In vitro study of antibacterial and osteogenic activity of titanium metal releasing strontium and silver ions

Abstract

Peri-prosthetic infection and loosening of implants are major problems in orthopaedic and dental surgery. To address these issues, surface treatment methods for titanium implants have been improved by modifying the alkali and heat treatment. We have previously fabricated calcium-treated Ti metal that releases Sr ions (CaSr-Ti), which resulted in a higher in vitro osteogenic response and early in vivo bone bonding.

Further, we developed a Ti metal that released both Sr and Ag ions (CaSrAg-Ti). In this study, we evaluated the antibacterial ability and osteogenic cellular response of CaSrAg-Ti and CaSr-Ti in vitro using rat bone marrow stromal cells (BMSCs) cultured on implant samples and extract mediums (EMs) made by immersing the implant samples in the medium. CaSrAg-Ti did not show cytotoxicity and was associated with a slightly higher osteogenic response when compared to CaSr-Ti, without inhibiting the effect of Sr. The osteogenic response was also observed in the cells cultured with the CaSrAg-Ti EM; however, the response was not as high as that of the cells on the CaSrAg-Ti implant sample. Significantly higher antibacterial activity was observed along with an antibacterial efficacy of more than 95% against methicillin-susceptible Staphylococcus aureus and Escherichia coli. The main advantages of our surface treatment are its simplicity and low cost. Therefore, our treatment is promising for clinical applications in orthopaedic or dental Ti-based implants with antibacterial and early bone-bonding abilities.

Keywords

Silver ion strontium ion antibacterial activity ion release titanium surface treatment

Introduction

Peri-prosthetic infection is among the most common complications in orthopaedic surgery. The infection rates in total joint arthroplasty (TJA) and spinal fusion surgery (SFS) have been reported to be 0.2%–3%¹ and 2.0%–4.4%,² respectively, with an associated one-year mortality rate of 8.0%–25.9%.³ To heal the infection, patients are subjected to repeated surgeries, enormous medical costs, long hospital stays, and implant removal.⁴ Therefore, preventing infection around implants is an important problem that needs to be solved. One method is to develop implants with antibacterial abilities. Among several antibacterial chemical substances, Ag ions are among the most promising antibacterial agents,⁵ and have already been used for manufacturing urethral⁶ and vascular catheters⁷ as well as prostheses for total hip arthroplasty.⁸

Implantation into osteoporotic bone is another concern in TJA and SFS because of the risk for insufficient initial fixation, which results in loosening of the implant.⁹ This issue can be addressed by improving the bone density around the implant. Strontium ranelate, an anti-osteoporotic agent, has a two-way effect on bone remodelling, in that it can simultaneously promote bone formation and decrease bone resorption.¹⁰ Numerous studies have reported that Sr ions promote osteoblast proliferation and differentiation, while reducing osteoclast differentiation, activity, and bone resorption.¹¹

Kokubo et al. developed an alkali and heat treatment (AHT) method,¹² which can bestow Ti and its alloys with bone-bonding ability. This method has been successfully applied clinically to total hip arthroplasty¹³ and SFS¹⁴ by using porous Ti surfaces. We further modified the AHT methods to incorporate various elements into the Ti surface. The incorporation of Ca to form Ca-Ti led to an improved apatite forming ability in a simulated body fluid (SBF) together with bone-bonding ability.¹⁵ Moreover, additional incorporation of Sr led to the formation of CaSr-Ti, which exhibits early bonding between the implant and bone due to the release of Sr from CaSr-Ti.¹⁶,¹⁷ To impart antibacterial properties, Ag was incorporated into CaSr-Ti to form CaSrAg-Ti,¹⁸ which exhibited a release of 1.29 and 1.69 ppm for Sr and Ag ions, respectively. This material has shown good apatite formation in SBF and excellent antibacterial ability against Escherichia coli.¹⁸ Previous studies on CaSrAg-Ti have widely adopted the standard film contact method (ISO22196) for evaluating the antibacterial activity.¹⁹ Although these methods are suitable for evaluating the bacterial contact-killing materials,²⁰ they are probably not suitable for body implants because of the presence of interstitial fluid or blood around such implants. Therefore, we evaluated the antibacterial activity by a method in which foetal bovine serum (FBS) was used as a culture medium and implants were soaked in the medium during the culture time. The aim of this study was to evaluate the in vitro cellular osteogenic response and antibacterial ability of CaSrAg-Ti, that had been exposed to methicillin-susceptible Staphylococcus aureus (MSSA) and E. coli in an imitated body.

