Preparation and osteogenesis of a multiple crosslinking silk fibroin/carboxymethyl chitosan/sodium alginate composite scaffold loading with mesoporous silica/poly (lactic acid-glycolic acid) microspheres

Abstract

Large bone defect repair is a striking challenge in orthopedics. Currently, inorganic-organic composite scaffolds are considered as a promising approach to these bone regeneration. Silicon ions (Si⁴⁺) are bioactive and beneficial to bone regeneration and Si⁴⁺-containing inorganic mesoporous silica (MS) can effectively load drugs for bone repair. To better control the release of drug, we prepared biodegradable MS/PLGA (MP) microspheres. MP loaded organic silk fibroin/carboxymethyl chitosan/sodium alginate (MP/SF/CMCS/SA) composite scaffolds were further constructed by genipin and Ca²⁺ crosslinking. All MP/SF/CMCS/SA scaffolds had good swelling ability, degradation rate and high porosity. The incorporation of 1% MP significantly enhanced the compressive strength of composite scaffolds. Besides, MP loaded scaffold showed a sustained release of Si⁴⁺ and Ca²⁺. Moreover, the release rate of rhodamine (a model drug) of MP/SF/CMCS/SA scaffolds was obviously lower than that of MP. When culturing with rat bone marrow mesenchymal stem cells, scaffolds with 1% MP displayed good proliferation, adhesion and enhanced osteogenic differentiation ability. Based on the results above, the addition of 1% MP in SF/CMCS/SA scaffolds is a prospective way for drug release in bone regeneration and is promising for further in vivo bone repair applications.

Keywords

Bone repair silicon ions drug release silk fibroin/carboxymethyl chitosan/sodium alginate mesoporous silica/poly (lactic acid-glycolic acid) microspheres

Introduction

Recently, large bone defects caused by trauma, tumors, infection, and other reasons have increased significantly.¹ Every year, more than two million bone transplants are performed worldwide.² Bone defects are the second most common tissue transplantation after blood transfusion.³ Autologous bone transplantation is considered to be the best choice for bone defect repair, but there are limitations in the source of donor and injury or infection of donor sites; Allogeneic bone is also used, but it has risk of infection.⁴ Therefore, bone tissue engineering has attracted the attention of researchers. The strategies in bone tissue engineering for large bone repair include scaffold-guided bone regeneration, designing inorganic-organic composite scaffolds and so on.^5,6 These scaffolds should provide osteoconductive surfaces for cell attachment and pores for subsequent bone formation. Controlling the degradation rate and strength of bioabsorbable scaffolds is essential to balance the rate of bone regeneration. Besides, biomaterials mimicked the inorganic-organic composition of bone and loaded with bioactive factors and ions are beneficial for bone repair.^7,8

At present, bioceramics, biometallic metals, and biopolymers are the most commonly used substrate materials for the scaffolds of bone tissue engineering. Among them, natural polymers have superior cellular compatibility and biodegradability, therefore being widely used in bone tissue engineering.⁹ Silk fibroin (SF) is a natural protein derived from silkworm cocoon, which has good cytocompatibility, adjustable biodegradability, and easy extraction.¹⁰ It is considered as a good biomaterial for tissue regeneration. However, the application of SF in bone tissue engineering is limited by its weak mechanical properties and lack of osteoinductivity.¹¹ Therefore, SF is usually combined with other biomaterials (chitosan, sodium alginate, etc.) and cross-linked with biocompatible agents (genipin, EDC, etc.), to build composite scaffolds with good mechanical and biological properties.^12,13 Among them, carboxymethyl chitosan (CMCS) is a derivative of chitosan, has higher water solubility than chitosan, and can chelate with more Ca²⁺, showing superior biomineralization activity.¹⁴ Sodium alginate (SA) is an anionic copolymer derived from brown sea algae, can gelatinize with Ca²⁺ and has no cytotoxicity and biodegradability,¹⁵ which is widely used in tissue engineering. The degradation property of SF is poor, while the degradation rate of SA is faster.¹⁶ Therefore, the addition of SA effectively regulates the degradation performance, thus making it better adapted to bone tissue regeneration. Therefore, a stable and robust multi-crosslinked composite scaffold (SF/CMCS/SA composite scaffolds) will be developed by lending the three natural polymers and crosslinking with Ca²⁺ and genipin.

In addition to the necessary physicochemical properties and cytocompatibility, osteoinduction plays a key role in bone repair biomaterials. Drugs or bioactive ions were introduced to improve the osteoinductivity of bone repair biomaterials.^17,18 For a long time, degradable polymer based microspheres have been widely used in drug delivery due to their excellent controlled-release ability. Among them, poly (lactic acid-glycolic acid) (PLGA) based microspheres have received widespread attention.¹⁹ PLGA has been approved by the Food and Drug Administration (FDA) and the European Medicines Agency (EMA) for biomaterial applications due to its biocompatibility and biodegradation.²⁰ However, the acidic degradation products of PLGA can lead to poor biological activity and severe local inflammation,⁸ which hinders its application in bone tissue engineering. As a biocompatible and bioactive material, mesoporous silica (MS) has the ability to induce the formation of the mineral calcium phosphate on the surface, similar to the bone.²¹ Alkaline Si ions released from MS is essential for metabolic processes related to the formation of bone tissues. It is involved in the early stages of bone mineralization, thereby inducing hydroxyapatite deposition in bone matrix.²² Consequently, MS can greatly accelerate the apatite deposition kinetics, thus enhancing the osteogenic activity of these materials. Clinical studies have also proven that silicon ions intake increases bone density and promotes bone health.²³ Besides, MS particles are characterized with high surface area, large pore volume, and tunable pore size, which can be good carriers for drugs and molecules through absorption and surface modification.²⁴ Combining the advantages of MS and PLGA, MS/PLGA (MP) microspheres will be a better candidate for drug controlled-release. However, the biocompatibility and drug release ability of MP in natural polymer composite scaffolds are still unknown, especially its potential bone regeneration ability needs further evaluation.

