3D printable Sodium alginate-Matrigel (SA-MA) hydrogel facilitated ectomesenchymal stem cells (EMSCs) neuron differentiation

Abstract

Ectomesenchymal stem cells (EMSCs) are typical adult stem cells obtained from the cranial neural crest. They have the potential to differentiate into various cell types, such as osseous cells, neurons and glial cells. Three-dimensional (3 D) printing is a novel method to construct biological structures by rapid prototyping. Previously, our group reported on the stemness and multi-lineage differentiation potential of EMSCs on gels. However, the exploration of EMSCs in 3 D printing and then evaluation of the growth and neuronal differentiation of EMSCs on extruded 3 D printable hybrid hydrogels has not been reported. Therefore, the current study explored the novel hybrid Sodium alginate-Matrigel (SA-MA) hydrogel extruded 3 D printing to design an in vitro scaffold to promote the differentiation and growth of EMSCs. In addition, the physical properties of the hydrogel were characterized and its drug-releasing property determined. Notably, the results showed that the construct exhibited a sustain-released effect of growth factor BDNF in accordance with the Higuchi equation. Moreover, the cell survival rate on the 3 D printed scaffold was 88.22 ± 1.13% with higher neuronal differentiation efficiency compared with 2 D culture. Thus, SA-MA’s ability to enhanced EMSCs neuronal differentiation offers a new biomaterial for neurons regeneration in the treatment of spinal cord injury.

Keywords

3D bioprinting ectomesenchymal stem cells hydrogel neuronal differentiation

Introduction

Generally, stem cell-based therapies are applied to treating or preventing disease condition. They have the ability to recognize and differentiate into diverse types of cells as well as self-renewal to produce more stem cells. Thus, stem cells can develop into multiple types of cells with different functions.¹ Emerging evidence indicated that stem cells have unique advantages in repairing spinal cord injury.² However, stem cells with multi-directional differentiation coupled with scaffolds that have the potential to facilitate neuronal differentiation is a novel strategy worth exploring in nerve regeneration. Mesenchymal stem cells (MSCs), a type of stem cells widely found in fat, muscle, bone marrow, umbilical cord, amniotic fluid, etc. and they often differentiate into cartilage, bone and fat. In addition, evidence indicated that they have the ability to differentiate into muscle, endothelial cells and various cells of the heart, liver and kidney, as well as the nervous and reproductive systems.³ Ectomesenchymal stem cells (EMSCs), a type of MSCs are typical adult stem cells obtained from the cranial neural crest. They have the potential to differentiate into diverse cell types, such as osseous cells, neurons and glial cells.^4–6 Also, the lamina propria of the nasal mucosa is a good source for the isolation of EMSCs.⁷ Report revealed that EMSCs implanted into collagen scaffolds differentiated into nerve cells and then improved the repairing of spinal cord injury (SCI).²

The SCI is a serious disease culminating a major public health concern worldwide and typically resulting in multiple complications related to consequences of the high chances of mortality.^1,2 Owing to its complex pathophysiological process associated with inflammation, axonal injury, cavity formation, glial scar and myelin inhibitory factor, the repair of spinal cord injury is not conducive with regards to the microenvironment formed.^3,4 Although numerous researches have achieved encouraging results in the treatment of SCI in animals,^4–6 however, at present, there is no effective clinically treatment strategy. Thus, there is unmet need to discover more efficient ways to curtail spinal cord dysfunction. Based on the promising potential of 3 D-printable Matrigel hybrid constructs for cell culture and tissue engineering,⁸ here, we developed 3 D-printable Matrigel-alginate constructs to enhance the differentiation ability of EMSCs into neurons.

The 3 D bioprinting is a computer aided method that could specifically deposit biological materials and living cells in a layer-by-layer fashion to produce precise 3 D biological structures.^9,10 Exemplary, cells-laden tissues such as skin and cartilage were prepared by inkjet printing techniques.^11–13 However, the composition and material features of bioinks must have printability, biocompatibility and appropriate mechanical properties. Hydrogels prepared from polysaccharides have the advantage of rapid prototyping, such as hyaluronic acid, agarose, and alginate. It has been reported that polysaccharides were used to print vessel-like structures,^12,13 porous constructs,^14,15 and aortic valve conduits.¹⁶ Among the aforesaid hydrogels, alginate has been employed by several researchers in the field of 3 D printing due to its inherent viscosity and elasticity as a suitable bio-ink. Of note, alginate forms a large pore size after gelation, which is important for the delivery of therapeutic drugs, nutrients and cellular metabolites. On the other hand, Protein-derived hydrogels, such as Matrigel, mimic the extracellular matrix components that promote cell adhesion on the scaffold^14–17 . Although it has good biocompatibility, its tumor-derived nature has certain risks for transplantation in in vivo. Recently, durable Matrigel-based culture systems were established for intestinal stem cells.^18,19 Nevertheless, as a common characteristic properties of most protein-based hydrogels, Matrigel possess poor mechanical features and unfavorable for printing,²⁰ which considerably restricts its application as a bio-ink for 3 D printing.

