Silk fibroin-hydroxyapatite scaffolds promote the proliferation of adipose-derived mesenchymal stem cells by activating the ERK signal

Abstract

Adipose-derived mesenchymal stem cell (Ad-MSC) with capacities of releasing trophic factors and chondrogenic differentiation was a promising candidate for tracheal reconstruction. Silk fibroin (SF)- hydroxyapatite (HA) scaffolds were fabricated by the freeze-drying method. And Ad-MSCs were co-cultured on the scaffolds for 14 days in vitro. The role of the SF-HA scaffold in regulating the adhesion, growth, and proliferation of Ad-MSCs, and its potential mechanisms were investigated. The identity of Ad-MSCs was confirmed by cell morphology, surface markers, and differentiation characteristics. Cell proliferation, viability, and morphology were observed via CCK-8, live/dead assay, and scanning electron microscopy (SEM). Gene mRNA and protein levels were examined using quantitative real-time polymerase chain reaction and western blotting, respectively. SF-HA scaffolds showed excellent properties of promoting Ad-MSCs adhesion, growth, and proliferation for at least 14 days. In the CCK-8 assay, the relative OD value of Ad-MSCs cultured on SF-HA scaffolds increased (p < 0.001). Furthermore, live/dead staining showed that the fluorescent coverage increased with time (p < 0.05). SEM also showed that 3 days after inoculation, the coverage of Ad-MSCs on the SF-HA scaffolds was 78.15%, increased to 92.91% on day 7, and reached a peak of 94.38% on day 14. Extracellular signal-regulated kinase (ERK) mRNA and phosphorylated ERK (pERK) protein expression increased at day 3 (p < 0.05), followed by a significant decline at day 7 (p < 0.05). And ERK mRNA expression was positively correlated with Ad-MSCs proliferation (p < 0.05). In summary, the SF-HA scaffold co-cultured with Ad-MSCs is a promising biomaterial for tracheal repair by activating the ERK signal pathway.

Keywords

silk hydroxyapatite scaffold Ad-MSCs ERK signaling

Introduction

Tracheal reconstruction is one of the greatest challenges when a direct end-to-end anastomosis is impossible or when this procedure has failed. The main causes of tracheal reconstruction include prolonged endotracheal intubation, tracheostomy, cancer, trauma, and inflammation. Many natural and synthetic polymers have been considered for use as biomaterial scaffolds in reconstruction. Although many polymers have good mechanical properties, their mechanical properties cannot be balanced with trachea epithelial regeneration.¹ Increasing scaffold stiffness could lead to a potential decline in porosity and permeability, which prevents the neotissue ingrowth into porous scaffolds. However, increasing scaffold porosity might cause higher permeability but the effective stiffness could be sacrificed.

Of the natural and synthetic polymers, silk fibroin (SF) has been evaluated in tissue engineering and recommended as one of the potential biomedical matrices to be used as guided tissue regeneration.² The silk produced by B. mori is composed of two proteins, fibroin and sericin, a family of glue-like proteins that coat the fibers and hold them together. SF is an ideal biopolymer because of its high stability, good compatibility, and resistance to degradation under heat or shear stress. In combination with calcium phosphate ceramics, like hydroxyapatite (HA), SF can increase the toughness of the mineral component providing a greater balance between strength and fracture resistance.³ For bone regeneration, SF-HA scaffolds showed better environmental stability, options for genetic control to tailor sequence, biocompatibility, and mechanical properties.⁴

Reports increasingly suggest that multipotent mesenchymal stromal cells (MSCs), isolated from different tissue sources, confer benefits in vivo as tissue restorative agents.⁵ They act by either releasing trophic factors or through their multilineage differentiation properties.⁶ In particular, adipose tissue-derived MSCs (Ad-MSCs) are currently under investigation to treat tracheal wounds because of their abundance, easy isolation, and in vitro expansion.⁷

