Human epidermal growth factor-functionalized cocoon silk with improved cell proliferation activity for the fabrication of wound dressings

Abstract

Human epidermal growth factor (hEGF) is a key factor involved in wound healing owing to its powerful ability to stimulate cell proliferation. In this study, we used piggyBac transposon technology to produce transgenic silkworms expressing the hEGF protein fused to truncated heavy chain (FibH-hEGF). The FibH–hEGF fusion protein was successfully expressed and secreted into silkworm cocoons. Compared to wild-type silk, the transgenic silkworm silk had the similar morphology about silks fiber surface and cocoon nets, while the secondary structure between the transgenic silk and wild-type silk was different. Most importantly, transgenic silkworm cocoon silk powder extract significantly increased human fibroblast FIB cell proliferation for a long duration with no apparent cytotoxicity. Our study provides a promising method for obtaining cost-effective and functional biomaterials for the fabrication of wound dressings.

Keywords

Silkworm human epidermal growth factor cocoon silk transgenic wound healing

Introduction

Skin wounds are basically disruptions in the structure and function of skin tissue. Minor injuries can heal by skin self-repair mechanisms.¹ For specific types of wounds, such as diabetic ulcers, burn injuries, or deep wounds, however, plastic surgery or bioactive dressing materials are needed.^1,2 Traditional wound dressings include gauze, bandages, and so on. Due to various degrees of fluid absorption, they may cause injury and incomplete tissue growth after removal, which is not conducive to wound healing.³ In addition, some commercial wound dressings, such as collagen dressings, are expensive and have poor mechanical properties.⁴ Therefore, cost-effective, biodegradable, and bioactive wound dressings are urgently needed.

Silk, a natural protein fiber secreted from the domestic silkworm Bombyx mori, mainly consists of two proteins, inner fibroin and outer sericin. Fibroin includes a heavy chain (FibH) of about 391 kDa, a light chain (FibL) of 25 kDa, and a glycoprotein known as P25. Sericin glues fibroin fibers together and accounts for nearly 30% of the silk cocoon weight.⁵ Fibroin possesses numerous beneficial properties for medical applications of silk-based materials, such as biocompatibility, biodegradability, ease of genetical or chemical modification, low cytotoxicity and minimal induction of an immune response, low production costs, and wide availability, in addition to the ability to support cell attachment, migration, and proliferation.^1,6

Silk has been used in sutures since ancient times.¹ Although in recent time, it was reported with the poorest outcome of oral wound healing owing to its inflammatory reaction and microbial adherence affinity,⁷ it is still very often used as suture material and extensively investigated. With the aid of biotechnology and its own excellent properties, silk will be a promising material. The silk protein fibroin has been studied extensively for the fabrication of various biomaterials for wound healing, such as films, nanofibrous matrices, and 3 D porous scaffolds. It can be used alone, blended with other materials (such as gelation, polyethylene glycol [PEG], keratin, and collagen¹), or bio-functionalized (e.g., using FGF1, FGF2,⁸ bFGF,⁹ collagen,¹⁰ and VEGF¹¹), with various characteristics for wound repair, the stabilization of molecules, maintenance of bioactivity for extended periods, and drug delivery.^1,12

Human epidermal growth factor (hEGF) contributes substantially to skin wound healing. hEGF is a 53-amino acid residue globular protein of 6.2 kDa.¹³ It binds to the EGF receptor and mediates the proliferation, differentiation, and migration of various cells, such as epidermal cells and fibroblasts cells. hEGF can promote the formation of granulation tissue and epithelialization of skin wounds; it can also increase the synthesis of some endogenous growth factors and collagen. In this study, we generated hEGF-functionalized cocoon silk by expressing the FibH–hEGF fusion gene in transgenic silkworm by piggyBac transposon technology and established the activity of the transgenic cocoon silk in cell proliferation, providing a basis for the fabrication of effective wound dressings.