In this study, we first constructed MP carriers for drug sustained-release. Then, SF/CMCS/SA composite scaffolds loaded with MP were prepared and their physicochemical properties, release behaviors, and osteogenesis in vitro were evaluated in order to screen the optimal content of MP in SF/CMCS/SA composite scaffolds.

Materials and methods

Preparation of MP/SF/CMCS/SA composite scaffolds

Materials

Sodium carbonate (Na₂CO₃), lithium bromide (LiBr), and anhydrous calcium chloride (CaCl₂) were acquired from Mucklin (China). Anhydrous ethanol and dichloromethane were purchased from Guangzhou Chemical Reagent Company (China). Polylactic acid-glycolic acid copolymer (50:50, 31,000 g/mol) was purchased from Jinan Daigang (China). Polyvinyl alcohol (PVA) was purchased from Sigma-Aldrich (USA). CMCS was purchased from Yuanye (China), and SA was purchased from Aladdin (China). Genipin and dialysis bags (8 kDa) were purchased from Yuanye (China).

Extraction of SF

The cocoons removed from silkworm chrysalis were heated to 95°C for 30 min in Na₂CO₃ solution. Then, they were washed with distilled water. The above procedures were repeated with Na₂CO₃ solution. The cocoons were dried at 60°C. Next, 5 g dried cocoon was added to the LiBr solution and placed in the shaker until it was completely dissolved. Then, the solution was filtered through gauze and transferred to a dialysis bag for dialysis at room temperature. Finally, the SF solution was dried by lyophilization.

Fabrication of MP microspheres

MP microspheres was synthesized by a single emulsion solvent evaporation method.²⁵ In brief, PLGA and MS powders were dissolved in a dichloromethane solution. After ultrasound treatment, the suspension was added into PVA aqueous solution and stirred. Finally, MP was separated, washed and lyophilized.

Fabrication of MP/SF/CMCS/SA scaffolds

Briefly, 120 mg SF, 120 mg CMCS powder, and 60 mg SA were dissolved in 2.925 mL of distilled water. After complete dissolution, 3 mL of 1% genipin solution and 75 μL 10% CaCl₂ solution were added to the mixture. MP with different contents (0%, 0.5%, 1%, and 2%) was added to the mixed solution. Finally, they were placed at 37°C for 20 min to crosslink. In the end, these samples were frozen overnight and freeze-dried.

Characterization

Composition of MP and composite scaffolds

SF films, CMCS powders, SA powders, and MP/SF/CMCS/SA scaffolds were tested with ATR mode of fourier transform infrared spectrometer (FTIR; Thermo Scientific, USA). The range of the scanning spectrum was 600–4000 cm⁻¹. The resolution was 4 cm⁻¹ to collect the infrared absorption spectrum of the samples.

For X-ray diffractometer (XRD; Rigaku, Japan) analysis, CuKα rays are selected. X-ray wavelength was λ = 1.5406 Å, and the scanning speed was 2 min. The super probe recorded the diffraction intensity curve of 2θ = 10°∼60°. The XRD patterns of the samples were obtained.

Thermogravimetric analysis

Thermogravimetric analysis (TGA) was measured by the TG 209F3 instrument (Netzsch, German). The thermal properties of MP samples were analyzed under N₂ flow from 30°C to 800°C at a heating speed of 10 K/min. Finally, the percent weight loss with temperature and peak decomposition temperature was obtained by TG diagrams and DTG diagrams.

Morphological features

MS/PLGA microspheres and MP/SF/CMCS/SA scaffolds were pasted onto the sample platform with conductive adhesive. Gold spraying operation was performed after pumping the vacuum. Subsequently, the morphology of MP and scaffolds was observed by scanning electron microscope (SEM; Phenom, the Netherlands), and the element composition was detected with Energy-dispersive spectroscopy (EDS; Phenom). The distribution of MS/PLGA microspheres was analyzed by Image J software. The final consequence was presented as mean ± SD.

Compressive test

The compressive test was conducted using a compressive testing system (Kinsgeo, China) to evaluate the mechanical properties of the scaffolds. The freeze-dried samples were loaded in two flat disks. The samples were compressed to 60% of the original height at 2 mm/min. The compressive elastic modulus was determined and calculated by the slope of the initial linear region (0%∼20%) of the stress-strain curve.

Swelling test

The composite scaffold was weighted as W₁ and soaked in PBS (pH = 7.4). Furthermore, it was placed on a shaking table with 90 r/min and 37°C until its swelling reached equilibrium. At predetermined intervals, the scaffold was taken out, and excess water on its surface was removed with filter papers. Immediately, it was weighted as W₂. Eventually, the swelling rate (SR) was calculated according to formula (1).

SR = (W_{2} ‐ W_{1}) / W_{1} * 100 %

(1)

Porosity test

The composite scaffolds were immersed in anhydrous ethanol until saturated without bubbles. The scaffold was weighed before and after immersion in alcohol (n = 3). The porosity (P) was calculated as follows:

P = (W_{4} ‐ W_{3}) / ρ V * 100 %

(2)

where W₃ and W₄ represent the weight of the sample before and after immersion in alcohol, respectively. V is the volume of the scaffold, and ρ is the density of alcohol.

In vitro degradation behaviors

The degradation of the composite scaffolds was carried out in PBS and placed in a shaking table at 37°C and 90 r/min. At a scheduled time, the composite scaffolds were fetched out, freeze-dried, and weighted. The percent mass remaining of composite scaffolds was calculated by equation (3).