Materials and methods

Sample preparation

Commercially pure Ti (cp-Ti; >99.5%; Nilaco Co., Japan) was cut into discs (18 mm diameter × 2 mm height) which were washed with acetone, 2-propanol, and ultrapure water in an ultrasonic cleaner for 30 min each and then dried at 40 °C. After cleaning, two types of surface-treated pure Ti were prepared: CaSr-treated Ti (CaSr-Ti) and CaSrAg-treated Ti (CaSrAg-Ti). These treatments have been described elsewhere.¹⁵,¹⁶ Pure Ti was initially subjected to treatment with 5 M NaOH at 60 °C for 24 h and then soaked in a solution of 50 mM CaCl₂ and 50 mM SrCl₂ at 40 °C for 24 h. Subsequently, it was subjected to a heat treatment at 600 °C for 1 h. It was finally soaked in 1 M SrCl₂ at 80 °C for 24 h to fabricate CaSr-Ti or in a mixture of 1 M Sr(NO₃)₂ and 1 mM AgNO₃ at 80 °C and pH 4 for 24 h to fabricate CaSrAg-Ti (Table 1). The three samples (cp-Ti, CaSr-Ti, CaSrAg-Ti) were sterilized with ethylene oxide gas and are shown in Figure 1.

Table 1.

Cp-Ti and two types of surface-treated Ti used in this study.

Sample	1st step	2nd step	3rd step	4th step
cp-Ti	None	None	None	None
CaSr-Ti	5 M NaOH; 60 °C; 24 h	50 mM CaCl₂ + 50 mM SrCl₂; 40 °C; 24 h	600 °C; 1 h	1 M SrCl₂; 80 °C; 24 h
CaSrAg-Ti	5 M NaOH; 60 °C; 24 h	50 mM CaCl₂ + 50 mM SrCl₂; 40 °C; 24 h	600 °C; 1 h	1 M Sr(NO₃)₂ + 1mM AgNO₃; 80 °C; 24 h; pH = 4

Isolation and culture of rat bone marrow derived stromal cells (BMSCs)

Rat bone marrow derived stromal cells (BMSCs) were obtained from 4-week-old male Sprague-Dawley rats. Their femur and tibia bones were extracted aseptically, and then the bone tips were cut to collect the BMSCs by flushing the bone marrow using an α minimum essential medium (Gibco, USA) supplemented with 15% FBS and 1% penicillin–streptomycin solution. Hereafter, this medium is referred to as the normal medium. The cells were cultured at 37 °C in a humidified atmosphere with 5% CO₂ for 48 h. After cell adherence, the culture medium was changed to remove floating tissues and non-adherent cells until 80%–90% confluence was achieved; subsequently, the cells were passaged and purified. The cells in passage 3 were used for the subsequent experiments.

This study was approved by the Animal Research Committee, Graduate School of Medicine, Kyoto University, Japan (Approval number; Med Kyo 18260).

Preparation of the extract medium (EM) from the implants

Each of the three types of implant were immersed in the normal medium to extract soluble factors. Ten disc-shaped samples were immersed in 50 mL of the normal medium for 7 days. Subsequently, the three types of extract medium (EM) were used for evaluating the cellular response to the soluble factors from the implants. The in vitro cellular responses were evaluated by two methods: 1) rat BMSCs were cultured on the sample implants with the normal medium; and 2) the cells on the plastic dish were cultured with the EM.

XTT cell viability assay

Rat BMSCs were seeded onto the three implant samples (cp-Ti, CaSr-Ti, and CaSrAg-Ti disc specimens) in 12-well plates at a density of 2 × 10⁴ cells/well and cultured in the normal medium. In addition, BMSCs were seeded in 12-well plates and cultured in the EMs. After 3 and 7 days, the XTT labelling reagent (Roche Applied Sciences, USA) was added to each well. After incubation for 3 h, 150 µL of the medium was transferred to a 96-well plate. The amount of formazan product was quantified by measuring the absorbance at 450 nm using a microplate reader (Multiskan JX, Thermo Labsystems, USA). Three samples were used for each type of Ti implant.