Based on the above-mentioned advantages and disadvantages of alginate and Matrigel, the interest of the current work lies in: the combination of alginate and Matrigel into a hybrid hydrogel system, measurement of the viscosity of the resulting hydrogel, assessments of the biocompatibility, drug release and degradability of the hydrogel and then application of the hydrogel as bio-ink to print a 3 D scaffold to facilitate the differentiation of EMSCs into neurons in vitro. Notably, the prepared 3 D printed hydrogel system SA-MA had a higher neuronal differentiation efficiency compared with 2 D cultured cells. Therefore, the current study provides a novel strategy for the study of neuronal differentiation of EMSCs and could be useful in the construction of effective biological scaffolds for the treatment of spinal cord injury.

Materials and methods

Materials

DME/F-12 medium was purchased from Hyclone (Utah, UAS). Neurobasal medium, B27 supplement, and fetal bovine serum (FBS) were purchased from Gibco (Grand Island, NY, USA). Rabbit monoclonal anti-Sox1, anti-Sall4, anti-Sox10, anti-vimentin, anti-cx43 and mouse monoclonal anti-TUJ1 were purchased from Abcam (MA, USA). Mouse monoclonal anti-s100 were bought from Sigma Aldrich (St. Louis, MO, USA). Mouse Monoclonal anti-TAU, Rabbit Polyclonal anti-MAP2 were purchased from Proteintech (Proteintech, Shanghai, China). Rabbit monoclonal anti-NF200 were purchased from Boster (Boster, Wuhan, China). Epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), nerve growth factor (NGF), brain derived neurotrophic factor (BDNF), and sonic hedgehog (SHH) were bought from PeproTech (Rocky Hill, NJ, USA). Sodium alginate powder and Matrigel were purchased from Sigma-Aldrich (St. Louis, MO, USA) and BD (Corning, NY, USA) respectively.

EMSCS derived from the nasal mucosa

About 120 to 140 g Sprague Dawley rats were anesthetized and dissected to obtain EMSCs. A total of 10 to female SD rats were used in the experiment. Under aseptic condition, skin and nasal bone were cut up from nasal cavity to inner canthus through nostril to expose nasal cavity. The inferior part of nasal septum was removed and placed in DMEM/F12 medium. The whole nasal mucosa was stripped and the nasal septum cartilage was discarded. The precipitated tissue and cells were dispersed with DMEM/F12 of 10% fetal bovine serum, inoculated in culture flask, and then cultured in cell culture box under conditions of 37 °C temperature, 5% CO₂. After 7 days, the culture medium and suspended tissue were sucked out and discarded, and then replenish with a new medium. Subsequently, the medium was changed once every 3 days, digested and passaged when the cell density reached 80% confluence.

Detection of stem cell markers

In order to determine the level of expression of stem cell markers, the primary and passaged EMSCs were stained with immunofluorescence. First, the EMSCs were fixed with 4% paraformaldehyde for 30 minutes. Then it was washed three times with a phosphate buffer. 0.5% Triton-X100 was used as perforating agent and 5% BSA as sealing fluid. The cells were immunofluorescence-stained with antibodies against various stem cell markers, including SOX1, Sall4, SOX10, s100, Vimentin and Cx43. The markers TUJ1 and NF-200 were used as negative controls. Immunofluorescence microscope (Nikon Ti-E, Tokyo, Japan) was used to observe the stained EMSCs.

Preparation of bio-ink material

In order to make it more suitable hydrogel for use as bio-ink for 3 D printing, alginate needs to be selectively combined with other polymeric materials to form a hybrid hydrogel. A mixture of SA-Polyvinyl alcohol (PVA) (1.0/1.0), SA-hyaluronic acid (HA) (1.0/1.0), SA-gelatin (GA) (1.0/1.0) and SA-Matrigel (1.0/30.0) were prepared with 500 μL each. An equal amount of 3% CaCl₂ was added as a crosslinking agent to measure the time of its complete gelatinization. The 3 D printer was used to investigate its printability online and to measure the minimum squeezable printing volume of hydrogel.