Mass remaining = (W_{5} - W_{6}) / W_{5} * 100 %

(3)

W₅ and W₆ are the initial and scaffold weights, respectively.

The concentration of Si⁴⁺ and Ca²⁺ in PBS solution was detected by inductively coupled plasma (ICP; Thermo Scientific). The liquid pH was also measured by a pH meter (Thermo Scientific).

Determination of drug release behaviors

Rhodamine (Rh) was selected as a model drug to evaluate the drug-sustained release of MP. Firstly, MP loaded with 1.5% Rh was prepared according to a previous study.²⁵ They were blended in the scaffolds to fabricate the Rh-MP/SF/CMCS/SA scaffolds. The release of Rh from MP and the scaffolds was measured in vitro. Simply, they were immersed in phosphate buffer solution (PBS) and placed in a shaking table at 37°C. At predetermined time points, the supernatant was taken after centrifugation. It was measured for the absorbance by a microplate reader (Tecan, Switzerland). At last, the release of Rh was calculated using a designed standard curve.

Biocompatibility and osteogenic differentiation of rat bone marrow mesenchymal stem cells (rBMSCs)

Preparation of scaffold extracts

Firstly, the composite scaffolds were irradiated by UV light and soaked in 70% alcohol for 15 min. Then, they were washed with PBS to remove alcohol. They were soaked in a basal medium and placed in an incubator. After incubation for 1 day, the supernatant was sterilized by filter membrane (0.22 μm). Finally, the extract was prepared by mixing the supernatant with double FBS and P/S containing culture medium by a volume ratio of 1:1. It was used to culture rBMSCs with passage of 3∼6. The scaffold extract was supplemented with 50 μg/mL vitamin C, 100 nM dexamethasone and 10 mM β-phosphoglycerol for osteoinductive experiments.

Cell compatibility test

In brief, 2 × 10⁴ rBMSCs were seeded on each well of a 48-well plate (Corning). On the next day, the medium was replaced with a complete medium with composite scaffold extract. Besides, cell activity was measured by cell counting kit-8 (CCK-8, Abbkine) at 1, 3, and 7 days. Initially, the complete medium was removed and rinsed with PBS. After mixing CCK-8 solution with the complete medium, they were added to the well plate and incubated for 2 h at 37°C. Finally, the optical density (OD) value at the wavelength of 450 nm was measured by a microplate reader.

Live and dead cell staining

Cell viability was further evaluated by a Live/Dead staining kit (Biotium, USA). Firstly, 4 × 10³ rBMSCs per scaffold were cultured in 96-well plates for 1 and 7 days. At the scheduled time, every well was washed with PBS and covered with the staining solution containing Calcien AM and EthD-III. It was incubated in the incubator at 37°C. After 20 min, the status and number of living and dead cells were observed by fluorescence microscopy (Leica, USA). Living cells and dead cells presented green and red on fluorescent images, respectively.

Cell adhesion

In order to observe cell adhesion on the composite scaffolds, 2 × 10⁴ rBMSCs were seeded on the scaffolds and co-cultured for 1 day. After reaching the time point, the cells were fixed with 4% paraformaldehyde overnight. Moreover, the composite scaffolds were dehydrated sequentially with different concentrations of ethanol (50%, 70%, 80%, 90%, and 100% for 5 min each). After freeze-drying, composite scaffolds were sprayed with gold, and cell morphology was observed by SEM.

Alkaline phosphatase staining (ALP)

The expression of ALP was evaluated by BCIP/NBT alkaline phosphatase chromogenic kit (Beyotime, China). The cell suspension was co-cultured with the osteoinductive medium with scaffold extract. After 14 days of incubation, the wells from 96-well plates were rinsed with PBS, and the cells were fixed with 4% paraformaldehyde. Then, the ALP staining was performed as the protocol and photographed for observation.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The osteogenic differentiation gene expression was detected by the qRT-PCR method. Their primer sequences are listed in Table 1, and they were synthesized through Sangon Biotech (China) Co., Ltd. At first, 3 × 10⁴ rBMSCs were cultured on each well of a 48-well plate, and cells were collected at 7 days and 14 days. Then, total RNA was extracted from each well by Hipure Total RNA Micro Kit (Magen, China) and determined by a spectrophotometer (Thermo Scientific). Its cDNA was synthesized using Transcriptor cDNA Synth. Kit (Roche, USA). The osteogenic differentiation gene expression (OPN and Runx-2) was measured through the StepOnePlus real-time PCR system (Thermo Scientific) following the operation guide.

Table 1.

Primer sequences of osteogenic differentiation genes expression.

Gene name	Primer (5′ to 3′)	Primer sequence
GAPDH	Forward	AGCCCAGAACATCATCCCTG
GAPDH	Reverse	CACCACCTTCTTGATGTCATC
OPN	Forward	CGGTGAAAGTGACTGATTCTGG
OPN	Reverse	GGAGATTCTGCTTCTGAGATGG
Runx-2	Forward	CCGATGGGACCGTGGTT
Runx-2	Reverse	CAGCAGAGGCATTTCGTAGCT

Statistical analysis

All data were analyzed using SPSS for one-way analysis of variance (ANOVA) test and results were shown as means ± standard deviations. Differences p < .05 are regarded to be statistically significant.

Results and discussion

Composition and morphology of MP and composite scaffolds

The preparation of MP and MP/SF/CMCS/SA composite scaffolds were illustrated in Figure 1.

