse redness; 3, extensive redness. If the skin reaction score of the mice was greater than or equal to 1, it was judged positive and classified as sensitization-positive group, and the rest as sensitization-negative group. On day 22, mice were euthanized by carbon dioxide inhalation and samples were collected according to the experimental requirements.

In the first experiment, 40 SPF-grade BALB/c female mice were divided into blank control group (n = 5), solvent control group (n = 5), TCE-treated group (n = 15), and IWP-2+TCE-treated group (n = 15). The TCE-treated group was further divided into TCE sensitization-positive (TCE+) and TCE sensitization-negative (TCE-) groups based on the subsequent skin scores; the IWP-2+TCE-treated group was further divided into IWP-2+TCE sensitization-positive (IWP-2+) and IWP-2+TCE sensitization-negative (IWP-2-) (Table 1).

Table 1.

The sensitization rate of TCE and the weight of samples among different groups.

		Sample number (n)	Sensitization rate (%)
Blank control		5	- (%)
Vehicle control		5	- (%)
TCE	Negative	9	40
TCE	Positive	6	40
IWP-2	Negative	11	27
IWP-2	Positive	4	27

In the second experiment, 40 SPF-grade BALB/c female mice were divided into blank control group (n = 5), solvent control group (n = 5), TCE-treated group (n = 15), and SP600125+TCE-treated group (n = 15). The TCE-treated group was further divided into TCE-sensitized positive (TCE+) and TCE-sensitized negative (TCE-) groups based on subsequent skin scores; the SP600125+TCE-treated group was further divided into SP600125+TCE-sensitized positive (SP600125+) and SP600125+TCE-sensitized negative (SP600125-) groups (Table 2).

Table 2.

The sensitization rate of TCE and the weight of samples among different groups.

		Sample number (n)	Sensitization rate (%)
Blank control		5	- (%)
Vehicle control		5	- (%)
TCE	Negative	10	33
TCE	Positive	5	33
SP600125	Negative	10	33
SP600125	Positive	5	33

Extraction of Kupffer cells

First, the mice were anaesthetized and the livers were perfused using a two-step in situ perfusion method with type IV collagenase. The mice were flushed of blood in the liver with PC stock solution and then perfused and digested with type IV collagenase perfusion solution. This process continued until the mouse livers became soft. Subsequently, the livers were carefully excised with scissors and placed in a petri dish containing RPMI 1640 medium. The outer membrane was gently removed with forceps, revealing the effluent sand-like material. It was then passed through a 70-micron cell sieve. Finally, primary hepatic macrophages were isolated by centrifugation at different speeds and primary macrophages were isolated using Percoll’s solution.

Liver function markers

Mice were anaesthetized for orbital blood sampling, and serum was separated by centrifugation at 3000 × g for 10 min. The liver function markers alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were analyzed by microplate assays using the corresponding assay kits (Nanjing Jiancheng Institute of Biological Engineering, Nanjing, China) according to the manufacturer’s instructions.

Hematoxylin and Eosin (H&E) staining

H&E staining was performed using 50 µm paraffin sections of liver tissue. After the liver was deparaffinised and dehydrated, the sections were placed on glass slides and stained sequentially with hematoxylin and eosin. Finally, the pathological changes of the liver were observed under a light microscope.

Total protein extraction and western blotting

Liver tissue proteins were first extracted using the BCA kit. Proteins were separated by electrophoresis at 200 mA for 100 min, and the proteins were transferred to a PVDF membrane, followed by incubation at 4°C overnight with the corresponding primary antibody. The next day, the membranes were washed three times with Tris Buffered Saline with Tween-20 for 10 minutes each time, then incubated with the secondary antibody for 1-2 hours at room temperature and washed three times with Tris Buffered Saline with Tween-20 (TBST) for 10 minutes each time, and then finally developed on a gel imaging system.