A solution of 2% (w/v) alginate and Matrigel were mixed at a volumetric proportion of 2: 1 plus DMEM/F12 to acquire a concentration of 0.5% alginate and 30% Matrigel. Finally, EMSCs (3.0 x 10⁵/mL) was centrifuged, supernatant discarded, and resulting cells (about 1.0 x 10⁵/ml) resuspended in alginate-Matrigel hydrogel as bio-ink for printing.

Viscosity characterization of ink formulations

Rotational rheometer (TA Discovery DHR-1, USA) equipped with two concentric parallel plates (diameter: 40 mm) was used to analyze Rheological parameters. The gap was 1 mm for all measurements. the steady shear was measured within the shear rate range of 0.01–100 s⁻¹. The printability of hydrogel was studied by online 3 D printing (Thermo, USA). A circular shape consisting of 22 droplets with a diameter of 10 mm was designed. The evaluation index is the graphical integrity of the residual hydrogel on the needle.

The dual-channel printing of the 3 D bioprinter is used to construct a biological scaffold. The SA-MA solution was prepared as the printing filler in channel 1. Prepare a 3% CaCl₂ solution as a cross-linking agent for the printing filler in channel 2. The hydrogel scaffold is placed in a carbon dioxide incubator and cross-linked for 15 minutes to cure the gel. The printing parameters of the channels are shown in Table 1.

Table 1.

Print parameters of dual-channel 3 D bio-printer.

Parameter	Channel number
Parameter	1	2
Materials	SA-MA solution	3 % CaCl₂ solution
Valve opening time(μs)	1500	300
Pressure (Pa)	40	1
Print thickness(mm)	0.1	0.1
Layers	10	10
Total height(mm)	1	1

Table 2.

The primer sequences for each primer used in the real-time RT-PCR.

Genes		Primer sequences (5′ to 3′)	Annealing temperature (°C)
GAPDH	Forward	GACATGCCGCCTGGAGAAAC	60
	Reverse	AGCCCAGGATGACCTTTAGC	60
TUJ1	Forward	AGCTGTTCAAACGCATCTCG	60
	Reverse	GACACCAGGTCATTCATGTTGC	60
MAP2	Forward	TTCTCCACTGTGGCTGTTTG	60
	Reverse	GAGCCTGTTTGTAGTCTGGAAGA	60
NF200	Forward	AAGGTGCAAAATCCCTAGCTGA	60
	Reverse	GCTTCTGGAGACTTCACATCCA	60

Stability and drug release

To determine the stability of scaffold, different hydrogels scaffolds were placed in centrifuge tubes containing lysozyme buffer and then kept in 37 °C incubators. At the appointed time, the sample was centrifuged and the weight of the remaining support was measured. 100 ng BDNF was then incorporated into the 150 μL bio-ink SA-MA and printed into the dish. Next, CaCl₂ was added to facilitate the formation of hydrogels. Subsequently, the hydrogels were placed in DMEM/F 12 medium. At the settled points, the supernatant was extracted. The cumulative release of BDNF was tested by ELISA kit (Shanghai renjie biotechnology co., ltd, Shanghai, China) and was expressed as a percentage of the BDNF.

Cell viability and proliferation

The growth and viability of EMSCs cultured in printed scaffold were determined using fluorescence microscope (Nikon, Tokyo, Japan). The viability of cells in the scaffold was examined using Live/Dead kit (DOJINDO, Tokyo, Japan) according to the manufacturer’s instructions. Alamar Blue Kit (Solarbio, Beijing, China) was applied to investigate the proliferation of EMSCs under different culture conditions. At the designed time points, samples were washed with phosphate buffer solution two times and replaced with fresh medium containing 10% Alamar Blue at 37 °C for 4 h in the dark. After incubation, the optical density (OD) value of supernatant was measured at 590 nm wavelengths (Biotek Winooski, Vermont, USA).

Optimization of growth factors combination

The scaffold containing growth factors were prepared for the release of different combinations of BDNF, NGF, SHH growth factors into EMSCs for neuronal differentiation. EMSCs were cultured in 6-well plates, and the next day, DMEM/F-12 medium was replaced with induction medium. The composition of the induction medium was DMEM/F-12: Neuron basal =1:1, 1% B27 supplement, 1% N2 supplement, 20 ng/mL EGF, 20 ng/mL bFGF, 1% glutamine and 100 U/mL penicillin and 7 factor combinations (SHH (S), NGF(N), BDNF(B), SHH-NGF(SN), NGF-BDNF(NB), SHH-BDNF(SB), SHH-NGF-BDNF(SNB)) at 20 ng/mL. After induction culture for 2 weeks, the cells in the culture plate were collected for RNA extraction, and the expression level of the neuronal marker TUJ1 was measured using EMSCs cultured in the non-inducing medium as a control.