Quantitative reverse-transcription (RT-q) PCR

Rat BMSCs were seeded onto the three implant samples in 12-well plates at 5 × 10⁴ cells/well and cultured for 24 h as described in the previous section. In addition, BMSCs were seeded in 12-well plates and cultured in the EMs. The medium was subsequently changed to an osteogenic medium containing 10 mM β-glycerol phosphate and 50 µg/L ascorbic acid (both from Sigma-Aldrich, USA). After 1 and 2 weeks, total RNA was extracted using an RNeasy Mini Kit (Qiagen, Germany) as per the manufacturer’s protocol, and then reverse-transcribed with ReverTra Ace qPCR Master Mix (Toyobo, Japan). RT-qPCR was carried out on a LightCycler system (Roche) with Thunderbird SYBR qPCR Mix (Toyobo). Primer sequences are listed in Table 2. The expression levels of osteogenic differentiation-related genes (Runx2, Alp, Ocn, and Opn) were normalized with respect to those of β-actin. Four samples were used for each type of Ti implant.

Table 2.

Sequences of gene-specific primers used for RT-PCR analysis.

Gene	Primer sequence (F, forward; R, reverse; 5′-3′)
β-actin	F: CCCGCGAGTACAACCTTCT
	R: CGTCATCCATGGCGAACT
Runx2	F: CCACAGAGCTATTAAAGTGACAGTG
	R: AACAAACTAGGTTTGAGTCATCAAGC
Alp	F: GCACAACATCAAGGACATCG
	R: TCAGTTCTGTTCTTGGGGTACAT
Ocn	F: CTACCTCAACAATGGACTTGGA
	R: GAGCTCACACACCTCCCTGT
Opn	F: CAGCAGGACTGAAGGAGCTAA
	R: CACTGCCAGTCTCATGGTTG

Alkaline phosphatase (ALP) activity assay to evaluate cellular differentiation

Rat BMSCs were seeded onto the samples at 5 × 10⁴ cells/well in 12-well plates. In addition, BMSCs were seeded in 12-well plates as well and cultured in the EMs. After cell adherence, the medium was changed to the osteogenic medium as described above, and the cells were cultured for 7 days. The cells were then washed twice with normal saline and lysed with 1% NP-40 by extensive pipetting. After incubation with 6.7 mM p-nitrophenyl phosphate (Wako Pure Chemical Industries, Japan) at 37 °C for 30 min, the optical density at 405 nm was measured and alkaline phosphatase (ALP) activity was determined by extrapolation from a standard curve. The ALP activity was normalized against the total protein content. Four samples were used for each type of Ti implant.

Evaluating the cell morphology on the samples by scanning electron microscopy (SEM)

Rat BMSCs were seeded onto the samples at 2 × 10⁴ cells/well in 12-well plates. After three hours incubation, the cultured samples were gently rinsed with phosphate buffer saline (PBS) twice and fixed with 2.5% glutaraldehyde for 3 h. Thereafter, they were soaked in a graded series of ethanol (50%, 70%, 90%, 95%, 99%, 100%, and 100% [v/v]) for 3 min, and then coated with Pt-Pd. The cells attached to the samples were observed by scanning electron microscopy (SEM; S-4700, Hitachi Ltd., Japan).

Antibacterial assay

MSSA (ATCC 25923) and E. coli (ATCC 25922) were cultivated in tryptic soy broth (TSB) medium in a shaking incubator at 37 °C for 24 h and used as pathogens. The pathogen concentration in the culture was calculated from a pre-made calibration curve. The bacterial suspension was diluted with FBS to imitate in vivo conditions. The bacterial suspension (1.0 × 10⁶ CFU/mL; 400 μL) was seeded onto each sample in a 12-well plate and cultured at 37 °C for 24 h under aerobic condition. Subsequently, the planktonic bacteria were collected by gently sucking the culture medium and then counted. The Ti samples were then gently washed with PBS twice and soaked in 500 µL of PBS in a test tube. The attached bacteria were detached using an ultrasonic device (Branson CPX3800-J, EMERSON, USA) for 1 min and a vortex mixer for 3 min. The bacterial suspension was serially diluted with PBS in 10-fold steps and cultured on TSB agar plates for a further 24 h incubation. The planktonic and attached bacteria were counted and the antibacterial efficacy (ABE) was calculated using the following equation²¹

ABE = (B - A) / B \times 100 (%)

(1)

where A is the bacterial concentration on CaSr-Ti or CaSrAg-Ti, and B is that on cp-Ti (used as a control). Three samples were used for each type of Ti implant.