Materials and methods

Transgenic vector construction

The DNA sequence for the target protein included mature hEGF and truncated FibH. The mature 162-bp sequence for hEGF (GenBank Accession No. X04571.1) was synthesized by GENEWIZ (Suzhou, China) after optimization according to silkworm codon usage bias and was saved in the pBac[FibL–hEGF–IE1–DsRed] vector. The truncated FibH fragment (684 bp) containing a signal peptide, N terminal region, and C terminal region was also synthesized. The transgenic vector was constructed as follows. First, the FibH promoter was amplified from the pBac[FibH promoter–EGFP–SV40] vector using the primers FHP/RHP (Table 1) and cloned into pBac[A3–EGFP–SV40] using XhoI/SpeI sites. The FibH fragment was cloned into the same vector using SpeI/BamHI, thus generating the FibH promoter–FibH fragment. The fragment was sub-cloned between the XhoI and XmaI sites of the pBac[FibL–hEGF–IE1–DsRed] vector to produce the FibH promoter–FibH–hEGF-containing vector. Next, the synthesized poly-A signal sequence of FibH was inserted into the vector, resulting in the intermediate vector pBac[FibH promoter–FibH–hEGF–poly-A]. Then, the vector was digested with XhoI/BamHI and cloned into pBac[FibH promoter-EGFP-SV40] to obtain pBac[FibH promoter–FibH–hEGF–polyA -EGFP–SV40], which lacked the hr3 enhancer-IE1 promoter fragment. Therefore, the pBac[FibL–MSP1–IE1–DsRed] vector was used as an amplification template to produce the hr3–IE1 fragment with the primers FHI/RHI (Table 1). Finally, hr3-IE1 was cloned into pBac[FibH promoter-FibH-hEGF-EGFP] by using SalI/NcoI sites, resulting in the final vector pBac[FibH promoter–FibH–hEGF–hr3–IE1–EGFP], which was designated pBac[FibH–hEGF–EGFP]. All vectors were saved in our laboratory.

Table 1.

List of primer sequences used in this study.

Name	Sequence (5′-3′)
FHP	CTCGAGGTGATCAGGAAAAATGTGG
RHP	ACTAGTCTTGAGAGTTGGAACCGAA
FHI	GTCGACCGACGAATTTAAATGTAACG
RHI	CCATGGAGTCGTTTGGTTGTTCA
L1-F	GACAAGCACGCCTCAGCC
L1-R	TGAGTCAAAATGACGCATGATTATC
L2-F	GCTCCAAGCGGCGACTG
L2-R	GGGATGTTCTTTAGACGATGAGC
R1-F	TCTGTATATCGAGGTTTATTTA
R1-R	CCGATAAAAACACATGC
R2-F	ACTCAAAATTTCTTCTAAAGTAACAA
R2-R	CTTTAACGTACGTCACAATATG

Generation and screening of transgenic silkworms

The non-diapause silkworm Lan10 preserved in our laboratory was used for transgenic experiments. The transgenic vector pBac[FibH–hEGF–EGFP] was mixed with a helper plasmid at a concentration of 200 ng/μL, and this mixture was microinjected into the pre-blastoderm of generation 0 (G0) embryos.¹⁴ The hatched larvae were carefully bred and then mated with a wild-type moth to produce G1 silkworms. Transgenic individuals were screened for the expression of EGFP in G1 larvae using a fluorescence microscope (Olympus SZX16, Tokyo, Japan). The transgenic positive individuals at G1 were sib-mated to each other from the same brood to generate G2, and the transgenic positive individuals were selected and sib-mated in the same way to generate G3.

Insertion site analysis

Inverse PCR was performed to analyze the insertion sites of the positive transgenic silkworms as described previously.¹⁵ Briefly, genomic DNA extracted from the transgenic silkworm at generation 2 (G2) was digested with Sau3AI at 37 °C for 2 h and then self-cyclized by T4 DNA ligase (TaKaRa, Dalian, China) at 16 °C. The ligated fragments were used as templates for PCR with primers designed from the right-arm or left-arm of the piggyBac vector. The primers were as follows: R1-F/R1-R and L1-F/L1-R for the first PCR and R2-F/R2-R and L2-F/L2-R for the second PCR (Table 1). The amplification conditions for the first PCR were as follows: 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 49 °C (R1-F/R1-R) or 56 °C (L1-F/L1-R) for 30 s, 72 °C for 3 min, and a final extension period of 72 °C for 10 min. The second PCR was performed under the same conditions. Products were sequenced after cloning into the pMD19-T vector. Searches against the silkworm genome database (http://sgp.dna.affrc.go.jp/KAIKObase/) were used to localize the transgenes to distinct chromosomes.