Neurogenic differentiation assay

The printed object was designed as a cylinder with a diameter of 8 mm and covered with three layers of hydrogels. The channel temperature of the print head was kept at 4 °C to prevent the Matrigel from solidifying.

Growth factor such as SHH, BDNF were added to the bio-ink, the scaffold was printed as described in Viscosity characterization of ink formulations and cross-linked in an incubator at 37 °C for 15 minutes. Basic induction medium was added, and the medium was changed every 2 days. Every 100 mL basal medium can be divided into 48 mL D/MEM-F12, 48 mL Neurobasal, 1% NEAA, 1% glutamine, 1% B27 supplement, 1% N2 supplement, 1% Penicillin-Streptomycin.

In 2 D culture, cells are directly seeded in a culture dish, basic induction medium is added, and same growth factors are additionally added to the medium, and the medium is changed every two days.

Immunofluorescence

The printed constructs were analyzed using immunofluorescence staining against the neuronal markers. In brief, the specific steps are the same as described in section Detection of stem cell markers above. Primary antibodies rabbit anti-MAP2 (1:200), rabbit anti-TAU (1:200), mouse anti-TUJ1 (1:200) and mouse anti-NF200 (1:200) were employed for neuronal differentiation. Primary antibody detection was done with Alexa-Fluor conjugated 488 horse anti-mouse IgG and CY3 horse anti-rabbit IgG. All secondary antibodies were diluted in the ratio of 1:300. Cell nucleus were stained with Hoechst33258 (1:5000). The immunofluorescence staining results were obtained by fluorescence microscope ((Nikon Ti-E, Tokyo, Japan) or laser scanning confocal microscope (Leica Microsystems, Wetzlar, Germany).

Quantitative real time PCR analysis

Cells were collected by dissolving the scaffold in sodium citrate solution as described in literature.²¹ The 2 D cultured cells were harvested with trypsin digestive method. Total RNA of cells was extracted following the instructions of the RNA extraction kit. RNA samples were mixed with primers and other reagents using the method of one-step reverse transcription PCR kit (Tiangen, China), and reverse transcription reaction was performed with LC96 (Roche, Switzerland). The primer sequences for each gene used in this study are shown in Table 1. The reaction procedure was set according to the kit instruction. 2^−ΔΔCt method were used to calculate relative gene expression.

Flowcytometry analysis

Cells in the scaffold were collected using the same method as in Quantitative real time PCR analysis and resuspended with phosphate buffered solution, then add 10 μL primary antibodies mouse anti-TUJ1 per 10⁶ cells at room temperature. Subsequently, sample were added Fluorescent secondary antibodies after being washed twice with phosphate buffered solution. The samples were incubated in dark for 30 minutes, washed and resuspended for detection.

Statistical analysis

Data were expressed as mean ± SD. SPSS 19.0 software (Chicago, IL, USA) was employed for the statistical analysis. Analysis of variance (AVOVA) was used to compare the data between groups, The Student’s t-test was then used to compare the mean differences. P-values < 0.05 were considered statistically significant.

Results

The morphology and stemness of the EMSCs

To confer whether the isolated primary cells are our targeted cells, we detected for the mesenchymal stem cell markers including Sox1, Sall4, Sox10, s100, vimentin and cx43 by immunofluorescence staining. In addition, neuronal markers TUJ1 and NF200 were tested as negative controls. Indeed, the obtained cells expressed the above-mentioned stem cell markers (C-H) whereas the neuronal markers were identified as negative (I-J). Thus, the result indicated the isolated primary cells were EMSCs (Figure 1(c) to (j)). From the results obtained (Figure 1(a) and (b)), EMSCS migrated from the nasal septum upon the attachment of tissue to the dish after 7 days of culturing.

Characterization of the bioinks

Gelation time

As shown in Figure 2(a), SA-HA gelation took the longest time up to 20 ± 0.40 min, followed by SA-PVA. SA-GA and SA-MA have similar gelation time. In the printing process, the extruder printer is used in this research. Even if the ratio of SA and gelatin is adjusted, online printing is difficult, while the SA-Matrigel group can reduce the Matrigel viscosity in hydrogels by controlling the printing outlet temperature to 4 °C, so as to improve the printability and obtain a more complete scaffold. Thus SA-MA group is the most suitable combination in terms of the complete gelation.