RNA extraction and Real-time PCR

Approximately 100 mg of liver was taken for tissue homogenization, and 1 mL TRIzol was added to the homogenizer for low temperature homogenization, and lysed at room temperature for 10 min. Chloroform was added and shaken for 30 s, and centrifuged after which isopropanol was added, total RNA of liver tissue was extracted, cDNA was synthesized using reverse transcriptase and then amplified by PCR program to detect the expression of the target gene. The relative expression of the target gene mRNA was calculated by the 2^-ΔΔCt (Livak) method using GAPDH as the internal reference gene. The primers used are listed in Table 3.

Table 3.

Primers for real-time RT-PCR.

Gene	Primer sequence (5′-3′)	Species
GAPDH	Forward: ATCACTGCCACCCAGAAG	Mouse
GAPDH	Reverse: TCCACGACGGACACATTG	Mouse
CXCL-1	Forward: TGCCGTCATTTTCTGCCTCATCC	Mouse
CXCL-1	Reverse: TCCACGACGGACACATTG	Mouse
CXCL-10	Forward: TGCCGTCATTTTCTGCCTCATCC	Mouse
CXCL-10	Reverse:CCGGATTCAGACATCTCTGCTCATCA	Mouse
MCP-1	Forward: TTAAAAACCTGGATCGGAACCAA	Mouse
MCP-1	Reverse: GCATTAGCTTCAGATTTACGGGT	Mouse
CCL3	Forward: TGTACCATGACACTCTGCAAC	Mouse
CCL3	Reverse: CAACGATGAATTGGCGTGGAA	Mouse

Immunohistochemistry (IHC) staining

Five-micrometer-thick paraffin sections of liver were dewaxed after 20 min in a 98°C oven, washed with PBS, subjected to antigen repair in a microwave oven, cooled to room temperature, washed with PBS, blocked with goat serum at 37°C for 20 min, titrated with F4/80 antibody overnight at 4°C, rewarmed the next day, washed with PBS, titrated with secondary antibody and peroxidase, incubated at 37°C in an incubator, and visualized under a microscope after DAB color development.

Immunofluorescence (IF) staining

Five-μm thick paraffin sections of liver were sequentially subjected to dewaxing and dehydration operations, followed by antigen repair followed by permeabilisation with Tritor and blocking with 5% goat serum in an oven at 37°C, and finally the corresponding primary antibody was added overnight at 4°C in a refrigerator. The next day, the corresponding secondary antibodies were added and incubated for 2 h in an oven at 37°C and stained with DAPI for 15 min, during which time they were rinsed with PBS. Finally, the sections were observed by fluorescence microscopy under light protection.

Statistical analysis

Student's t-test was used to analyze differences between two groups, and differences between multiple groups were analyzed using one/two-way ANOVA with a Bonferroni multiple comparison post-test. Data was analysed using SPSS 23.0 software (SPSS Inc, Chicago, USA). All quantitative data were expressed as mean ± SEM. Significant differences were indicated at p < .05.

Results

Wnt5a is highly expressed in the liver and Kupffer cells of TCE-sensitization mice

We examined the expression of Wnt5a and its receptor Ror2 in the liver of the mice by Western blot (WB) and fluorescence colocalization. The WB results showed that there was no significant difference in the expression of Wnt5a and Ror2 in the blank control group and the vehicle control group (p > .05). Compared with the blank control group, the expression of Wnt5a and Ror2 was significantly higher in the TCE sensitization-positive group mouse liver (p < .05) (Figure 1(A)). It is suggested that Wnt5a may play a role in liver injury in TCE-sensitization mice. Our previous study found that liver injury in TCE-sensitization mice was closely related to the activation of Kupffer cells. Thus, we tried to colocalize F4/80 with Wnt5a by immunofluorescence double labeling (Figure 1(B)). The results showed that the expression of Wnt5a was significantly enhanced in the TCE-sensitization positive group, while F4/80 overlapped with Wnt5a (red box), which showed that there was altered expression of Wnt5a in the liver Kupffer cells of TCE-sensitization mice, but how the mechanism of Wnt5a worked in Kupffer cells was not clear.