Briefly, MP microspheres were synthesized by an improved single solvent evaporation method. Its morphology, sizes, and distribution were displayed in Figure 2(a) and (b). As shown in Figure 2(a) and (b), MP microspheres exhibited a clearly regular spherical geometry, were uniform in size and the average diameter was 113.79 ± 23.87 μm. EDS analysis detected C, O, and Si elements on microsphere surface (Figure 2(c)). This proved that we successfully synthesized MP composite microspheres. Besides, the surface of MP was rough with MS particles and some shallow holes of various sizes. These porous structures increased the area of water infusion, which contributed to drug release.²⁶ MS powders can slow the drug release rate due to their mesoporous structure.²⁷ In addition, the drugs from MS in MP could be released gradually with the degradation of PLGA. It was suggested that MP possessed a double-layer drug loading ability, which was a better candidate for the sustained release of drugs.

TGA analysis was exhibited in Figure 2(d) and (e). MP samples displayed a slight weight loss in the temperature range of 30°C ∼ 300°C, which was a consequence of water evaporation from PLGA matrix.²⁸ Besides, a significant weight loss among 300°C ∼ 400°C was recorded due to PLGA decomposition.²⁹ Until 800°C, the weight loss of MP samples was 98.51%. Since MS cannot decompose below 800°C, the residual weight at 800°C can be regarded as the content of MS in MP samples. Consequently, the mass fraction of MS in MP could be estimated as 1.49%, which indicated that PLGA microspheres effectively encapsulate MS. The maximum decomposition temperature of MP samples at 355.87°C could be observed in Figure 2(e). It suggested a significant rate of weight loss around 355.87°C in the TG curve, which was related to PLGA decomposition.

To prepare composite scaffolds, MP was incorporated into SF/CMCS/SA solution and cross-linked by genipin and Ca²⁺. The molecular structure and chemical functional groups of composite scaffolds with different MP content were identified by FTIR. As viewed in Figure 3(a), FTIR spectrum of SF showed a stretching vibrational peak of -OH at 3283 cm⁻¹. Amide Ⅰ, amide Ⅱ and amide Ⅲ were characterized by the absorption peaks at 1644 cm⁻¹, 1529 cm⁻¹, and 1231 cm⁻¹, respectively.³⁰ They could be attributed to the β-sheet structures. In particular, amide Ⅰ was mainly assigned to stretching vibration of C=O and C-N. Amide Ⅱ was dominated by the bending vibration of N-H and the stretching vibration of C-N. Amide Ⅲ also major in the stretching vibration of C-N and bending vibration of N-H.³¹ For FTIR spectrum of CMCS, the characteristic peaks were presented at 3407.6 cm⁻¹ (stretching vibration of -OH and -NH), 2908.6 cm⁻¹ (stretching vibration of -CH), and 1309.4 cm⁻¹ (bending vibration of -CH).^32,33 The absorption of the stretching vibrations of C-N and C-O was located at 1112 cm⁻¹ and 1027 cm⁻¹, respectively.³⁴ Furthermore, the instinct peak around 1584.2 cm⁻¹ and 1413 cm⁻¹ could be attributed to the asymmetric and symmetric stretching vibration of -COOH, respectively, which suggested the presence of carboxymethyl groups.³⁵ In the FTIR spectrum of SA, the peaks about 1591.9 cm⁻¹ and 1405.3 cm⁻¹ were responsible for the -COO group.³⁶ Another sharp peak around 1025.9 cm⁻¹ was assigned to the vibration of C-O.³⁷ Additionally, the spectrum of composite scaffolds corresponded to the spectrum of SF, CMCS, and SA, indicating the successful construction of composite scaffolds and the cross-linkers had little effect on their composition.

The crystallographic properties of composite scaffolds were displayed in the XRD pattern (Figure 3(b)). XRD spectrum of composite scaffolds generally exhibited a broad peak around 20°, which was attributed to the β-sheet crystalline domain of SF.³⁸ The broad peak indicated composite scaffolds were low crystalline or amorphous phases .³⁹ In addition, the slight sharp diffraction peaks at near 2θ = 19.7°, 20.72°, 21.32°, and 26.44° in SF/CMCS/SA scaffold were originated from crosslinking agents, CaCl₂ (JCPDS: 01-070-2740). There were no these peaks in MP loaded scaffold, which indicated CaCl₂ might deposit with silicon ions from MP and the reaction product was too little to be detected.

At the same time, the addition of MP didn’t impact the microstructure of composite scaffolds. As seen in Figure 3(c), the vertical section of the scaffolds displayed that MP microspheres were dispersed evenly in the scaffold and contacted closely with the scaffolds. But MP microspheres aggregation was observed in 2% composite scaffolds. Moreover, the interconnecting porous structures were found on their SEM images, which was helpful for promoting nutrient exchange, cell interaction, and cell survival.⁴⁰ It also showed that the microspheres on the surface were obviously increased with their incorporation. The elements of C, O, N, Na, and Ca were identified on the composite scaffolds by EDS. Compared with pure composite scaffolds, EDS results of composite scaffolds loading MP could also detect Si.

Compressive strength, swelling ability, and porosity

The compressive mechanical properties of freeze-dried composite scaffolds and the soaked scaffolds under dynamic loads were measured, and their consequence was represented in Figure 4(a)–(c) and Figure S1.