SDS-PAGE and Western blotting

Cocoons were randomly selected from each of the four silkworm lineages at G2. They were suspended with a 20-fold volume of SDS buffer (10 mL of glycerol, 12.5 mL of 0.5 M Tris-HCl (pH 6.8), 2.5 g of SDS, 5 mL of β-mercaptoethanol, and water to a total volume of 100 mL) after being ground into a powder using a tissue homogenizer (Tissuelyser-24, Shanghai Jingxin Company, Shanghai, China) and incubated at 37 °C for about 10 h. Subsequently, the dissolved proteins were collected by centrifugation at 15,000 rpm for 10 min, loaded onto gels for SDS-PAGE (8–20% gradient), and stained with Coomassie brilliant blue R-250. For western blotting, proteins were blotted onto a PVDF membrane (Immobilon-P; Millipore, Billerica, MA, USA) after separation by SDS-PAGE. The membrane was incubated with antibodies and detected using ECL Luminescence Reagent (Sangon, Shanghai, China). An anti-EGF antibody (ab9695; Abcam, Cambridge, UK) and anti-P25 antibody synthesized by Genscript (Nanjing, China) were used as primary antibodies; goat anti-rabbit IgG H&L (HRP) (ab205718; Abcam) was used as the second antibody.

Scanning electron microscopy (SEM) and fourier transform infrared (FTIR) microspectroscopy

The transgenic and wild-type (Lan10) cocoon silks were degummed with 0.02 M Na2CO3 at 85 °C and air-dried. The surfaces of degummed silk fibers and substructure morphologies of the raw cocoon nets were observed using a JCM-7000 scanning electron microscope (NeoScope, Tokyo, Japan). The samples were vacuum-coated with a layer of platinum. Images were obtained using a field emission scanning electron microscope. SEM micrographs were collected at 25 °C and 60% relative humidity with an acceleration voltage of 5.0 kV. The secondary structures of transgenic and wild-type silks were analyzed by FTIR microspectroscopy. A mixture of 2 mg degummed silk powder with 200 mg of potassium bromide (KBr) was made into tablets for analysis using an instrument FTIR-8400S (Shimadzu, Japan). FTIR microspectra were recorded in the range 400–4000 cm⁻¹ at a resolution of 4 cm⁻¹ with 50 scans. Then the FTIR spectra were collected to analyze the amide I band (1620–1700 cm⁻¹) by the Omnic and Origin 9.1 software, including the β-turn conformation located at 1690–1700 cm⁻¹, α-helix and random coil conformations located at 1650–1660 cm⁻¹ and β-sheet conformation located at 1620–1630 cm⁻¹.

Cell lines

The human skin fibroblast FIB cell line was obtained from the Department of Ophthalmology, the Second Affiliated Hospital of College of Medicine, Zhejiang University. Cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) with 10% FBS (all from Gibco, Waltham, MA, USA), 50 mg/mL streptomycin, and 100 mg/mL ampicillin (Cienry, Huzhou, China).

Cell proliferation measurement

Cell proliferation was evaluated according to previously described methods.^8,16 Sericin and fibroin components of silk are not used in combination for the fabrication of matrices for tissue engineering.¹⁷ Accordingly, degummed cocoons were prepared as stated above and used in our study. 30 mg of cocoon silk powder was immersed in 1 mL of DMEM and shaken at 2800 rpm/min at 25 °C for 48 h. The protein extract was collected by centrifugation at 15000 rpm for 10 min and stored at 20 °C before use. The human skin fibroblast FIB cells were seeded into 96-well plates at a density of 500 cells per well and starved in 100 µL of DMEM without FBS for 12 h. DMEM was removed and the protein extract was added with 1% FBS for several days. Then, 300 ng/mL commercial hEGF standard (R&D Systems, Minneapolis, MN, USA) was used as a positive control. Next, the viability of FIB cells was examined using the live/dead cell dye Calcein-AM (Yisheng, Beijing, China) and propidine iodide (PI; BioFroxx, Einhausen, Germany), and images were obtained by fluorescence microscopy (Olympus IX81). Cell-Counting Kit-8 (CCK-8; 7sea, Shanghai, China) was used to analyze cell proliferation. All measurements were performed in five copies and the experiment was repeated independently three times.

Statistical data analysis

Statistical analyses were performed using Student’s t-tests. Values of p < 0.01 were considered statistically significant. The data are reported as means ± SEM (n = 5).