Wnt5a expression downregulation alleviates liver injury and inhibits Kupffer cell activation in TCE sensitization model mice

As shown in (Figure 2(A)), in the blank control group and vehicle control group, the hepatocytes were rounded and well arranged with a clear hepatic cord structure. The TCE-sensitization positive group showed obvious loss of hepatic cord structure, hepatocyte swelling, and inflammatory cell infiltration. Liver injury was alleviated after the use of IWP-2, a Wnt5a inhibitor, in TCE-sensitization mice. The serum levels of ALT and AST were not significantly different between the blank control group and the vehicle control group (p > .05). Compared with the blank control group and TCE-sensitization negative group, ALT and AST in serum were significantly increased in the TCE-sensitization group (p < .05) and decreased after the intervention with IWP-2 (p < .05) (Figure 2(B)).

We further detected P-JNK/JNK expression in the mouse model. There was no significant difference in P-JNK/JNK expression in the blank control group and the vehicle control group (p > .05). Compared with the blank control group and the TCE-sensitization negative group, P-JNK/JNK expression was significantly increased in the TCE-sensitization positive group (p < .05). After Wnt5a inhibition, the expression of P-JNK/JNK decreased in the IWP-2+ group (p < .05), which indicated that IWP-2 intervention effectively reduced the protein expression of P-JNK/JNK (Figure 2(C)).

To investigate Kupffer cell activation after IWP-2 intervention on Wnt5a in a mouse model, we performed immunohistochemical staining of liver sections with F4/80. The results showed that there was no obvious Kupffer cell activation in the blank control group and vehicle control group. Kupffer cell activation was detected in the TCE-sensitization positive group. The activation of Kupffer cells was significantly reduced after the use of the Wnt5a inhibitor IWP-2, and little Kupffer cell activation was present in the IWP-2-sensitization positive group (Figure 2(D)).

Wnt5a/JNK is inhibited in Kupffer cells of TCE-sensitization mice after IWP-2 intervention

We extracted Kupffer cells from model mouse livers to detect Wnt5a, Ror2, and JNK protein expression. The expression of Wnt5a, Ror2, and JNK showed no significant differences between the blank control group and vehicle control group. Compared with the blank control group, the expression of Wnt5a, Ror2, and JNK in the TCE-sensitization positive group was significantly higher (p < .05), and the expression was significantly reduced after use of IWP-2 (p < .05) (Figure 3).

SP600125 intervention alleviates liver injury and inhibits Kupffer cell activation in TCE sensitization model mice

Based on the results of the above mouse model, we found that the inhibition of the Wnt5a pathway can downregulate JNK signal activation and macrophage activation, thereby reducing liver injury, but it is not clear whether the specific mechanism is related to the JNK signaling pathway. Therefore, we established a mouse TCE sensitization model and investigated the role of Kupffer cell activation mediated by the JNK signaling pathway in TCE immune liver injury by using the JNK-specific inhibitor SP600125.

P-JNK/JNK was significantly increased in the TCE-sensitization positive group compared with the blank control group and the TCE-sensitization negative group, as shown in the above result (p < .05) (Figure 4(A)). After SP600125 intervention, the protein expression of P-JNK/JNK decreased significantly (p < .05), which indicated that SP600125 intervention effectively reduced the protein expression of P-JNK/JNK.

We measured the serum AST and ALT concentrations in the model mice, and the results were consistent with the above results. There was no significant difference between the blank control group and the vehicle control group (p > .05). Compared with the blank control group and the TCE-sensitization negative group, the liver function indexes AST and ALT expression levels increased significantly (p < .05) in the TCE sensitization-positive group and decreased significantly (p < .05) after the use of the JNK inhibitor SP600125 (Figure 4(B)). It was suggested that liver injury in TCE-sensitization mice was alleviated after JNK was inhibited. Meanwhile, we performed histopathology using H&E stains. The TCE sensitization-positive group showed significant loss of hepatic cord structure, hepatocyte swelling and inflammatory cell infiltration, and liver injury was alleviated after the use of the JNK inhibitor SP600125. We also examined the activation of Kupffer cells in the liver of each group of mice, and the immunohistochemical staining of liver sections of each group was performed using F4/80. The activation of Kupffer cells increased significantly in the TCE-sensitization positive group and decreased significantly after the use of the JNK inhibitor SP600125 (Figure 4(C)).