The test demonstrated that the compressive stress and elastic modulus of dry scaffolds could be regulated by microsphere concentration. The composition of the natural polymer and the crosslinking degree of scaffolds affected the compressive strength.⁴¹ As the increase of microsphere concentration, the compressive strength was gradually enhanced and then weakened. In particular, 1% MP in the composite scaffolds exhibited the maximum compressive strength. It could be explained that Si ions released from MP acted as the role of Ca ions and alkalize the microenvironment, thereby accelerated the crosslinking degree of SF/CMCS/SA with genipin.4⁴² When the concentration of MP exceeded 1%, the compressive properties decreased distinctly, which could be related to the uneven distribution of MP in 2% composite scaffolds. The composite scaffolds took some time to form. So, more MP microspheres in the 2% composite scaffolds deposited and distributed unevenly.⁴³ Moreover, the average compressive strength of the scaffolds with 0%, 0.5%, 1%, and 2% MP at 60% strain was 179.36 ± 13.47 kPa, 256.25 ± 11.84 kPa, 415.24 ± 3.72 kPa, and 310.88 ± 23.26 kPa, respectively. Their elastic modulus were 0.50 ± 0.04 MPa, 0.86 ± 0.15 MPa, 1.31 ± 0.14 MPa, and 0.84 ± 0.05 MPa, respectively. When soaking the scaffolds in PBS for 12 h, the results in Figure S1(a)–(d) showed that the strength of all scaffolds was lower than that of dry samples, but they had good recovering ability (80%∼90%) after five cycles of load. The mechanical strength of scaffolds was also influenced by MP concentration and 1% scaffolds had the highest strength and elastic modular (Figure S1(e) and (f)). In conclusion, 1% MP significantly improved the mechanical strength of composite scaffolds.

The swelling performance of the composite scaffolds was detected by water absorption ability. It was decreased with the increase of MP content (Figure 4(d) and (e)). Their swelling rate was increased significantly in the first 2 h. The initial rapid swelling was due to the porous structure and the absorption ability of SF, CMCS, and SA, which was beneficial to nutrient absorption, drug diffusion, and cell adhesion on the three-dimensional matrix.⁴⁴ After 2 h, their swelling rate rose slowly and reached a swelling equilibrium at 12 h. Their absorption rate of 24 h were 1533.81 ± 65.41%, 1219.79 ± 88.32%, 1116.02 ± 33.37%, and 952.58 ± 51.83%, respectively. Particularly, the swelling rate of all scaffolds with MP was obviously slower than that of SF/CMCS/SA scaffolds. The swelling properties of the scaffold were highly related to the mechanical properties of the scaffolds. Higher compressive strength was due to a higher crosslinking degree, which decreased the swelling ability.⁴⁵ Generally, the greater the elastic modulus of scaffolds, the lower its swelling ratio.⁴⁶ Although the swelling rate of 2% composite scaffolds was also significantly decreased, its compressive strength was weakened. Excessive MP microspheres tended to lead to their agglomeration, which reduced the elastic modulus and compressive strength of the composite scaffolds.⁴⁷

Additionally, the porous structure and porosity of scaffolds affected cell behavior and nutrient transportation.⁴⁸ The porosity of scaffolds was measured according to the Archimedes principle.⁴⁹ As shown in Figure 4(f), the porosity of the former three groups was over 80%, and the porosity of the 2% groups was lower than 80%. High porosity promotes nutrient and oxygen diffusion as well as metabolic waste removal, thus facilitating cell attachment, proliferation, differentiation, and migration.^48,50 Concretely, their porosity was approximately 89.13 ± 4.61%, 88.44 ± 1.26%, 87.13 ± 2.88%, and 79 ± 5.77%, respectively.

Degradation and release properties

Biodegradable scaffolds were beneficial in providing structural support to promote tissue regeneration.⁵¹ And they gradually biodegraded during new bone tissue formation.⁵² So, the degradation properties play an essential role in bone tissue engineering. The degradation rates were displayed in Figure 5(a). The degradation rate of the composite scaffolds was slowed down with the increase of MP microspheres. Due to PLGA microsphere degradation,²⁵ the mass decrease rate of the composite scaffolds loaded with MP was faster than the control group after 21 days. The degradation behavior of 0% scaffolds was similar to that of 0.5% scaffolds due to the addition of MP was low. All the composite scaffolds had good stability. The degradation results in vitro were in line with the swelling performance and compression properties of composite scaffolds.⁵³ These results showed that the incorporation of MP microspheres could drastically improve the stability and compression properties of composite scaffolds. Depending on the evaluation of swelling, porosity, and degradation properties, 1% scaffold had excellent physicochemical properties and was more suitable for bone repair applications. As shown in Figure 5(b), the pH of PBS solution ranged from 7.35 to 7.45 during 56 days. At 14 days, pH of scaffolds with MP was higher than that of control group. After 21 days, the pH decreased with an increase in MP incorporation of composite scaffolds. The pH values in different composite scaffolds by 21 days were 7.34, 7.31, 7.30, and 7.29, respectively. These pH changes may be related to PLGA and MS degradation. The concentration of Si⁴⁺ and Ca²⁺ released from composite scaffolds during degradation were displayed in Figure 5(c) and (d). The concentration of released Si⁴⁺ and Ca²⁺ was increased with the content of MP. For Ca²⁺ released from the composite scaffolds, it tended to be fast at first and then slow. The initial fast stage was caused by Ca²⁺ release from the cross-linker (CaCl₂) due to the swelling and degradation of scaffolds. The concentration of Si⁴⁺ released from 2% scaffolds increased significantly at first and then decreased. At 42 and 56 days, the concentration of Si⁴⁺ was close to that of 0.5% and 1% composite scaffolds. The initial rapid phase of Si⁴⁺ release rate from 2% scaffolds may be related to the uneven distribution and deposition of MP.