Live/dead assay

After the seeding and culture of bacteria on the samples, the bacterial cells were stained using Live/Dead BacLight Bacterial Viability Kits L7012 (Invitrogen, USA). The samples were gently rinsed with PBS twice, and then 500 µL of the reagent mixture was added. After incubation in the dark for 15 min, the samples were mounted and the bacteria on them were observed using fluorescence microscopy (BZ-X710, Keyence, USA).

Examination of bacteria by SEM

The bacterial suspension was seeded and cultured as described in antibacterial assay section. After culturing for 24 h, the samples were gently rinsed with PBS twice and fixed with 2.5% glutaraldehyde for 3 h. Thereafter, they were soaked in a graded series of ethanol (50%, 70%, 90%, 95%, 99%, 100%, and 100% [v/v]) for 3 min, and then coated with Pt-Pd. The bacteria attached to the samples were observed by SEM (S-4700; Hitachi Ltd., Japan).

Statistical analysis

All the data are represented as the mean value ± standard deviations. Among the three sample groups, statistically significant differences were determined using one-way analysis of variance (ANOVA) with a post-hoc Tukey’s HDS test. A value of p < 0.05 was considered statistically significant. All the analyses were performed using JMP Pro 11.0.0 (SAS Institute Inc., USA).

Results

Cell viability and osteogenic differentiation

The XTT assay for the cells on the samples showed no apparent cytotoxicity for CaSrAg-Ti at day 3 or 7, as shown in Figure 2(a). The XTT assay for the cells cultured with EM is shown in Figure 2(b). There were no significant differences among the EMs and the same tendency was observed for the results of all samples.

The expression of Runx2 in the cells on CaSrAg-Ti was significantly higher than in those on cp-Ti at day 7 and that in the cells on cp-Ti and CaSr-Ti at day 14 (Figure 3(a)). The expressions of Runx2 in the cells cultured with three EMs showed no differences at day 7, while a significant difference was observed between the cp-Ti and CaSrAg-Ti EMs at day 14 (Figure 3(b)). The expression of Alp in the cells on CaSrAg-Ti was significantly higher than in the cells on cp-Ti and CaSr-Ti at day 14, and a similar result was observed for the cells cultured with EMs. The expression levels of Ocn and Opn in the cells on CaSrAg-Ti were comparable with the respective levels in the cells on CaSr-Ti. The expressions of Ocn and Opn in the cells cultured with the EMs were mostly comparable with those in the cells on the implant samples. Generally, the gene expressions on the cells cultured with the EMs showed similar tendencies to the expressions of the cells on the implant samples; however, the expressions of the cells cultured with the EMs were slightly weaker than those of the cells cultured on the samples.

The ALP activity results were in agreement with the Alp expression results for both the cells on the samples and the cells cultured with EMs (Figure 4). The cells on the CaSrAg-Ti implant samples showed significantly higher ALP activity than those of the cells on the cp-Ti and CaSr-Ti implant samples. Similarly, the cells cultured with the CaSrAg-Ti EM showed significantly higher ALP activity than the cells cultured with the cp-Ti EM. However, the degree of the activity of the cells cultured with the CaSrAg-Ti EM was slightly weaker than that of the cells on the CaSrAg-Ti implant sample.

The morphologies of the cells on the implant samples are shown in Figure 5. The cells on CaSr-Ti and CaSrAg-Ti were extended widely on the samples and multiple pseudopodia were found. On the other hand, the cells on cp-Ti were adhered in a narrow shape, and only a few pseudopodia were observed.

Evaluation of the antibacterial effect

As shown in Figure 6, the colony forming units (CFUs) of planktonic and CaSrAg-Ti attached bacteria were significantly lower than those for cp-Ti and CaSr-Ti for both MSSA and E. coli. The ABE for CaSrAg-Ti was between 95% and 99% (Table 3).

Table 3.

Antibacterial efficacy of CaSr-Ti and CaSrAg-Ti against the selected bacteria.