Inhibition of JNK activation downregulates hepatic chemokine expression in liver of TCE sensitization model mice

We examined the expression of liver chemokines in model mice. We found that the expression of CXCL-1, CXCL-10, CCL3, and MCP-1 was not significantly different between the blank control group and the vehicle control group (p > .05). Compared with the blank control group and the TCE-sensitization negative group, CXCL-1, CXCL-10, CCL3, and MCP-1 expression was significantly higher in the TCE sensitization-positive group (p < .05), and CXCL-10, CCL3, and MCP-1 expression was decreased after SP600125 intervention (p < .05). RT‒PCR results showed that the decrease in JNK expression significantly downregulated the mRNA expression of CXCL-1, CXCL-10, CCL3, and MCP-1 (p < .05), which was consistent with the WB results (Figure 5).

JNK is inhibited to downregulate chemokines in Kupffer cells of TCE-sensitization mouse liver

To further investigate the secretion of chemokines by Kupffer cells, we extracted liver Kupffer cells from the model mice and detected the expression of chemokines, and the results showed that there was no significant difference in the expression of CXCL-1, CXCL-10, CCL3, and MCP-1 in the blank control group compared with the vehicle control group (p > .05). CXCL-1, CXCL-10, CCL3, and MCP-1 expressions were significantly higher in the TCE-sensitization positive group than in the blank control group and the TCE-sensitization negative group (p < .05) and was significantly reduced after the use of the JNK-specific inhibitor SP600125 (p < .05). Compared with the SP600125 sensitization negative group, the expression was slightly higher in the SP600125 positive sensitization group, and the difference was statistically significant (p < .05) (Figure 6).

Discussion

The mechanism of TCE liver damage has been a central question of our research, and we hope to make progress. In our work, we found that Wnt5a was highly expressed in the livers of TCE-exposed mice. To explore its role in liver injury in TCE-exposed mice, we investigated the expression of Wnt5a and its downstream JNK signaling in a TCE-exposed mouse model. We also investigated the role of IWP-2, a Wnt5a antagonist, in vivo. In addition, the effect of Wnt5a/JNK signaling on downstream inflammatory cytokine expression in Kupffer cells was investigated in vitro.

TCE was widely used as a solvent in industrial production related to metal cleaning and degreasing and had received widespread attention because of the health hazards caused by occupational exposure (Chiu et al., 2013; Ordaz et al., 2017). The immune-related effects of TCE occupational exposure had been confirmed by most studies (Gilbert et al., 2009; Nakajima et al., 2022). Among them, liver injury caused the highest morbidity and mortality rate (Al-Griw et al., 2016) and had been the subject of numerous studies, but the exact mechanism was unclear.

The Wnt signaling pathway is highly conserved and plays a key role in regulating cellular processes during development and in adult tissue homeostasis (Rim et al., 2022). The Wnt pathway was increasingly recognized as an important regulator of metabolic compartmentalization, in vivo homeostatic renewal and regeneration throughout liver injury response (Wild et al., 2020). It was found that the biliary network could be indirectly regulated, and liver compartmentalization could be affected through the regulation of Wnt ligand production in hepatic endothelial cells (Zhu et al., 2022). The Wnt pathway might play an important role in the liver inflammatory response. Wnt5a was an important molecule in the Wnt family, and our previous study found that it was highly expressed in the organs of TCE-sensitization mice (Zuo et al., 2022). However, how Wnt5a acts in liver injury induced by TCE is unclear. We established a TCE sensitization mouse model using IWP-2, a Wnt5a-specific inhibitor. We found that the expression of Wnt5a/JNK was significantly elevated in the liver of the TCE sensitization-positive group. TCE-sensitization mice treated with IWP-2 showed downregulated Wnt5a/JNK expression, reduced Kupffer cell activation, and alleviated liver injury. At the same time, we found that phosphorylated JNK in TCE-sensitization mouse livers and extracted Kupffer cells showed a significant downward trend after inhibition of Wna5a function. Based on a previous study (Zuo et al., 2022), we further focused on the possible mechanism of Wnt5a-mediated liver injury to the JNK pathway.