We selected scaffolds with 1% MP for drug and ion release experiments. As observed in Figure 5(e) and (f), MP and composite scaffolds both exhibited excellent sustained release behaviors of Rh. For Rh-MP, four distinct phases of Rh release were observed, including an initial plateau phase, a rapid phase, a plateau phase, and a late slow phase. The initial rapid phase was probably related to the drug released from the surface of MP and MS attached on the surface of MP microspheres. It continued for from 1 h to 7 days with a cumulative release of 5.0%. From 14 days to 21 days, Rh released from MP rapidly and the cumulative release of Rh at 21 days was 73.3%, which was greatly higher than the cumulative release of Rh-MP loaded composite scaffolds (8.6%). This suggested that SF/CMCS/SA composite polymer acted as a sustained release carrier to prevent the rapid release of drugs during the second stages. During the plateau phase, the release rate of two groups was slow. The cumulative release of Rh in Rh-MP group increased from 73.3% to 74.3% between 21 days and 35 days. The phase was considered to be controlled by Rh from slow degradation of PLGA matrix and MS attached to microspheres. The cumulative release of Rh in 1% group increased from 8.6% to 23.3% between 21 days and 35 days. The late slow phase was associated with the fast degradation of PLGA polymer and Rh release from free MS. However, the cumulative release of Rh from the composite scaffolds was only 52.3%, which was much lower than that (98.9%) in Rh-MP group. For Rh-MP composite scaffolds, there was no evident rapid release of Rh in the composite scaffolds. The release speed of scaffolds with 1% MP was slower than that of microspheres due to the encapsulation ability of SF/CMCS/SA.⁵⁴

Cytocompatibility and osteogenesis of composite scaffolds

Biocompatibility of scaffolds was one of the most necessary requirements for bone tissue engineering.⁵⁵ Live/dead cell staining, cell adhesion, and CCK-8 experiments were carried out to evaluate the cytocompatibility of composite scaffolds.

For live/dead cell staining, 0%, 0.5%, and 1% scaffolds have no negative impact on rBMSCs viability at 1 day and 7 days (Figure 6(a)). The number of cells at 7 days was clearly greater than that at 1 day. However, the number of cells in 2% group at 7 days was less than that in other groups, which indicated that 2% MP in the scaffolds could inhibit cell proliferation.

The cell attachment on the scaffold was observed by SEM (Figure 6(b)). SEM images showed that rBMSCs spread and extended pseudopods on the scaffolds after 1-day culture, which suggested that SF/CMCS/SA scaffolds promoted cell adhesion.⁵⁶ And there were no statistical differences between the groups. The incorporation of MP had little impact on cell adhesion.

As seen in Figure 6(d), CCK-8 results showed that the cell activity was firstly enhanced and then weakened with the increase of MP content. The composite scaffolds with 0%, 0.5%, and 1% MP exhibited good cytocompatibility. However, 2% group appeared to obviously inhibit cell proliferation. CCK-8 results were consistent with those of live/dead cell staining.

As described in the above results, the composite scaffolds with less than 2% MP interacted positively with rBMSCs. They could promote cell viability, cell proliferation, and cell adhesion, which had potential applications in tissue engineering.

For bone repair materials, the capacity to induce osteogenic differentiation of rBMSC is a key factor.⁵⁷ ALP and calcium nodules are early and late markers of osteoblast differentiation, respectively. They were positively correlated with the level of osteogenic differentiation of rBMSCs.⁵⁸ As shown in Figure 6(c), the addition of MP could enhance ALP activity and increased calcium deposition. ALP activity and calcium deposition were dependent on the MP content. However, the osteogenic differentiation of rBMSCs was suppressed when the MP content was 2%. In this regard, the composite scaffold loading of 1% MP could lead to a large number of ALP and calcium nodules compared to the other groups, which was beneficial to bone regeneration. Further quantitative analysis of osteogenic differentiation of rBMSCs was displayed in Figure 6(e) and (f). The expression of osteogenesis-related genes (including OPN and Runx-2) was increased in the 1% group compared to the other groups. Notably, though 1% group did not have the highest cell activity, it had the most obvious osteogenic effect. The osteogenic factor that played an important role in the composite scaffolds is Si ions released from MP. The osteogenic effect of 1% group was better than that of 0.5% scaffolds due to more released Si⁴⁺.

As the scaffolds developed in this study has good compatibility and osteogenesis, we will conduct in vivo bone defect experiments in mice or rats in future to evaluate their long degradation behavior, stability and bone repair effect when incorporating inorganic materials (biogalss, calcium phosphate, etc.) in the matrix and/or loading factors (BMPs, VEGF and other drugs) in MP microspheres. Besides, the potential future research directions also include bone hemostasis as their high absorption rate and the composition of CMCS and SA had good hemostatic performance.⁵⁹

Conclusion

In conclusion, our work developed a novel strategy to prepare porous composite scaffolds based on mesoporous silica/PLGA (MP) microspheres and SF/CMCS/SA matrix for drug loading and bone repair. The composite scaffolds loading with MP enabled slower release of Rh, which would be favored for the sustained and steady release of osteogenic drugs. Moreover, MP enhanced the compressive strength and decreased the swelling, porosity, and degradation performances of SF/CMCS/SA composite scaffolds. Among them, 1% MP loaded scaffolds had the highest strength. In addition, the composite scaffolds could release bioactive ions (Ca²⁺ and Si⁴⁺), which are beneficial to osteogenesis of BMSCs. SF/CMCS/SA scaffolds with 1% MP not only had optimized cytocompatibility, but also possessed the best osteogenic performance. Therefore, SF/CMCS/SA composite scaffolds with 1% MP will be desirable scaffolds for bone regeneration.