Mitogen-activated protein kinase (MAPK) cascades are evolutionarily conserved in all eukaryotes and play an essential role in the regulation of gene expression and cytoplasmic signaling. The mammalian MAPK consists of three major subfamilies, namely extracellular signal-regulated kinase 1/2 (ERK1/2), c-jun-N-terminal kinase (JNK), and p38, each with specific substrates and functions.⁸ Of these, ERK1/2 could regulate cell growth and differentiation. In this regard, calcium salts enhanced the proliferation of human dental pulp cells via ERK1/2 activation.⁹ Moreover, ERK1/2 is important in the proliferation and differentiation of Ad-MSCs.¹⁰ Taking these factors all together, we hypothesized that SF-HA scaffolds may impact the behavior of Ad-MSCs via a MAPK pathway, in particular ERK1/2.

Therefore, this study aimed to investigate the role of the ERK1/2 pathway on SF-HA scaffolds-induced proliferation of Ad-MSCs.

Methods

Fabrication of SF-HA scaffolds

The SF-HA scaffolds were prepared using previously established methods.^11,12 Briefly, Bombyx mori cocoon silk was boiled in aqueous Na₂CO₃ solution (0.5 wt %) for 30 min to remove sericin, rinsed with deionized water, and dried in an oven at 40 $° C$ for later use. The degummed silk fibroin was then dissolved in 9.5 mol/L LiBr aqueous solutions at 60 $° C$ . After being filtered and dialyzed, the resulting silk solution was concentrated to 14 wt % by dialyzing against a 12.5 wt % polyethylene glycol solution.

Then, HA was added to the SF solution (the mass ratio 1:10). Subsequently, the SF solution was mixed with 2 mol/L CaCl₂, 0.54 mol/L Na₂HPO₄, and n-butanol in a shaker at 37 $° C$ for approximately 30 min, respectively. The mixture was then poured into a cylindrical mold and frozen in a freezer for 24 h at −20 $° C$ . After thawing at room temperature and rinsing with deionized water several times to remove n-butanol, SF-HA scaffolds were obtained.

Scaffold characterization

Cross sections of the freeze-dried SF-HA scaffolds were obtained by fractured in liquid nitrogen. The fracture surfaces were sputter-coated with Au and then examined by SEM (SU8010, Hitachi, Japan). The pore size of the scaffolds was analyzed with ImageJ and more than 60 pores were randomly selected for statistical analysis.

Adipose-derived stem cells isolation and culture

Ad-MSC from rabbits was isolated from male rabbits as previously described.¹³ Briefly, Ad-MSCs were harvested from inguinal fat by digestion of collagenase and expanded in culture. Cell multipotency was confirmed by differentiation to chondrogenic phenotypes (Alcian blue staining). We also confirmed that the adherent cells obtained had the conventional phenotypic signature of Ad-MSCs (CD44⁺, CD105⁺, and CD45⁻).

Cell proliferation on SF-HA scaffolds

CCK-8 assay was carried out for the observation of cell proliferation on the SF-HA scaffolds. The Ad-MSCs on the culture dishes were used as a control. The scaffolds were put in 48-well plates. About 20 $μ l$ of Ad-MSCs suspension containing $4 \times 10^{4}$ cells were seeded on the scaffolds. After half an hour, 200 $μ l$ of fresh medium was added to each well. At different times of co-culture (1, 3, and 7 days), the scaffolds were transferred to a new 48-well plate and incubated in 200 $μ l$ of medium containing 50 $μ l$ CCK-8 solutions for 3 h. Afterward, the absorbance was measured at 450 nm using a microplate reader. The results were normalized to those reported in the control group.