Results

Generation of transgenic silkworms

The FibH expression system was first used for recombinant protein production in transgenic cocoons in 2007.¹⁸ In this study, we used the system to produce recombinant hEGF. The transgenic vector pBac[FibH–hEGF–EGFP] was designed and constructed (Figure 1(a)). The expression cassette sequence included the FibH-promoter, FibH gene (signal peptide, N terminal of FibH, and C terminal of FibH), optimized hEGF gene, and FibH polyA sequence. In addition, EGFP driven by the hr3 enhancer with the IE1 promoter was chosen as the transgenic selectable marker, with expected expression throughout the silkworm body. The vector pBac[FibH–hEGF–EGFP] was mixed with helper plasmids and microinjected into preblastodermal eggs of Lan10. Microinjected eggs after hatching were fed until the adult stage for oviposition. Larvae were screened by fluorescence microscopy (Olympus SZX16), and positive G1 individuals with specific EGFP emission were detected (Figure 1(b)). Four transgene-positive lineages were obtained, designated FibH–hEGF-1 to FibH–hEGF-4.

Insertion site analysis

Inverse PCR was performed to further confirm the precise insertion in the four transgenic lineages. FibH–hEGF-1 to FibH–hEGF-4 each contained a single insertion of the FibH–hEGF gene in intronic regions, as shown in Figure 1(c). FibH–hEGF-2 and FibH–hEGF-3 shared the same insertion in silkworm chromosome 19, while FibH–hEGF-1 and FibH–hEGF-4 harbored insertions in chromosome 21 and 2, respectively. Thus, we selected these lines for further analyses.

Expression of the FibH-hEGF fusion protein in transgenic cocoons

Cocoon silk proteins from FibH–hEGF-1 to FibH–hEGF-4 were separated by SDS-PAGE and the FibH–hEGF fusion protein was detected by western blotting using an antibody against hEGF. A band was obtained at approximately 40 kDa (Figure 2), indicating the successful expression of the FibH–hEGF fusion protein in transgenic cocoons. Additionally, the expression levels of the FibH–hEGF fusion protein differed among the four transgenic lineages (Figure 2(b)). FibH–hEGF-1 showed the highest expression level of the target protein and was selected to establish a stable transgenic silkworm strain for subsequent analyses.

Characterization of FibH–hEGF-1 cocoon silk

The basic characteristics of FibH–hEGF-1 cocoon silk were analyzed by SEM and FTIR. The SEM results showed there were no evident differences in the morphology of the degummed silk fibers surface and raw cocoon nets between FibH–hEGF-1 and wild-type (WT) ones (Figure 3(a)). We mainly analyzed the amide I band (1620–1700 cm-1) and found the similar amide I band in FibH-hEGF and WT groups (Figure 3(b)). But the content of α-helix and random curls increased and that of β-sheet and β-turn conformations decreased in FibH-hEGF degummed cocoon silk compared to that in wild type one (Figure 3(c)).

Bioactivity of FibH–hEGF-1 cocoon silk

hEGF stimulates the proliferation of fibroblasts. To evaluate the bioactivity of transgenic cocoons, both degummed FibH–hEGF-1 and wild-type (WT) cocoon silks were ground into a powder and immersed in DMEM. hEGF was released from FibH–hEGF-1 cocoon silks into DMEM (Supplementary Figure 1). FIB cells were cultured with the protein extract. After 48 h, cells viability was evaluated. LIVE/DEAD cell dyeing assays showed a greater number of FIB cells in the FibH–hEGF-1 and commercial recombinant hEGF protein (hEGF standard) groups than in the Null and WT group (Figure 4(a)). No dead cells were observed in these groups. A CCK-8 assay of FIB cells treated with the FibH–hEGF-1 cocoon silk protein extract and hEGF standard for 2 and 7 days showed an increased absorbance at 450 nm compared with that in the WT group (Figure 4(b)). Moreover, the FibH-hEGF-1 group showed significantly higher absorbance than that of the hEGF standard after 7 days.