Supplemental Material

Supplemental Material - Preparation and osteogenesis of a multiple crosslinking silk fibroin/carboxymethyl chitosan/sodium alginate composite scaffold loading with mesoporous silica/PLGA microspheres

Supplemental Material for Preparation and osteogenesis of a multiple crosslinking silk fibroin/carboxymethyl chitosan/sodium alginate composite scaffold loading with mesoporous silica/PLGA microspheres by Yiwan Shi, Zhaozhen Wang, Weikang Xu, Xiaolu Yu, Botao Gao, Xinting Zhou, Jiwen Chen, Kunfeng Jia, Lek Hang Cheang, Man seng Tam, Huajun Wang, Xiaofei Zheng and Tingting Wu in Journal of Biomaterials Applications.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the Research and Development Plans in Key Areas of Guangdong Province (2020B1111560001), The Special Fund Project for GDAS to Build First Class Research Institutions in China (2019GDASYL-0102004/0103018), the National Natural Science Foundation of China (52102343, 82172440), the National Key Research and Development Program of China (2022YFE0206200), Guangzhou Science and Technology Program (2024A04J3423), GDAS’ Project of Science and Technology Development (2023GDASZH-2023010102), Natural Science Foundation of Guangdong Province (2024A1515010571, 2023A1515011860), Science and technology development fund (FDCT) of Macao (FDCT 0009/2021/AMMJ).

ORCID iD

Tingting Wu

Supplemental Material

Supplemental material for this article is available online.

References

Migliorini

La Padula

Torsiello

, et al. Strategies for large bone defect reconstruction after trauma, infections or tumour excision: a comprehensive review of the literature. Eur J Med Res 2021; 26(1): 118.

Nik Md Noordin Kahar

NNF

Ahmad

Jaafar

, et al. A review of bioceramics scaffolds for bone defects in different types of animal models: HA and β-TCP. Biomed Phys Eng Express 2022; 8(5): 052002.

Zhang

Lin

Meng

, et al. 3D gel-printed porous magnesium scaffold coated with dibasic calcium phosphate dihydrate for bone repair in vivo. J Orthop Translat 2022; 33: 13–23.

Sanz-Sánchez

Sanz-Martín

Ortiz-Vigón

, et al. Complications in bone-grafting procedures: classification and management. Periodontol 2000 2022 88(1): 86-102.

Laubach

Hildebrand

Suresh

, et al. The concept of scaffold-guided bone regeneration for the treatment of long bone defects: current clinical application and future perspective. J Funct Biomater 2023; 14(7): 341.

, et al. Biologically modified implantation as therapeutic bioabsorbable materials for bone defect repair. Regen Ther 2021; 19: 9–23.

Xue

Deng

, et al. Recent advances in design of functional biocompatible hydrogels for bone tissue engineering. Adv Funct Mater 2021; 31(19): 2009432.

Jin

Xia

Huang

, et al. Recent advances in PLGA-based biomaterials for bone tissue regeneration. Acta Biomater 2021; 127: 56–79.

Bharadwaz

Jayasuriya

. Recent trends in the application of widely used natural and synthetic polymer nanocomposites in bone tissue regeneration. Mater Sci Eng C Mater Biol Appl 2020; 110: 110698.

10.

Kim

Hong

Ajiteru

, et al. 3D bioprinted silk fibroin hydrogels for tissue engineering. Nat Protoc 2021; 16(12): 5484–5532.

11.

Zhang

Liu

, et al. Nano-hydroxyapatite composite scaffolds loaded with bioactive factors and drugs for bone tissue engineering. Int J Mol Sci 2023; 24(2): 1291.

12.

Zhang

X-Y

Chen

Han

, et al. Biocompatiable silk fibroin/carboxymethyl chitosan/strontium substituted hydroxyapatite/cellulose nanocrystal composite scaffolds for bone tissue engineering. Int J Biol Macromol 2019; 136: 1247–1257.

13.

Xin

Zheng

, et al. Delivery vehicle of muscle-derived Irisin based on silk/calcium silicate/sodium alginate composite scaffold for bone regeneration. Int J Nanomedicine 2019; 14: 1451–1467.

14.

Ren

, et al. Chitosan-based biomimetically mineralized composite materials in human hard tissue repair. Molecules 2020; 25(20): 4785.

15.

Zheng

Cao

Liu

, et al. Biocompatible silk/calcium silicate/sodium alginate composite scaffolds for bone tissue engineering. Carbohydr Polym 2018; 199: 244–255.

16.

Wang

Ling

Chen

, et al. 3D-printed composite scaffold with gradient structure and programmed biomolecule delivery to guide stem cell behavior for osteochondral regeneration. Biomater Adv 2022; 140: 213067.

17.

Lalzawmliana

Anand

Roy

, et al. Mesoporous bioactive glasses for bone healing and biomolecules delivery. Mater Sci Eng C Mater Biol Appl 2020; 106: 110180.

18.

Aryan

Behpour

Benvidi

, et al. Evaluation of sodium alendronate drug released from TiO2 nanoparticle doped with hydroxyapatite and silver–strontium for enhancing antibacterial effect and osteoinductivity. Mater Chem Phys 2023; 295: 126934.

19.

Zhang

Sun

, et al. PLGA-based biodegradable microspheres in drug delivery: recent advances in research and application. Drug Deliv 2021; 28(1): 1397–1418.

20.

Martinez-Borrajo

Diaz-Rodriguez

Landin

. Rationalized design to explore the full potential of PLGA microspheres as drug delivery systems. Drug Deliv 2023; 30(1): 2219864.

21.

Prokopowicz

Szewczyk

Skwira

, et al. Biphasic composite of calcium phosphate-based mesoporous silica as a novel bone drug delivery system. Drug Deliv Transl Res 2020; 10(2): 455–470.

22.

Hoppe

Güldal

Boccaccini

. A review of the biological response to ionic dissolution products from bioactive glasses and glass-ceramics. Biomaterials 2011; 32(11): 2757–2774.

23.