Viscosity and printability

Adjusting the proportion of alginate and Matrigel had a great impact on viscosity. The concentrations of two compositions were selected: 0.2%, 0.5%, and 1% (w/v) for alginate and then 30% and 50% (w/v) for Matrigel. The change in ink viscosity with shear rate for each formulation is shown in Figure 2(b). The hydrogel viscosity of 0.2/30, 0.2/50, 0.5/30, 0.5/50, 1/30 and 1/50 increased successively and their online printed results are shown in Figure 2(c). Indeed, the first three combinations indicated smooth printing. However, a higher viscosity will lead to an incomplete printed image as shown in Figure 2(d). Moreover, reducing the viscosity of the hydrogel facilitates extrusion printing, which protects cells from shear stress. Although the viscosity of 0.2/30 is low and easy to print, however, it was not conducive to molding. Of note, the viscosity of 0.2/50 and 0.5/30 are similar. Therefore, based on the high cost of Matrigel, 0.5/30 was selected as the most suitable hydrogel ratio.

Viability

The viability of the EMSCs as examined in the hydrogel are shown in Figure 2(e) to (g). The cells were cultured on three different scaffolds (SA-MA, 0.5% Sodium alginate and 30% Matrigel) for three days. The surviving cells were stained with Calcein as in green, and the dead cell binding PI in red. Ten fields were randomly selected and the dead or living cells were counted by image j. The cell survival rate of the three scaffolds are 88.22 ± 1.13%, 66.16 ± 2.9% and 78.56 ± 3.1%.

Stability and drug release

In order to measure the stability and the drug (i.e. growth factor) release by the prepared hydrogel, scaffolds were prepared with different composition of alginate and Matrigel.

From the degradation curves of the resulted hydrogels (Figure 3(a)), it is observed that with increasing amount of Matrigel the degradability of scaffolds decreases with time. Scaffolds containing only 0.5% alginate were easily degraded with time which indicated Matrigel’s ability to reinforce scaffold structure at room temperature. Neuronal differentiation is a long-term process and we investigated the growth factor sustained release ability of hydrogel scaffolds. Of note, among the growth factors employed in the current study, we emphasized on the release kinetics of BDNF (Figure 3(b)). Free BDNF was rapidly released in the first 6 hours (39%), and the release was then slowed down progressively to 2% per day for 7 consecutive days and then 2.3% for the remaining days over a week. At 4 h, a burst release rose to 3.1% per hour. Collectively, the release plot of free BDNF from the hydrogel conformed to the Higuchi model (R2 = 0.9874). This reveals the release of free BDNF from the hydrogel materialized mainly by diffusion.

Proliferation in 3 D scaffold and changes of cell morphology

As shown in Figure 4(a), regardless of whether 2 D culture or 3 D culture of different bio-inks, viz; 3 D SA-MA, 3 D SA and 3 D MA the rate of cell proliferation rapidly increased in the first five days of culture. After 5 days, the growth rate decreased slightly and then increased again. Notably, the environment of hydrogel SA-MA was the most suitable for cell growth followed by 2 D culture. In the case of a hydrogel containing only SA, although the cells proliferated, however, the overall cell growth rate was not fast. Figure 4(b) to (e) is the morphology of the cells observed under a phase contrast microscope. After induction, it was observed the cells spread in the hydrogel as time progresses. The cell morphology was different from the typical fusiform shape of EMSCs, and dendrites appear between the cell bodies.

Differentiation of EMSCs into neurons

The differentiation of EMSCs into neurons is quantitatively dependent on the level of expression of mRNA of the associated markers such as TUJ1 and the type or combination of factors present in the cell microcosm. By screening for the best combination that would facilitate the level of expression of mRNA of TUJ1, our results indicated that the highest level of mRNA of TUJ1 was recorded by the combination that has all three factors coexisting (i.e. SNB), followed by SB (Figure 5(a)). Indeed, there was no significant difference between the mRNA level of expression of TUJ1 induced by the two combinations, SNB and SB. Therefore, the SB combination was selected for subsequent experiments. Nevertheless, the induction results of other combinations were lower than those of the two groups.

Neuronal differentiation of 2 D and 3 D cultured EMSCs was determined by immunofluorescence. Figure 5(c1) to (c4) are the results of immunofluorescence in 2 D culture. Figure 5(d1) to (d8) are the results of dual-color immunofluorescence in 3 D culture.