Discussion

The development of wound dressings with various advantages (e.g., non-cytotoxicity, biodegradability, and low production cost) to heal wounded tissues is a major research goal. As a kind of natural fiber, silk from Bombyx mori has excellent properties and is therefore a desirable material for medical applications. The addition of functional molecules or drugs, such as antibiotics and growth factors, by carriers or genetic modification confers excellent properties to silk-based materials.⁶

Since 2000, rapid advances in the application of piggyBac transposon technology to the silkworm have enabled germline transformation and stable gene inheritance in Lepidoptera.¹⁵ Compared with the baculovirus system, the piggyBac transposon is highly safe, as it causes no viral infection in the silkworm. The silkworm PSG expression system including FibH, FibL, and P25 promoters has been used to obtain various recombinant proteins.^14,18,19 In this study, we used the FibH expression system based on piggyBac transposon technology to obtain transgenic silkworms. EGFP screening and inverse PCR suggested the successful heritable transgenesis of the hEGF gene in silkworms. The marker gene EGFP fluorescence was screened to select silkworms with hEGF gene in each generation, which can confirm the stable inheritance of hEGF gene. Four transgenic lineages shared three different insertion sites, showing the random nature of the piggyBac transposon-mediated introduction of foreign genes into the genome. Subsequently, we performed SDS-PAGE and western blotting analyses of FibH–hEGF silk proteins and detected the successful expression and secretion of the fusion protein FibH–hEGF in transgenic cocoons. Cocoons for preparing protein samples were obtained from generation 2 (G2), further confirmed the stable inheritance and expression of hEGF in silkworms. It was worth noting that the molecular weight of the fusion protein was about 40 kDa, rather than 30 kDa (6 kDa for hEGF and 24 kDa for truncated FibH) calculated using the Peptide Properties Calculator (<seurld>http://biotools.nubic.northwestern.edu/proteincalc.html</seurld>); this difference may be related to the post-translational modification of FibH, as it might contain some N-glycosylation sites.²⁰ Additionally, the expression levels of the FibH–hEGF fusion protein varied among the four positive individuals, consistent with previous studies suggesting that expression differences among silkworm individuals are determined by a position effect caused by the random integration into the silkworm genome using the piggyBac system.^21–24 To summarize, we successfully obtained transgenic silkworms using the FibH expression system based on the piggyBac transposon and produced FibH–hEGF protein in transgenic cocoons.

EGF is a key factor in wound healing. It has been researched in medical applications for a long time owing to its excellent effects in proliferation, differentiation, and migration of various cells. However, the quick degradation of EGF due to the highly active proteases within the wound environment results in a failure to reach enough dosages for wound repair. To overcome this limitation, various studies have evaluated the incorporation of EGF protein into silk materials with two approaches, mixing EGF in a silk solution before casting and soaking the silk matrices in EGF.^9,25–27

However, it is difficult to incorporate growth factors into natural silks⁸ and the production of EGF is costly. Therefore, we inserted the hEGF gene into the silkworm genome using the piggyBac transposon for stable inheritance in transgenic silkworms and produced hEGF protein-containing cocoon silks. The cocoon is easy to harvest and can be stored for long durations due to its antibacterial and protease inhibitory activity,^28–30 making it a cost-effective and excellent material. We evaluated bioactivity directly using transgenic cocoon silks, instead of extracting silk protein from silk glands.^31,32 In a previous study,³³ the exogenous DsRed expressed under the control of silk fibroin P25 gene promoter was found to be showed up as particles coating the silk fiber and these particles were distributed at the surface of the fiber with different sizes. To analyze whether the exogenous FibH-hEGF fusion protein in our study would cause obvious morphological changes to the silks, SEM was conducted and the results showed showed high similarity on the silks surface and cocoon nets between the FibH–hEGF and wild-type (WT) groups. This may suggest that our FibH-hEGF fusion protein expressed under the control of the FibH gene promoter was trapped within the fibroin protein crystal network but not distributed on the silk surface. The SEM results indicated that the FibH–hEGF fusion protein cause no changes to the silk surface so that the properties of silk might not be affected. According to the FTIR results, the amide I bands (1620–1700 cm⁻¹) were similar in FibH-hEGF and WT silks, but the contents of secondary structure were changed in FibH–hEGF silks. The α-helix and random curls increased and that of β-sheet and β-turn conformations decreased in FibH-hEGF silks compared to that in wild type one. Referring to a previous study,⁸ we assumed that these changes in FibH–hEGF silks might be caused by the similar reason that exogenous hEGF protein might affect the pH of silk gland, thus affecting the assembly of silk fibroin. The western blotting detection demonstrated hEGF could be released from cocoon to DMEM. When cultured with human skin fibroblast FIB cells, FibH–hEGF cocoon silk powder protein extract showed high cell proliferation without apparent toxicity. More importantly, the FibH–hEGF group displayed stronger activity than that of the hEGF standard even after 7 days. This might be explained by the higher stability of hEGF in FibH–hEGF cocoon silk, as previous studies have shown that cocoons contain protease inhibitors²⁹ and the hEGF standard undergoes degradation without protection from cocoons. These results suggested that FibH–hEGF cocoons not only release hEGF but also might improve its stability. Thus, hEGF-containing cocoon silk was produced with potential applications for wound dressings.