JNKs belong to the superfamily of MAP kinases, which had been shown to play a crucial role in the regulation of cell development, cell differentiation, survival and apoptosis (Li et al., 2020; Wang et al., 2022). JNK played an important role in liver injury (Abo et al., 2020; Kim et al., 2018; Seki et al., 2012). Kupffer cells treated with GdCl₃ led to apoptosis mainly through the ERK/JNK/SAPK pathway (Sakaida et al., 2003), but the specific regulators involved were not elucidated. Thus, we explored the relationship between JNK and Kupffer cells. We found that SP600125 decreased the secretion of cytokines and chemokines and decreased Kupffer cell activation. It could be speculated that the activation of Kupffer cells was affected by JNK, which reduced the secretion of chemokines and cytokines and alleviated liver injury in TCE-sensitization mice.

Kupffer cells were the first response to liver injury, and the expression of injury-related molecular patterns on liver cells can be detected by Kupffer cells (Fainboim et al., 2007). The cytokines and chemokines produced by Kupffer cells can further aggravate liver injury. Chemokines are involved in the recruitment of immune cells during inflammation but also contribute to immune surveillance, directing cells to target organs in homeostasis and exerting a pleiotropic effect on nonimmune cells. Immune cells usually carry different chemokine receptors. Interestingly, chemokine receptors were primarily involved in regulating inflammatory responses (e.g., CXCL-1 and CXCL-10) (Marra., 2014). The important pathological role of MCP-1 and chemokines in inflammatory diseases had been reported, including liver injury (Baeck et al., 2012; Sahin et al., 2013; Xie et al., 2016). Activated Kupffer cells secrete interleukin (IL)-1β and CXC chemokines such as CXCL1 and CCL2. CXCL1 was a key chemokine that attracts neutrophils, mainly via the chemokine receptors CXCR1 and CXCR2, which released reactive oxygen species as well as proteases and thereby evoking hepatocyte necrosis (Zimmermann, 2011). In the present study, we extracted Kupffer cells from the liver and detected MCP-1, CXCL-1, CXCL-10, and CCL-3 expression. We found that the expression of MCP-1, CXCL-1, CXCL-10, and CCL-3 in Kupffer cells was significantly reduced. In addition, our findings also showed that activation of the inflammatory signaling pathway could be inhibited by SP600125. Immune damage was an important mechanism of liver failure, and the infiltration of immune cells and cytokine storms were important factors (She et al., 2022).

The present study suggests that the inflammatory response can be regulated by inhibiting the activation of Wnt5a/JNK to alleviate liver damage in TCE-sensitization mice.

Conclusion

Our findings demonstrated that Wnt5a/JNK was involved in the regulation of liver injury in TCE-sensitization mice, which aggravated liver injury by activating Kupffer cells and releasing chemokines. It was also suggested that Wnt5a/JNK could be used as a potential regulator to control immune liver injury induced by TCE exposure.

Footnotes

Acknowledgements

We want to thank the Platform of Environmental Exposure and Life Health Research at Anhui Medical University. The authors would like to thank all the authors for their research, which we quoted in our paper.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Natural Science Foundation of China (82273602, 82173494) and the Open Project of Key Laboratory of Dermatology (Anhui Medical University), Ministry of Education (No AYPYS2024-4). Anhui Province student innovation and entrepreneurship training program.

Ethical statement

ORCID iD

Lei Gao

References

Abo El-Nasr

NME

Saleh

Mahmoud

, et al. (2020) Olmesartan attenuates type 2 diabetes-associated liver injury: crosstalk of AGE/RAGE/JNK, STAT3/SCOS3 and RAS signaling pathways. European Journal of Pharmacology 874: 173010.