Organism	MSSA
Organism	Attached bacteria		Planktonic bacteria
Sample type	CaSr-Ti	CaSrAg-Ti	CaSr-Ti	CaSrAg-Ti
ABE (%)	47.7 ± 45	97.7 ± 3.0	43.8% ± 33	96.0 ± 2.7

Organism	E. coli

	Attached bacteria		Planktonic bacteria

Sample type	CaSr-Ti	CaSrAg-Ti	CaSr-Ti	CaSrAg-Ti
ABE(%)	−84.4 ± 18.0	98.4 ± 1.7	−300 ± 52.0	97.2 ± 0.9

Note: Mean value ± standard deviation.

ABE: antibacterial efficacy; MSSA: methicillin-susceptible Staphylococcus aureus; E. coli: Escherichia coli.

The live/dead assay showed many viable bacteria (green spots) and almost no dead bacteria (red spots) on cp-Ti and CaSr-Ti for both of MSSA and E. coli (Figure 7(a)), whereas, CaSrAg-Ti had fewer viable bacteria and some dead bacteria.

For both MSSA and E. coli, fewer isolated and shrinking bacteria (yellow arrows) were observed on CaSrAg-Ti, as shown by the SEM images in Figure 7(b). However, no apparent bacterial membrane rupturing was observed among the three samples.

Discussion

In the present study, the cellular response to CaSrAg-Ti showed no cytotoxicity and a slightly higher expression of osteogenic differentiation-related genes, without any inhibition of the Sr ion osteogenic effect. A significant antibacterial activity of CaSrAg-Ti was also observed for both the attached and planktonic MSSA and E. coli. Previous studies on implants that contain Ag have reported a minimum inhibitory concentration range of 0.03–8.0 μg/mL against various bacterial strains.⁵ This wide range is mainly because no standard method for measuring the concentration has been established. Furthermore, the implant size, amount and type of solvent, and time of measurement also vary. In our previous study,¹⁸ CaSrAg-Ti Ag ion release at 1.69 ppm and antibacterial efficacy of 5.9-log reduction against E. coli were good enough for more than 99% ABE. Herein, the antibacterial ability of CaSrAg-Ti was significant; however, it was less than 99% ABE. Thus, an insufficient efficacy in the eradication of bacteria was achieved. To imitate an in vivo environment, we used FBS in the culture medium while soaking implants during the culture. As a result, the Ag ion release from CaSrAg-Ti may decrease. We believe that this environmental difference from the previous study is the main cause for the antibacterial activity of CaSrAg-Ti being weaker than that in the previous study. Consequently, modifying the treatment process to promote the release of more Ag ions without inducing any cytotoxicity may be necessary for improving the antibacterial effect. In addition, evaluation in an environment imitating in vivo conditions is necessary for clinical application.

The antibacterial mechanisms of Ag ions are numerous and not fully understood.²² These include inhibition of the phosphate uptake, bounding to the metabolic enzyme sulfhydryl group, altering the DNA into a condensed form, and generating reactive oxygen species. In this study, the SEM images revealed shrunk bacterial membrane, which has been reported in many other studies.^23–25 These studies^23,26 suggest that the thickness of the peptidoglycan layer of gram-positive bacteria may protect the bacterial cell from the influx of Ag ions, which would explain the higher activity of Ag against gram-negative bacteria. The slightly higher ABEs of E. coli compared to that of MSSA in both attached and planktonic bacteria is consistent with previous reports.^23,27–29 Although the mechanism of the antibacterial activity of the Ag ion was not explored in this study, our results do not conflict with those of the previous studies; further, based on the SEM images, it is deduced that Ag ions damaged the bacterial membrane.

The osteogenic related-genes and ALP activity in the cells cultured with the EMs showed similar tendencies to those of the cells cultured on the implant samples; however, the osteogenic response of the cells cultured with the EMs was somewhat lower than that on the cells cultured on the implants. Therefore, we posit that the osteogenic effect of the CaSrAg-Ti implant was derived from the soluble factors that were released from the implant, as well as the topographical features and Sr on the implant surface. However, culturing with EM does not completely reflect the culture environment of the soluble factors around the implant. A gradual release of ions was observed in the previous study,¹⁸ which can lead to an ion gradient near the implant. Cells attached to the implant can be considerably influenced by the released ions because of the locally high ion concentration near the implant. The microenvironment between the cells and the implant are not well known. This is one of the limitations of our study.