In a word, we successfully obtained transgenic silkworms by piggyBac transposon and produced hEGF-containing cocoon silks. The improved cell proliferation indicated the feasibility of transgenic cocoon silks for wound healing. Our research provides a novel basis for obtaining cost-effective and highly efficient biomaterials for the fabrication of dressings to repair multiple wounds in the future.

Conclusions

We performed a genetically engineered strategy here to produce transgenic cocoon silks containing hEGF fused with FibH. The transgenic cocoon silks showed similar morphology but different secondary structure to those of wild-type silk. The western blotting detection and cell proliferation experiments demonstrated hEGF could be released from cocoon to DMEM and significantly increased human fibroblast FIB cell proliferation for long-term without apparent cytotoxicity. Thus, our transgenic cocoon silks have potential for the fabrication of wound dressings and provide a hopeful strategy for fabricating molecular or drug-functionalized silk-based biomaterials for wound healing.

Supplemental Material

sj-pdf-1-jba-10.1177_0885328221997981 - Supplemental material for Human epidermal growth factor-functionalized cocoon silk with improved cell proliferation activity for the fabrication of wound dressings

Supplemental material, sj-pdf-1-jba-10.1177_0885328221997981 for Human epidermal growth factor-functionalized cocoon silk with improved cell proliferation activity for the fabrication of wound dressings by Meiyu Wu, Shenyu Huang, Xiaogang Ye, Jinghua Ruan, Shuo Zhao, Juan Ye and boxiong Zhong in Journal of Biomaterials Applications

Footnotes

Acknowledgement

We thank Mrs. Li Zhou for helping us breed silkworms in our study.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was funded by the National Natural Science Foundation of China, grant number: 31772676.

ORCID iD

boxiong Zhong

Supplemental Material

Supplementary material for this article is available online.

References

Chouhan

Mandal

BB.

Silk biomaterials in wound healing and skin regeneration therapeutics: from bench to bedside. Acta Biomater 2020; 103: 24–51.

Clark

Ghosh

Tonnesen

MG.

Tissue engineering for cutaneous wounds. J Invest Dermatol 2007; 127: 1018–1029.

Farokhi

Mottaghitalab

Fatahi

, et al. Overview of silk fibroin use in wound dressings. Trends Biotechnol 2018; 36: 907–922.

Helary

Bataille

Abed

, et al. Concentrated collagen hydrogels as dermal substitutes. Biomaterials 2010; 31: 481–490.

Lamboni

Gauthier

Yang

, et al. Silk sericin: a versatile material for tissue engineering and drug delivery. Biotechnol Adv 2015; 33: 1855–1867.

Gholipourmalekabadi

Sapru

Samadikuchaksaraei

, et al. Silk fibroin for skin injury repair: where do things stand? Adv Drug Deliv Rev 2020; 153: 28–53.

Dragovic

Pejovic

Stepic

, et al. Comparison of four different suture materials in respect to oral wound healing, microbial colonization, tissue reaction and clinical features – randomized clinical study. Clin Oral Investig 2020; 24: 1527–1541.

Wang

, et al. Genetic fabrication of functional silk mats with improved cell proliferation activity for medical applications. Biomater Sci 2019; 7: 4536–4546.

Schneider

Wang

Kaplan

, et al. Biofunctionalized electrospun silk mats as a topical bioactive dressing for accelerated wound healing. Acta Biomater 2009; 5: 2570–2578.

10.

Ramadass

Nazir

Thangam

, et al. Type I collagen peptides and nitric oxide releasing electrospun silk fibroin scaffold: a multifunctional approach for the treatment of ischemic chronic wounds. Colloids Surf B Biointerfaces 2019; 175: 636–643.

11.

Saotome

Hayashi

Tanaka

, et al. Introduction of VEGF or RGD sequences improves revascularization properties of Bombyx Mori silk fibroin produced by transgenic silkworm. J Mater Chem B 2015; 3: 7109–7116.

12.

Kluge

Guziewicz

, et al. Silk-based stabilization of biomacromolecules. J Control Release 2015; 219: 416–430.