Immunofluorescence results showed that 2 D and 3 D cell neuron markers TUJ1, MAP2, TAU, and NF-200 were positive after 15 days of culture (Figure5 (c) to (d)), whereas 3 D cultured EMSCs extended longer neurites, which is more conducive to the formation of a neural network. RT-PCR was performed to quantify the mRNA expression of TUJ1, MAP2 and NF200. Both 2 D and 3 D cultures had different degrees of differentiation into neurons. For 3 D cultured cells, the mRNA expressions of TUJ1, MAP2 and NF-200 were 3.24 ± 0.321, 4.25 ± 0.231 and 2.34 ± 0.36 times higher than that of control on day 15, respectively (Figure 5(b)). To further confirm the differentiation efficiency of EMSCs, on day 15, differences in the TUJ1 phenotype ratio between the 3 D bioprint scaffold and the 2 D culture were assessed using flow cytometry. As shown in Figure 5(e), the proportion of cells with TUJ1 phenotype in 3 D culture was 39.1 ± 2.64% whiles it was 32.1 ± 2.55% in 2 D culture. It was observed that the percentage of TUJ1 phenotype cells in 3 D scaffolds was considerably higher than that in 2 D culture.

Discussions

The greatest advantage of 3 D printing is that it can produce tissue engineering products with high degree of adjustability and complexity. In the current study, we employed for the first time a normal routine extrusion-based 3 D bioprinting to construct an EMSCs model and to evaluate the differentiation behavior of EMSCs in 3 D bioprinted microenvironment into neurons. The key obstacle confronting the process of extrusion-based bioprinting is to avoid dripping and warrant smooth extrusion of a bioink via viscosity optimization. Hydrogels have been extensively applied to build microenvironments for 3 D-printed cell cultures.^22,23 These include but not limited to collagen, alginate, gelatin, hyaluronic acid, etc. However, the main drawbacks associated with these biomaterials is either insufficient mechanical properties or poor biocompatibility. Meanwhile, hybrid hydrogels have been recognized as potential hydrogels to build microenvironments for 3 D-printed cell cultures in order to overcome the above-mentioned drawbacks. Matrigel had been widely used for 3 D cell cultivation due to its good biocompatibility and thermo sensitivity. However, the complex component²⁴ of Matrigel hard to illustrate the mechanism of different cells cultivation and differentiation. Besides, the problem of oncogenesis²⁵ of Matrigel could not been avoided. In this research, to keep the high biocompatibility and reduce its tumorigenicity, the concentration of Matrigel was decreased, while the concentration of alginate was increased. Besides, the addition of alginate could offer a more stability mechanical properties due to the combination of CaCl_2.^26,27 Although there are few reported literatures on Matrigel hybrid hydrogels, however, sodium alginate-Matrigel (SA-MA) hybrid hydrogel extruded 3 D printing has not been reported. Therefore, this study explored SA-MA extruded 3 D printing to design an in vitro scaffold to promote the differentiation and growth of EMSCs. The SA-MA combination was chosen as a result of sodium alginate’s wide applications in tissue engineering and Matrigel’s biocompatible nature among others.

Researchers have assessed the mechanical properties of Matrigel-agarose hydrogel bioink, indicating that the concentration of Matrigel played an important role in compromising the elastic property of the hybrid hydrogel.⁸ Their results further revealed that 15% and 30% Matrigel had the desired mechanical properties for printing, whereas 50% Matrigel did not maintain the printed structure.⁸ Moreover, it has been documented that low viscosity hydrogels and appropriate nozzle diameter can greatly decrease the shear force produced during printing.²¹ In this study, hydrogel with 0.5% sodium alginate and 30% Matrigel was obtained by incorporating EMSCs suspension into bioink. Notably, this composition exhibited higher degree of printability. Next, we examined the biocompatibility of the mixed hydrogel components. Live-dead staining showed that the cells were stretched to varying degrees after three days of culture in the three printed hydrogel scaffolds. We counted the relative amount of living cells. The cell viability rate was 88.23 ± 1.13%, 78.56 ± 3.1% and 66.16 ± 2.9% for 0.5/30 (SA-MA), 30% Matrigel and 0.5% alginate respectively. Our results corroborates with the findings that microenvironment can influence the morphological structure of cells and regulate their function and biological behavior.²⁵ In comparison with 2 D culture, 3 D scaffolds provided a more favorable microenvironment for the growth of cells.

Consequently, we measured the proliferation of EMSCs in the 3 D and 2 D culture. The cells proliferated rapidly within the first five days, and then cluster due to insufficient living space and insufficient nutrient which led to a decreased rate of the proliferation. A suitable cell proliferation rate is critical to maintain cell survival and function.²¹ The 3 D culture provided a suitable microenvironment for cell growth, and the micropores in the printing scaffold promoted the nutrient transport of cell proliferation. The SA-MA scaffold biomaterial effectively alleviated the contact inhibition during cell proliferation and was more conducive for cell growth. In the case of Matrigel, cell proliferation was similar to 2 D culture because of its inherent mechanical strength. Hydrogels containing only alginate is prone to calcium cytotoxicity than other groups, which accounted for the death and inactivation of cells. Therefore, the hydrogel scaffold constructed by 3 D printing has the ability to maintain the good activity and growth of cells, and can simulate the microenvironment of cells in the body.