Cells viability and morphology on SF scaffolds

Cell viability was further measured by live/dead assay (Sigma, USA). In brief, the scaffolds were put in 24-well plates. The 100 $μ l$ of Ad-MSCs suspension containing $2 \times 10^{5}$ cells were seeded on the scaffolds. At different times of co-culture (3, 7, and 14 days), the scaffolds were incubated in 20 $μ M$ calcein-AM (staining live cells) and 1 $μ g / m l$ propidium iodide (PI, staining dead cells) in PBS for 20 min at 37 $° C$ . All scaffolds were observed by fluorescence microscope at certain wavelengths.

The morphology of Ad-MSCs on the scaffolds at 3, 7, and 14 days in vitro was imaged using scanning electron microscopy (SEM) (SU8010, Hitachi, Japan). For this observation, the prepared samples were fixed in 2.5% glutaraldehyde solution, dehydrated, and coated with gold using a sputter coater. Afterward, the specimens were observed via SEM at a magnification of 500–3000 times at an accelerating voltage of 10 kV.

The microphotographs were then analyzed using ImageJ v1.52a.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The relative mRNA levels of the ERK gene in Ad-MSCs on the SF-HA scaffolds were assessed using quantitative real-time polymerase chain reaction (qRT-PCR). Briefly, the total RNA samples of Ad-MSCs were isolated using the Trizol reagent (Beyotime, China) following the manufacturer’s instructions. About 10 μL RNA samples were subjected to the synthesis of the cDNA library, using RT First Strand cDNA Synthesis Kit (Thermo Scientific, USA) following the manufacturer’s instructions. ERK gene expression levels were finally determined using a real-time quantitative PCR method with 2×SYBR Green qPCR Master Mix (None ROX) (Thermo Scientific, USA) following the manufacturer’s instructions. Quantitative PCR was performed by predenaturation for 30 s at 95

°C

, followed by 40 cycles of 95

°C

for 15 s and 60

°C

for 30 s. Relative mRNA levels were then measured using the 2^−ΔΔCt method. GAPDH served as the internal standard. The sequences of primers utilized for quantitative RT-PCR were outlined in Table 1.

Table 1.

Sequences of primers used in the qRT-PCR method.

	Sequence (5′-3′)
ERK-F	CCAGACCTACTGCCAGAGAACC
ERK-R	TGAGGATCTGGTAGAGAAAATAGCAG
GAPDH-F	GGAAGCTTGTCATCAATGGAAATC
GAPDH-R	TGATGACCCTTTTGGCTCCC

Western blot

Total protein samples were extracted from cultured Ad-MSCs on the SF-HA scaffolds using the cell lysis buffer (Beyotime, China) following the instructions of the manufacturer. The protein concentration was determined using a bicinchoninic acid protein (BCA) assay (beyotime, China) following the manufacturer’s instructions. Protein extracts were resolved in gradient sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer (beyotime, China), boiled at 100°C for 5 min, and stored at −80°C. After electrophoresis (80 V, 10 min; 120 V, 1 h), the protein was transferred onto the PVDF membrane, which was then blocked with QuickBlock™ Blocking Buffer (beyotime, China) at room temperature for 1 h. The membrane was incubated with primary antibodies overnight at 4 $°C$ . After washing with Tris-buffered saline with Tween-20 (TBST, beyotime, China), the membrane was incubated with horseradish peroxide reductase-conjugated secondary antibodies (beyotime, China) and finally developed with the enhanced chemiluminescence (ECL) substrates (biosharp, China). $β$ -actin served as the internal standard. The primary antibodies utilized in this study include anti-ERK (Abmart, T40071M, China); anti-p-ERK (abmart, T40072M, China); and $β$ -actin (beyotime, AF2811, China).

Statistical analysis

Analysis was carried out through GraphPad Prism v8.4.0. The quantitative data in this study based on at least three biological repeats were presented as mean ± standard deviation (SD). The comparisons for multiple groups were carried out by one-way ANOVA followed by a Bonferroni correction. p < 0.05 was considered statistically significant. Pearson correlation analysis was used to measure the strength and direction of (growth rate of relative ERK mRNA expression)-to-(growth rate of Ad-MSCs on SF-HA scaffolds by SEM).