Al-Griw

Alghazeer

Al-Azreg

, et al. (2016) Cellular and molecular etiology of hepatocyte injury in a murine model of environmentally induced liver abnormality. Open Veterinary Journal 6(3): 150–157.

Baeck

Wehr

Karlmark

, et al. (2012) Pharmacological inhibition of the chemokine CCL2 (MCP-1) diminishes liver macrophage infiltration and steatohepatitis in chronic hepatic injury. Gut 61(3): 416–426.

Blumenthal

Ehlers

Lauber

, et al. (2006) The Wingless homolog WNT5A and its receptor Frizzled 5 regulate inflammatory responses of human mononuclear cells induced by microbial stimulation. Blood 108(3): 965–973.

Chiu

Jinot

Scott

, et al. (2013) Human health effects of trichloroethylene: key findings and scientific issues. Environmental Health Perspectives 121(3): 303–311.

Dorsey

Greenamyre

Willis

(2023) The water, the air, the marines-camp lejeune, trichloroethylene, and Parkinson disease. JAMA Neurology 80(7): 663–665.

Endo

Nishita

Minami

(2012) Analysis of Wnt/planar cell polarity pathway in cultured cells. Methods in Molecular Biology 839: 201–214.

Fainboim

Cherñavsky

Paladino

, et al. (2007) Cytokines and chronic liver disease. Cytokine & Growth Factor Reviews 18(1-2): 143–157.

Gilbert

Przybyla

Pumford

, et al. (2009) Delineating liver events in trichloroethylene-induced autoimmune hepatitis. Chemical Research in Toxicology 22(4): 626–632.

10.

Jiao

Liu

, et al. (2022) Occupational health effect of TCE exposure: experiment evidence of gene-environment interaction in hypersensitivity reaction. Chemico-Biological Interactions 368: 110220.

11.

Kim

Noh

Hwang

, et al. (2018) Hepatocyte SHP deficiency protects mice from acetaminophen-evoked liver injury in a JNK-signaling regulation and GADD45β-dependent manner. Archives of Toxicology 92(8): 2563–2572.

12.

Kumar

Singh

Kini

, et al. (2015) JNK pathway signaling: a novel and smarter therapeutic target for various biological diseases. Future Medicinal Chemistry 7(15): 2065–2086.

13.

Zhang

, et al. (2018) Wnt5a suppresses inflammation-driven intervertebral disc degeneration via a TNF-α/NF-κB-Wnt5a negative-feedback loop. Osteoarthritis and Cartilage 26(7): 966–977.

14.

Zhao

, et al. (2020) Nobiletin protects against acute liver injury via targeting c-jun N-terminal kinase (JNK)-Induced apoptosis of hepatocytes. Journal of Agricultural and Food Chemistry 68(27): 7112–7120.

15.

Liu

Chu

, et al. (2020) SFRP5 mediates downregulation of the wnt5a/caveolin-1/JNK signaling pathway. Journal of Endocrinology 247(3): 263–272.

16.

Marra

Tacke

(2014) Roles for chemokines in liver disease. Gastroenterology 147(3): 577–594.

17.

Nakajima

Wang

Yuan

, et al. (2022) Increased serum anti-CYP2E1 IgG autoantibody levels may be involved in the pathogenesis of occupational trichloroethylene hypersensitivity syndrome: a case‒control study. Archives of Toxicology 96(10): 2785–2797.

18.

Ordaz

Damayanti

Irudayaraj

JMK

(2017) Toxicological effects of trichloroethylene exposure on immune disorders. Immunopharmacology and Immunotoxicology 39(6): 305–317.

19.

Rim

Clevers

Nusse

(2022) The wnt pathway: from signaling mechanisms to synthetic modulators. Annual Review of Biochemistry 91: 571–598.

20.