The porous structure of the 0.5/30 SA-MA hydrogel was suitable for drug release. BDNF is a type of neurotrophic factor. We examined its release kinetics from the hydrogel into the supernatant. The results showed that the construct exhibited a sustained release effect in accordance with the Higuchi equation. This shows that our bio-scaffold has the effect of protecting protein drugs, allowing them to be gently released, and has the effect of continuously nourishing cells. The function of BDNF in the nervous system and its role at the cellular and molecular level have attracted extensive attention. Studies have found that BDNF treatment protects severed neurons from degenerative atrophy and apoptotic cell death, as well as enhances spinal cord plasticity and regenerative growth, which generally seem to be resistant to other growth-promoting strategies, such as corticospinal tract.⁷ Also, as an important member of the neurotrophin family, NGF promotes neuronal survival and prevents neuronal pathology.²⁸ Moreover, SHH can affect the fate of glial cells, promote the formation of oligodendrocytes, and inhibit the pedigree of astrocytes.²⁹ Therefore, SHH can play a dual role by stimulating myelination and reducing the formation of scar of astrocytes after SCI. In addition, SHH can promote the survival of neurons and the growth of axons after spinal cord injury. Based on the 2 D culture, we compared the results of differentiation of EMSCs into neurons induced by different combinations of three factors. Cell differentiation was most effective when the three factors coexisted in the induced combination followed by induced BDNF-SHH combination, which showed little difference in the effect. Indeed, the promotion of neuron survival and axon growth was mainly dependent on BDNF and SHH.

Further, the 3 D SA-MA scaffold containing BDNF-SHH and EMSCs was subjected to differentiate in vitro for 2 weeks. The morphology of cells was examined under the phase contrast microscope. We observed significant changes in the morphology of cells as time elapsed. Consequently, immunofluorescence staining was performed to validate the result of 2 D and 3 D cultures. Moreover, we were interested in examining the degree of differentiation of EMSCs into neurons via quantification of the mRNA level of expression of characteristic markers of neurons, viz; TUJ1, MAP2, TAU, and NF200. Notwithstanding, EMSCs showed the trend of neuronal differentiation in both culture environments (i.e. 2 D and 3 D). The mRNA expression level and flow cytometry results indicated that 3 D culture was more conducive for EMSCs differentiation to neurons. Based on the above-mentioned potential of SA-MA 3 D scaffolds to support ESCs differentiation into neurons, not-too distant future works will comprehensively investigate the possible applications in the rescuing of SCI and other neurodegenerative disorders in vivo.

Conclusion

In summary, we used 3 D bioprinting technology to construct a biological scaffold with cells and factors. Thus, we evaluated the differentiation of EMSCs cells in 3 D SA-MA scaffolds. The bio-ink used satisfies the requirements of biological scaffolds in terms of printability and mechanical properties. Moreover, the microenvironment provided by these biological scaffolds promoted the growth and proliferation of cells. Compared with traditional 2 D culture, EMSCs in 3 D printed scaffolds can differentiate into neurons more efficiently. Subsequent experiments using hydrogel scaffold to repair spinal cord injury in rats are under way. Collectively, the favorable microenvironmental conditions provided by the 3 D SA-MA printed scaffolds for EMSCs provide a new strategy for the study of neuronal differentiation of EMSCs and the use of biological scaffolds in the treatment of spinal cord injury.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Natural Science Foundation of China (Grant Nos.81720108030, 81803475 and 81773695), the National “Twelfth Five-Year” Plan for Science & Technology Support (Grant No. 2013BAD16B07-1), China Postdoctoral Science Foundation (Grant Nos. 2017M621658 and 2017M621659), Scientific Research Innovation Team in Colleges and Universities of Jiangsu Province, a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, Laboratory of Drug Delivery & Tissue Regeneration, and Jiangsu Provincial Research Center for Medicinal Function Development of New Food Resources.

ORCID iDs

Yang Li

Ximing Xu

References

Bindu

Srilatha

Potency of various types of stem cells and their transplantation. J Stem Cell Res Ther 2011; 01: 115.

Shende

Subedi

Pathophysiology, mechanisms and applications of mesenchymal stem cells for the treatment of spinal cord injury. Biomed Pharmacother 2017; 91: 693–706.

Kim

Cho

S-G.