13.

Cohen

Carpenter

Human epidermal growth factor: isolation and chemical and biological properties. Proc Natl Acad Sci USA 1975; 72: 1317–1321.

14.

You

Qian

Wang

, et al. Transgenic silkworms secrete the recombinant glycosylated MRJP1 protein of Chinese honeybee, Apis Cerana cerana. Transgenic Res 2017; 26: 653–663.

15.

Tamura

Thibert

Royer

, et al. Germline transformation of the silkworm Bombyx Mori L. using a piggybac transposon-derived vector. Nat Biotechnol 2000; 18: 81–84.

16.

Wang

, et al. Genetically engineered bi-functional silk material with improved cell proliferation and anti-inflammatory activity for medical application. Acta Biomater 2019; 86: 148–157.

17.

Rockwood

Preda

Yücel

, et al. Materials fabrication from Bombyx Mori silk fibroin. Nat Protoc 2011; 6: 1612–1631.

18.

Kurihara

Sezutsu

Tamura

, et al. Production of an active feline interferon in the cocoon of transgenic silkworms using the fibroin H-chain expression system. Biochem Biophys Res Commun 2007; 355: 976–980.

19.

Cao

Wang

, et al. Expression of the HIGF-I gene driven by the FHX/P25 promoter in the silk glands of germline silkworm and transformed BMN cells. Biotechnol Lett 2011; 33: 489–494.

20.

Kojima

Kuwana

Sezutsu

, et al. A new method for the modification of fibroin heavy chain protein in the transgenic silkworm. Biosci Biotechnol Biochem 2007; 71: 2943–2951.

21.

Iizuka

Ogawa

Takeuchi

, et al. Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons. Febs j 2009; 276: 5806–5820.

22.

Chen

Wang

Tian

, et al. Transgenic silkworm-based silk gland bioreactor for large scale production of bioactive human platelet-derived growth factor (Pdgf-Bb) in silk cocoons. IJMS 2018; 19: 2533.

23.

Qian

Zhang

, et al. Analysis of the Sericin1 promoter and assisted detection of exogenous gene expression efficiency in the silkworm Bombyx Mori L. Sci Rep 2015; 5: 8301.

24.

Iizuka

Tomita

Shimizu

, et al. Translational enhancement of recombinant protein synthesis in transgenic silkworms by a 5′-untranslated region of polyhedrin gene of Bombyx Mori nucleopolyhedrovirus. J Biosci Bioeng 2008; 105: 595–603.

25.

Gil

Panilaitis

Bellas

, et al. Functionalized silk biomaterials for wound healing. Adv Healthc Mater 2013; 2: 206–217.

26.

Choi

Lee

Kim

, et al. Effects of structurally stabilized EGF and BFGF on wound healing in type I and type Ii diabetic mice. Acta Biomater 2018; 66: 325–334.

27.

Sen

Basak

Prasad Sinha

, et al. Anti-Inflammatory effect of epidermal growth factor conjugated silk fibroin immobilized polyurethane ameliorates diabetic burn wound healing. Int J Biol Macromol 2020; 143: 1009–1032.

28.

Pandiarajan

Cathrin

Pratheep

, et al. Defense role of the cocoon in the silk worm Bombyx Mori L. Rapid Commun Mass Spectrom 2011; 25: 3203–3206.

29.

Zhang

Zhao

Dong

, et al. Comparative proteome analysis of multi-layer cocoon of the silkworm, Bombyx Mori. PLoS One 2015; 10: e0123403.

30.

Dai

Sun

Zhang

Comparative analysis of Itraq-Based proteomes for cocoons between the domestic silkworm (Bombyx Mori) and wild silkworm (bombyx mandarina). J Proteomics 2019; 192: 366–373.

31.

Bienert

Hoss

Bartneck

, et al. Growth factor-functionalized silk membranes support wound healing in vitro. Biomed Mater 2017; 12: 045023.

32.

Woltje

Bobel

Bienert

, et al. Functionalized silk fibers from transgenic silkworms for wound healing applications: surface presentation of bioactive epidermal growth factor. J Biomed Mater Res A 2018; 106: 2643–2652.

33.

Royer

Jalabert

Rocha

, et al. Biosynthesis and cocoon-export of a recombinant globular protein in transgenic silkworms. Transgenic Res 2005; 14: 463–472.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.15 MB