Result

SF-HA scaffolds characterization

The SEM images of the fabricated SF-HA scaffolds were shown in Figures 1(a) and (b). The scaffolds had a multilevel three-dimensional porous structure, which was an interconnected porous structure formed by ice crystals. The pore walls had an obvious fibrous network structure at the micro and nanoscale. The average pore size was 54 $\pm$ 22 $μ m$ .

Identification of Ad-MSCs

After being cultured for 14 days, Ad-MSCs showed homogeneously fibroblast-like and typically spindle-shaped, with a fascicular arrangement (Figure 2(a)). Ad-MSCs were plastic-adherent when maintained in standard culture conditions. Cells isolated from adipose tissue were differentiated into chondrocytes in a specific commercial induction medium. Chondrogenic differentiation was identified by micromass formation that showed blue color upon alcian blue staining. (Figure 2(b) and (c)) To assess the surface marker phenotype of Ad-MSCs, the flow cytometry analysis was used to identify the purified Ad-MSCs. Ad-MSCs were positive for CD44 and CD105, but negative for CD45 (Figure 2(d)).

Cell proliferation on SF-HA scaffolds

Cell proliferation was evaluated by a CCK-8 assay. As shown in Figure 3, the relative OD of Ad-MSCs cultured on SF-HA scaffolds gradually increased during the first 3 days, followed by an abrupt increase on day 7, suggesting that Ad-MSCs could proliferate on the SF-HA scaffolds during the culture period. Between the first and the third day, the OD value increased gradually (p < 0.001), with significant increases on the seventh day (p < 0.0001).

Cells viability and morphology on SF-HA scaffolds

The viability and morphology of Ad-MSCs on the SF-HA scaffolds were further observed with fluorescence microscopy and SEM at different times (three, seven, and 14 days).

Live/dead staining showed that Ad-MSCs were stained by calcein-AM on the SF-HA scaffolds during the culturing period, suggesting that the Ad-MSCs on the SF-HA scaffolds were alive and maintained good viability. Ad-MSCs attached closely to each other and were spindle in shape (Figure 4(a)–(c)). The fluorescent coverage on the SF-HA scaffolds increased significantly with time. The Ad-MSCs remained active for all 14 days of culture, with cells stained green with calcein-AM, and no dead cells (stained red) were seen (Figure 4(d)). The results indicated that cells were able to adhere to the scaffold, remain well-active, and continue to proliferate on the scaffold.

On the SF-HA scaffold, Ad-MSCs showed good adhesion, proliferation, and growth. On day 3, the cells adhered and spread out on the scaffold with elongated morphology (Figure 5(a)). On days 7 and 14, the cells proliferated, and the morphology became more elongated and tightly arranged (Figure 5(b) and (c)). On day 7, the cells increased in number and covered more of the scaffold surface (Figures 5(b) and (c)). By day 14, the cells were even greater in number and density and spread over almost the entire surface of the scaffold. As shown in Figure 5(d), the cell coverage on the SF-HA scaffold was higher on days 7 and 14 than on day 3 (p < 0.0001).

SF-HA scaffolds promoted Ad-MSCs proliferation by activating ERK signaling pathway

ERK signaling pathway has been proven to participate in Ad-MSCs proliferation. Thus, we explored whether SF-HA scaffolds increased Ad-MSCs growth through ERK signaling. Results showed that ERK mRNA expression of Ad-MSCs on the SF-HA scaffolds was increased on the third day and decreased on the seventh day (Figure 6(a)). A positive correlation between the growth rate of ERK mRNA expression and the growth rate of Ad-MSCs on the SF-HA scaffolds was confirmed by a Pearson correlation analysis (Figure 6(b)). During the observation period, there was no significant difference in the ERK protein expression level of Ad-MSCs whereas the protein expression of phosphorylated ERK (pERK) rose to the highest level on day 3 which followed a significant decline on day 7 and day 14. (Figure 6(c)–(e)).