Expression levels of early osteogenic differentiation-related genes and ALP in the case of CaSrAg-Ti were higher than those for CaSr-Ti. To the best of our knowledge, there is no report in the literature that combined Ag with Sr to induce a higher osteogenic response. However, synergistic effect of combining zinc (Zn) with Ag on osteogenic cellular response has been reported.²⁵ It has been demonstrated that the galvanic-couple between Zn and Ag could result in the release of more Zn ions from the implant. We speculate that the higher Runx2 and Alp expression as well as the ALP activity in the present study can be attributed to this galvanic phenomenon. In fact, the release of Sr ions from CaSrAg-Ti was slightly higher than that from CaSr-Ti.^16,18 Although the expression levels of the late osteogenic marker genes, Opn and Ocn, in cells on CaSrAg-Ti were almost equal to those in the case of CaSr-Ti, the galvanic phenomenon can be generated on the implant surface.

The advantages of our treatment include low cost, simplicity, and ease of application to any shape; this is because the process involves only immersion and heat treatment, thereby enabling its application to inner surface of complicated structure. However, there are some limitations of the present study. First, this is predominantly an in vitro study, wherein an in vivo environment has been imitated to the best of our abilities. However, our attempt to imitate the in vivo environment by using the different media made it difficult to interpret the results. Therefore, there is need to evaluate the antibacterial activity and osteogenic ability of CaSrAg-Ti in vivo in future studies. Second, we did not evaluate the antibacterial activity against other organisms, for example fungi. We used MSSA and E. coli as representative organisms for gram-positive cocci and gram-negative rods. Although Ag ion has an antibacterial effect on most species, the effect on other organisms needs to be evaluated along with the required Ag content in implants to effectively eradicate different species.²⁶ Third, the origin of the osteogenic effect of CaSrAg-Ti was not fully indicated, as discussed above. Our study confirmed that the released ions did influence the osteogenic response of the cells, but it was not the only factor. Fourth, we used pure Ti metal in the present study, whereas Ti alloy is predominantly used for clinical application owing to its mechanical strength and ease of processing. Therefore, future studies are needed, wherein our treatment method is applied to Ti alloy implants as well.

Conclusions

Herein, the surface treated Ti that released Sr and Ag ions exhibited no cytotoxicity and a reasonable cellular response without inhibition of the osteogenic effect of Sr ions in rat BMSCs. Moreover, significantly higher antibacterial activities against MSSA and E. coli were also observed in vitro. The advantages of our treatment are its simplicity and low cost, rendering it promising for clinical applications in orthopaedic or dental Ti-based implants with antibacterial and early bone-bonding abilities. Further studies are needed to confirm the effect against other organisms, to assess the in vivo effects of Ti implants treated using our method, and to test our treatment methods on Ti alloy implants.

Footnotes

Declaration of conflicting interests

The author(s) declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: SF and KG were financially supported by KYOCERA, Kyoto, Japan.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by a research grant from the Japan Society for the Promotion of Science (KAKENHI Grant No. 18K09028).

ORCID iD

Yaichiro Okuzu

References

Porrino

Wang

Moats

, et al. Prosthetic joint infections: diagnosis, management, and complications of the two-stage replacement arthroplasty. Skeletal Radiol 2020; 49: 847–859.

Sono

Fujibayashi

Izeki

, et al. Decreased rate of surgical site infection after spinal surgery with instrumentation using bundled approach including surveillance and intrawound vancomycin application. Medicine (Baltimore) 2018; 97: e12010.

Otto-Lambertz

Yagdiran

Wallscheid

, et al. Periprosthetic infection in joint replacement. Dtsch Arztebl Int 2017; 114: 347–353.

Anderson

Savage

Vaccaro

, et al. Prevention of surgical site infection in spine surgery. Neurosurgery 2017; 80: S114–123.

Ferraris

Spriano

Antibacterial titanium surfaces for medical implants. Mater Sci Eng C Mater Biol Appl 2016; 61: 965–978.

Davenport

Keeley

FX.

Evidence for the use of silver-alloy-coated urethral catheters. J Hosp Infect 2005; 60: 298–303.

Casey

Karpanen

Nightingale

, et al. Microbiological comparison of a silver-coated and a non-coated needleless intravascular connector in clinical use. J Hosp Infect 2012; 80: 299–303.

Eto

Kawano

Someya

, et al. First clinical experience with thermal-sprayed silver oxide-containing hydroxyapatite coating implant. J Arthroplasty 2016; 31: 1498–1503.