Clinical applications of mesenchymal stem cells. Korean J Intern Med 2013; 28: 387–402.

Forni

Wray

Neural crest and olfactory system: new prospective. Mol Neurobiol 2012; 46: 349–360.

Le Douarin

Dupin

Multipotentiality of the neural crest. Curr Opin Genet Dev 2003; 13: 529–536.

Dupin

Sommer

Neural crest progenitors and stem cells: from early development to adulthood. Dev Biol 2012; 366: 83–95.

Zhang

Deng

, et al. Nasal ectomesenchymal stem cells: multi-lineage differentiation and transformation effects on fibrin gels. Biomaterials 2015; 49: 57–67.

Fan

Piou

Darling

, et al. Bio-printing cell-laden matrigel–agarose constructs. J Biomater Appl 2016; 31: 684–692.

Ozbolat

Peng

Ozbolat

Application areas of 3D bioprinting. Drug Discov Today 2016; 21: 1257–1271.

10.

Murphy

Atala

3D bioprinting of tissues and organs. Nat Biotechnol 2014; 32: 773–785.

11.

Cui

Breitenkamp

Finn

, et al. Direct human cartilage repair using three-dimensional bioprinting technology. Tissue Eng Part A 2012; 18: 1304–1312.

12.

Skardal

Mack

Kapetanovic

, et al. Bioprinted amniotic fluid‐derived stem cells accelerate healing of large skin wounds. Stem Cells Transl Med 2012; 1: 792–802.

13.

Tan

Richards

Trusk

, et al. 3D printing facilitated scaffold-free tissue unit fabrication. Biofabrication 2014; 6: 024111.

14.

Ahmad

Wang

Gracz

, et al. Optimization of 3-D organotypic primary colonic cultures for organ-on-chip applications. J Biol Eng 2014; 8: 9.

15.

Y-C

Song

, et al. Designing compartmentalized hydrogel microparticles for cell encapsulation and scalable 3D cell culture. J Mater Chem B 2015; 3: 353–360.

16.

Radotra

McCormick

Glioma invasion in vitro is mediated by CD44–hyaluronan interactions. J. Pathol 1997; 181: 434–438.

17.

Tibbitt

Anseth

KS.

Hydrogels as extracellular matrix mimics for 3D cell culture. Biotechnol Bioeng 2009; 103: 655–663.

18.

Sato

Clevers

Growing self-organizing mini-guts from a single intestinal stem cell: mechanism and applications. Science 2013; 340: 1190–1194.

19.

Zhang

Xia

, et al. Salmonella‐infected crypt‐derived intestinal organoid culture system for host–bacterial interactions. Physiological Reports 2014; 2: e12147.

20.

Wells

RG.

The role of matrix stiffness in regulating cell behavior. Hepatology 2008; 47: 1394–1400.

21.

Wang

Dai

, et al. Bioprinting of glioma stem cells improves their endotheliogenic potential. Colloids Surf B Biointerfaces 2018; 171: 629–637.

22.

Law

Doney

Glover

, et al. Characterisation of hyaluronic acid methylcellulose hydrogels for 3D bioprinting. J Mech Behav Biomed Mater 2018; 77: 389–399.

23.

Liu

Shen

Zhi

, et al. 3D bioprinting and in vitro study of bilayered membranous construct with human cells-laden alginate/gelatin composite hydrogels. Colloids Surf B Biointerfaces 2019; 181: 1026–1034.

24.

Kleinman

H-K

Martin

G-R.

Matrigel: basement membrane matrix with biological activity. Semin Cancer Biol 2005; 15: 378–386.

25.

Madalina

Mihaela

Anca

, et al. Influence of matrigel on single- and Multiple-Spheroid cultures in breast cancer research. SLAS Discovery 2019; 24: 563–578.

26.

Giuseppe

Law

Webb

, et al. Mechanical behaviour of alginate-gelatin hydrogels for 3D bioprinting. J Mech Behav Biomed Mater 2018; 79: 150–157.

27.

Zhao

Yao

Ouyang

, et al. Three-dimensional printing of hela cells for cervical tumor model in vitro. Biofabrication 2014; 6: 035001.

28.

Zhao

Y-Z

Jiang

Xiao

, et al. Using NGF heparin-poloxamer thermosensitive hydrogels to enhance the nerve regeneration for spinal cord injury. Acta Biomaterialia 2016; 29: 71–80.

29.

Lowry

Goderie

Lederman

, et al. The effect of long-term release of shh from implanted biodegradable microspheres on recovery from spinal cord injury in mice. Biomaterials 2012; 33: 2892–2901.