Discussion

Tracheal reconstruction is a comprehensive and dynamic process that requires injured host cells, immune cells, cytokines, and growth factors to interact, including cell dedifferentiation, migration, proliferation, angiogenesis, and redifferentiation pathways, in which angiogenesis is the key step for guaranteeing adequate nutrition.¹⁴ Ad-MSCs enhance the blood supply to transplanted grafts through differentiation into endothelial cells and secretion of angiogenic growth factors.¹⁵ Ad-MSCs also accelerate neovascularization.¹⁶ Besides, some growth factors, secreted from Ad-MSCs, such as fibroblast growth factor (FGF) and epidermal growth factor (EGF), can stimulate cell proliferation, differentiation, and migration.¹⁷ Ad-MSCs also have several advantages, including ease of isolation, relative abundance, rapid expansion, and multipotency.¹⁶ In the present study, we confirmed that Ad-MSCs could differentiate into chondrocytes, which were the main components of the trachea. Thus, Ad-MSCs are considered cells with an active capacity to release angiogenic and trophic factors, critical to proper wound regeneration or can differentiate into chondrocytes. These characteristics of the Ad-MSCs make them ideally suited for tracheal repair.

As a fundamental premise in tracheal reconstruction, the scaffold should provide host-tissue-like mechanical support for promoting neo-tissue growth and functioning. There are five types of tracheal substitutes in the research field: 1) synthetic prosthesis; 2) allografts; 3) tracheal transplantation; 4) tissue engineering, and 5) autologous tissue composite.¹⁸ The ideal tracheal substitute is still unclear, but some techniques have shown promising results. Among these, SF-HA scaffolds are easy to handle, have great mechanical strength, support cell adhesion, and allow the storage and release of growth factors produced by the cells.¹⁵ The multilevel three-dimensional porous structure of SF-HA scaffolds not only provides sufficient space for cell attachment and growth but also facilitates the diffusion of nutrients and metabolites. SF-HA scaffolds are suitable for use as tracheal repair scaffolds because of these properties. Therefore, we observed the biocompatibility of Ad-MSCs cells with SF-HA scaffolds thus exploring the prospect of Ad-MSCs cellularized SF-HA scaffolds as tracheal repair materials.

First, Ad-MSCs were spindle-shaped when maintained in standard culture conditions. Second, Ad-MSCs expressed CD44 and CD105 and lacked expression of CD45 surface molecule. Third, Ad-MSCs could differentiate into chondroblasts in vitro. Thus, isolated Ad-MSCs met the three criteria that was used to identify MSCs.¹⁹ Follow-up experiments confirmed Ad-MSCs could keep alive and continued to proliferate on the SF-HA scaffolds during the culture period. In particular, the living/dead assay showed the fluorescent coverage showed a statistical increase on day 7 compared to day 3 and was significantly elevated on day 14 compared to day 7. SEM also showed that 3 days post-inoculation, the cell coverage of Ad-MSCs on the SF-HA scaffolds was 78.15%, increasing to 92.91% by day 7 and peaking at 94.38% by day 14. Besides, the cells adhered on the SF-HA scaffolds with elongated morphology, suggesting good cell compatibility with the scaffolds.