Sahin

Borkham-Kamphorst

ONT

, et al. (2013) Proapoptotic effects of the chemokine, CXCL-10 are mediated by the noncognate receptor TLR4 in hepatocytes. Hepatology 57(2): 797–805.

21.

Sakaida

Hironaka

Terai

, et al. (2003) Gadolinium chloride reverses dimethylnitrosamine (DMN)-induced rat liver fibrosis with increased matrix metalloproteinases (MMPs) of Kupffer cells. Life Sciences 72(8): 943–959.

22.

Seki

Brenner

Karin

(2012) A liver full of JNK: signaling in regulation of cell function and disease pathogenesis, and clinical approaches. Gastroenterology 143(2): 307–320.

23.

She

Ren

Chen

, et al. (2022) Functional roles of chemokine receptor CCR2 and its ligands in liver disease. Frontiers in Immunology 13: 812431.

24.

Valdiviezo

Brown

Michell

, et al. (2022) Reanalysis of trichloroethylene and tetrachloroethylene metabolism to glutathione conjugates using human, rat, and mouse liver in vitro models to improve precision in risk characterization. Environmental Health Perspectives 130(11): 117009.

25.

Wang

Zhang

, et al. (2015) An animalmodel of trichloroethylene-induced skin sensitization in BALB/c mice. International Journal of Toxicology 34(5): 442–453.

26.

Wang

Huang

, et al. (2021) Renal tubular cell necroptosis: a novel mechanism of kidney damage in trichloroethylene hypersensitivity syndrome mice. Jounal of Immunotoxicology 18(1): 173–182.

27.

Wang

Sun

, et al. (2022) Diacerein protects liver against APAP-induced injury by targeting JNK and inhibiting JNK-mediated oxidative stress and apoptosis. Biomedicine & Pharmacotherapy 149: 112917.

28.

Wild

Elghajiji

Grimaldos

, et al. (2020) The canonical Wnt pathway as a key regulator in liver development, differentiation and homeostatic renewal. Genes 11(10): 1163.

29.

Xie

Yang

Tian

, et al. (2016) Macrophage migration inhibitor factor upregulates MCP-1 expression in an autocrine manner in hepatocytes during acute mouse liver injury. Scientific Reports 6: 27665.

30.

Yang

Mowry

Nejak-Bowen

, et al. (2014) β-catenin signaling in murine liver zonation and regeneration: a Wnt-Wnt situation. Hepatology 60(3): 964–976.

31.

Zeng

Awan

Otruba

, et al. (2007) Wnt’er in liver: expression of Wnt and frizzled genes in mouse. Hepatology 45(1): 195–204.

32.

Zhang

Wang

, et al. (2017) The immune response in trichloroethylene hypersensitivity syndrome: a review. Toxicology and Industrial Health 33(11): 876–883.

33.

Zhang

Yang

, et al. (2020) Kupffer cell inactivation ameliorates immune liver injury via TNF-α/TNFR1 signal pathway in trichloroethylene sensitization mice. Immunopharmacology and Immunotoxicology 42(6): 545–555.

34.

Zhang

Yang

Huang

, et al. (2021) TNF-α/TNFR1 regulates the polarization of Kupffer cells to mediate trichloroethylene-induced liver injury. Ecotoxicology and Environmental Safety 30(230): 113141.

35.

Zhu

Rao

Qian

, et al. (2022) Liver endothelial Heg regulates vascular/biliary network patterning and metabolic zonation via Wnt signaling. Cell Molecular Gastroenterology and Hepatology 13(6): 1757–1783.

36.

Zimmermann

Tacke

(2011) Modification of chemokine pathways and immune cell infiltration as a novel therapeutic approach in liver inflammation and fibrosis. Inflammation Allergy Drug Targets 10(6): 509–536.

37.

Zuo

Liu

, et al. (2022) Wnt 5a mediated inflammatory injury of renal tubular epithelial cells dependent on calcium signaling pathway in Trichloroethylene sensitization mice. Ecotoxicology and Environmental Safety 243: 114019.