Aro

Alm

Moritz

, et al. Low BMD affects initial stability and delays stem osseointegration in cementless total hip arthroplasty in women: a 2-year RSA study of 39 patients. Acta Orthop 2012; 83: 107–114.

10.

Boivin

Doublier

Farlay

Strontium ranelate – a promising therapeutic principle in osteoporosis. J Trace Elem Med Biol 2012; 26: 153–156.

11.

Saidak

Marie

PJ.

Strontium signaling: molecular mechanisms and therapeutic implications in osteoporosis. Pharmacol Ther 2012; 136: 216–226.

12.

Kokubo

Miyaji

Kim

, et al. Spontaneous formation of bonelike apatite layer on chemically treated titanium metals. J Am Ceramic Soc 1996; 79: 1127–1129.

13.

Kawanabe

Ise

Goto

, et al. A new cementless total hip arthroplasty with bioactive titanium porous-coating by alkaline and heat treatment: average 4.8-year results. J Biomed Mater Res Part B Appl Biomater 2009; 90: 476–481.

14.

Fujibayashi

Takemoto

Neo

, et al. A novel synthetic material for spinal fusion: a prospective clinical trial of porous bioactive titanium metal for lumbar interbody fusion. Eur Spine J 2011; 20: 1486–1495.

15.

Kizuki

Takadama

Matsushita

, et al. Preparation of bioactive Ti metal surface enriched with calcium ions by chemical treatment. Acta Biomater 2010; 6: 2836–2842.

16.

Yamaguchi

Nath

Matsushita

, et al. Controlled release of strontium ions from a bioactive Ti metal with a Ca-enriched surface layer. Acta Biomater 2014; 10: 2282–2289.

17.

Okuzu

Fujibayashi

Yamaguchi

, et al. Strontium and magnesium ions released from bioactive titanium metal promote early bone bonding in a rabbit implant model. Acta Biomater 2017; 63: 383–392.

18.

Yamaguchi

Minh Le

Ito

, et al. Tri-functional calcium-deficient calcium titanate coating on titanium metal by chemical and heat treatment. Coatings 2019; 9: 561.

19.

ISO221962011. Measurement of antibacterial activity on plastics and other non-porous surfaces.

20.

van de Lagemaat

Grotenhuis

van de Belt-Gritter

, et al. Comparison of methods to evaluate bacterial contact-killing materials. Acta Biomater 2017; 59: 139–147.

21.

Song

Ryu

Hong

SH.

Antibacterial properties of Ag (or Pt)-containing calcium phosphate coatings formed by micro-arc oxidation. J Biomed Mater Res A 2009; 88: 246–254.

22.

Lim

Chang

Thian

ES.

Development of nanosized silver-substituted apatite for biomedical applications: a review. Nanomedicine 2015; 11: 1331–1344.

23.

Feng

Chen

, et al. A mechanistic study of the antibacterial effect of silver ions on Escherichia coli and Staphylococcus aureus. J Biomed Mater Res 2000; 52: 662–668

24.

Lim

Chang

Tay

, et al. Proposed mechanism of antibacterial action of chemically modified apatite for reduced bone infection. ACS Appl Mater Interfaces 2014; 6: 17082–17092.

25.

Jin

Qin

Cao

, et al. Synergistic effects of dual Zn/Ag ion implantation in osteogenic activity and antibacterial ability of titanium. Biomaterials 2014; 35: 7699–7713.

26.

Jung

Koo

Kim

, et al. Antibacterial activity and mechanism of action of the silver ion in Staphylococcus aureus and Escherichia coli. Appl Environ Microbiol 2008; 74: 2171–2178

27.

Geng

Wang

Zhuo

, et al. Incorporation of silver and strontium in hydroxyapatite coating on titanium surface for enhanced antibacterial and biological properties. Mater Sci Eng C Mater Biol Appl 2017; 71: 852–861.

28.

Cheng

Xiong

Fang

, et al. Strontium (Sr) and silver (Ag) loaded nanotubular structures with combined osteoinductive and antimicrobial activities. Acta Biomater 2016; 31: 388–400.

29.

Geng

Cui

, et al. Strontium incorporation to optimize the antibacterial and biological characteristics of silver-substituted hydroxyapatite coating. Mater Sci Eng C Mater Biol Appl 2016; 58: 467–477.