To provide the molecular mechanisms for Ad-MSCs proliferation on SF-HA scaffolds, we examined the expression of ERK and pERK, which was essential for cell adhesion, growth, and differentiation.⁷ There were some studies on the relationship between MSCs and ERK signal pathway. For example, Bone marrow stromal cells could differentiate into osteoblasts via ERK activation.²⁰ A previous study also reported that activated ERK signaling could promote the chondrogenic differentiation of Ad-MSCs.²¹ For craniofacial bony defect repair, ERK signal pathway activation was closely coupled to the proliferation of Ad-MSCs.²²

The results of qRT-PCR showed that the expression of ERK mRNA was the highest on the third day and began to decline on the seventh day. At the same time, the expression of ERK protein did not change much on days 3, 7, and 14, but the expression of functional phosphorylated ERK protein increased on day 3 and decreased significantly on day 7, which was consistent with the change on ERK mRNA expression. The decrease of ERK protein and mRNA expression on the seventh day may be caused by the fact that the cells have covered most of the scaffold surface on the seventh day, and the space for further cell proliferation was limited. In fact, from the SEM experiment, we found that the cell coverage rate was 92.91% on the seventh day. The fluorescent coverage on SF-HA scaffolds showed an increase over time via live/dead assay. In addition, CCK-8 showed Ad-MSCs could proliferate on the SF-HA scaffolds during the 7 days. This proliferation phenotype was associated with an increase in the extent of ERK mRNA. From Pearson correlation analysis, the ERK mRNA expression was positively correlated with Ad-MSCs proliferation. On days 3 and 7, variations in pERK protein expression showed the same trend as those obtained for ERK mRNA expression. In summary, the ERK pathway was activated on day 3, at which the ERK mRNA was produced and then ERK was phosphorylated. Afterward, Ad-MSCs proliferated and covered most of the scaffold. Seven days after inoculation, less ERK mRNA was produced and less ERK protein was phosphorylated. Thus, from day 7 to day 14, the growth rate of Ad-MSCs decreased.

The phosphorylation level of ERK played an important role in Ad-MSCs proliferation and differentiation on SF-HA scaffolds. Several experimental studies found that SF-HA scaffolds could promote cell proliferation, and thus hold great promise for tissue regeneration and repair.^3,4 Zhao et al. demonstrated that SF/HA scaffolds containing naringin-loaded poly lactic-co-glycolic acid microspheres showed promise as osteo-modulatory biomaterials for bone regeneration.²³ Yu et al. found Silk fibroin-derived polypeptides promoted osteogenic differentiation for bone tissue engineering.²⁴ Besides, tricalcium silicate in scaffolds can activate the ERK signal pathway. On these bases, we speculated that the activated ERK signal pathway may be involved in Ad-MSCs proliferation on SF-HA scaffolds. If the ERK signal pathway was activated, SF-HA scaffolds may promote chondrogenic differentiation of Ad-MSCs, thus further promoting tracheal reconstruction.

Conclusion

In conclusion, our results demonstrated that Ad-MSCs showed good adhesion, growth, and proliferation on the SF-HA scaffolds. SF-HA scaffolds promote the proliferation of Ad-MSCs via activation of the ERK pathway. Therefore, the SF-HA scaffold cellularized with Ad-MSCs is a potential candidate for tracheal reconstruction.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Shanghai Science and Technology Committee (19ZR1407700).

References

Chen

Zhou

. Microstructure design of biodegradable scaffold and its effect on tissue regeneration. Biomaterials 2011; 32: 5003–5014.

Kundu

Rajkhowa

Kundu

, et al.. Silk fibroin biomaterials for tissue regenerations. Adv Drug Deliv Rev 2013; 65: 457–470.

McNamara

McCarthy

Schmidt

, et al. Rheological characterization, compression, and injection molding of hydroxyapatite-silk fibroin composites. Biomaterials 2021; 269: 120643.

Saleem

Rasheed

Yougen

. Silk fibroin/hydroxyapatite scaffold: a highly compatible material for bone regeneration. Sci Technol Adv Mater 2020; 21: 242–266.

Huang

Zou

Arno

, et al. Hydrogel scaffolds for differentiation of adipose-derived stem cells. Chem Soc Rev 2017; 46: 6255–6275.

Wang

. HGF and bFGF secreted by adipose-derived mesenchymal stem cells revert the fibroblast phenotype caused by vocal fold injury in a rat model. J Voice 2022; 36: 622–629. Epub ahead of print 2020. DOI: 10.1016/j.jvoice.2020.08.023.

Guo

Jia

, et al. Adipose mesenchymal stem cell-based tissue engineering mesh with sustained bFGF release to enhance tissue repair. Biomater Sci 2022; 10: 3110–3121. Epub ahead of print 11 May 2022. DOI: 10.1039/d1bm01893k.

Biernacka

Dobaczewski

Frangogiannis

. TGF-β signaling in fibrosis. Growth Factors 2011; 29: 196–202.

Liu

, et al. Role of the extracellular signal-regulated kinase 1/2 pathway in driving tricalcium silicate-induced proliferation and biomineralization of human dental pulp cells in vitro. J Endod 2013; 39: 1023–1029.

10.

S-C

Chen

C-H

Wang

J-Y

, et al. Hyaluronan size alters chondrogenesis of adipose-derived stem cells via the CD44/ERK/SOX-9 pathway. Acta Biomater 2018; 66: 224–237.

11.

Chen

Zhong

Wen

, et al. Porous three-dimensional silk fibroin scaffolds for tracheal epithelial regeneration in Vitro and in Vivo. ACS Biomater Sci Eng 2018; 4: 2977–2985.

12.

Wen

Yao

Chen

, et al. Silk fibroin act s as a self-emulsifier to prepare hierarchically porous silk fibroin scaffolds through emulsion-ice dual templates. ACS Omega 2018; 3: 3396–3405.

13.

Goel

Gowda

Veena

, et al. Adipose-derived mesenchymal stromal cells persist in tissue-engineered vocal fold replacement in rabbits. Ann Otol Rhinol Laryngol 2018; 127: 962–968.

14.

Dupuit

Gaillard

Hinnrasky

, et al. Differentiated and functional human airway epithelium regeneration in tracheal xenografts. Am J Physiol Lung Cell Mol Physiol 2000; 278: L165–L176.

15.

Navone

Pascucci

Dossena

, et al. Decellularized silk fibroin scaffold primed with adipose mesenchymal stromal cells improves wound healing in diabetic mice. Stem Cell Res Ther 2014; 5: 7.

16.

Kobayashi

Suzuki

Nomoto

, et al. A tissue-engineered trachea derived from a framed collagen scaffold, gingival fibroblasts and adipose-derived stem cells. Biomaterials 2010; 31: 4855–4863.

17.

Zhu

Jia

, et al. ADSC-Exos containing MALAT1 promotes wound healing by targeting miR-124 through activating Wnt/β-catenin pathway. Biosci Rep 2020; 40. Epub ahead of print 29 2020. DOI: 10.1042/bsr20192549.

18.

Etienne

Fabre

Gomez Caro

, et al. Tracheal replacement. Eur Respir J 2018; 51: 1702211.

19.

Dominici

Le Blanc

Mueller

, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006; 8: 315–317.

20.

Tang

Miao

, et al. Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone 2008; 43: 40–47.

21.

Luo

Shi

, et al. ITGB1 promotes the chondrogenic differentiation of human adipose-derived mesenchymal stem cells by activating the ERK signaling. J Mol Histol 2020; 51: 729–739.

22.

Jin

Zhang

Liu

, et al. rhPDGF-BB via ERK pathway osteogenesis and adipogenesis balancing in ADSCs for critical-sized calvarial defect repair. Tissue Eng Part A 2014; 20: 3303–3313.

23.

Sustained release of naringin from silk-fibroin-nanohydroxyapatite scaffold for the enhancement of bone regeneration - PubMed. 2022, https://pubmed.ncbi.nlm.nih.gov/35128373/ (accessed 29 August 2022)

24.

Deen

Rosei

. Silk fibroin-derived polypeptides additives to promote hydroxyapatite nucleation in dense collagen hydrogels. PLoS One 2019; 14: e0219429.