Götz

Tobiasch

Witzleben

, et al. Effects of silicon compounds on biomineralization, osteogenesis, and hard tissue formation. Pharmaceutics 2019; 11(3): 117.

24.

Sutthavas

Tahmasebi Birgani

Habibovic

, et al. Calcium phosphate-coated and strontium-incorporated mesoporous silica nanoparticles can effectively induce osteogenic stem cell differentiation. Adv Healthc Mater 2022; 11(4): 2101588.

25.

Zhang

F-X

Liu

Ding

, et al. Injectable mussel-inspired highly adhesive hydrogel with exosomes for endogenous cell recruitment and cartilage defect regeneration. Biomaterials 2021; 278: 121169.

26.

Dharmalingam

Anandalakshmi

. Fabrication, characterization and drug loading efficiency of citric acid crosslinked NaCMC-HPMC hydrogel films for wound healing drug delivery applications. Int J Biol Macromol 2019; 134: 815–829.

27.

Talaei

Hassanzadeh-Tabrizi

Saffar-Teluri

. Synthesis of mesoporous CuFe₂O₄@SiO₂ core-shell nanocomposite for simultaneous drug release and hyperthermia applications. Ceram Int 2021; 47(21): 30287–30297.

28.

Sánchez-Fernández

Presbítero-Espinosa

Peña-Parás

, et al. Characterization of sodium alginate hydrogels reinforced with nanoparticles of hydroxyapatite for biomedical applications. Polymers (Basel) 2021; 13(17): 2927.

29.

Wei

Yan

Gao

, et al. 3D-printed hydroxyapatite microspheres reinforced PLGA scaffolds for bone regeneration. Biomater Adv 2022; 133: 112618.

30.

Shi

, et al. Formation of hierarchical bone-like apatites on silk microfiber templates via biomineralization. RSC Adv 2016; 6(80): 76426–76433.

31.

Reizabal

Correia

Costa

, et al. Silk fibroin bending actuators as an approach toward natural polymer based active materials. ACS Appl Mater Interfaces 2019; 11(33): 30197–30206.

32.

Kumar

Behl

Chadha

. Synthesis of physically crosslinked PVA/Chitosan loaded silver nanoparticles hydrogels with tunable mechanical properties and antibacterial effects. Int J Biol Macromol 2020; 149: 1262–1274.

33.

Liu

Mao

Guo

, et al. Polyvinyl alcohol/carboxymethyl chitosan hydrogel loaded with silver nanoparticles exhibited antibacterial and self-healing properties. Int J Biol Macromol 2022; 220: 211–222.

34.

Liu

Guan

, et al. A novel Ag/AgO/carboxymethyl chitosan bacteriostatic hydrogel for drug delivery. Mater Res Express 2020; 7(8): 085403.

35.

Ullah

Sohail

Murtaza

, et al. Natural and synthetic materials based cmch/PVA hydrogels for oxaliplatin delivery: fabrication, characterization, in-vitro and in-vivo safety profiling. Int J Biol Macromol 2019; 122: 538–548.

36.

İsmail

Gökçe Kocabay

. Absorption and adsorption studies of polyacrylamide/sodium alginate hydrogels. Colloid Polym Sci 2021; 299(5): 783–796.

37.

Yue

Wang

, et al. Assembly of polyacrylamide-sodium alginate-based organic-inorganic hydrogel with mechanical and adsorption properties. Polymers 2019; 11(8): 1239.

38.

Tian

, et al. A flexible and biocompatible bombyx mori silk fibroin/wool keratin composite scaffold with interconnective porous structure. Colloids Surf B Biointerfaces 2021; 208: 112080.

39.

Zhang

Wang

, et al. Mechanically enhanced composite hydrogel scaffold for in situ bone repairs. Biomater Adv 2022; 134: 112700.

40.

Lian

Sun

Han

, et al. A low-temperature-printed hierarchical porous sponge-like scaffold that promotes cell-material interaction and modulates paracrine activity of MSCs for vascularized bone regeneration. Biomaterials 2021; 274: 120841.

41.

Hassani

Khoshfetrat

Rahbarghazi

, et al. Collagen and nano-hydroxyapatite interactions in alginate-based microcapsule provide an appropriate osteogenic microenvironment for modular bone tissue formation. Carbohydr Polym 2022; 277: 118807.

42.

Xue

Wang

, et al. Fabrication of physical and chemical crosslinked hydrogels for bone tissue engineering. Bioact Mater 2022; 12: 327–339.

43.

Zhang

. Preparation, structure, and properties of polystyrene-microsphere-reinforced PEG-based hydrogels. Polymers 2021; 13(16): 2605.

44.

Nemati Mahand

Jahanmardi

Kruppke

, et al. Sciatic nerve injury regeneration in adult male rats using gelatin methacrylate (GelMA)/poly(2-ethy-2-oxazoline) (PEtOx) hydrogel containing 4-aminopyridine (4-AP). J Biomed Mater Res A 2023; 111(8): 1243–1252.

45.

Nichol

Koshy

Bae

, et al. Cell-laden microengineered gelatin methacrylate hydrogels. Biomaterials 2010; 31(21): 5536–5544.

46.

Zhang

. Anti-bio adhesive behavior and mechanism of polystyrene microspheres enhanced PEG-based hydrogels. J Polym Environ 2023; 31(8): 3551–3564.

47.

Liu

Wang

Peng

, et al. Highly stretchable, strain-sensitive, and antifreezing macromolecular microsphere composite starch-based hydrogel. Macromol Mater Eng 2021; 306(9): 2100198.

48.

Chen

Wang

Lai

, et al. Structure and properties of gelatin methacryloyl (GelMA) synthesized in different reaction systems. Biomacromolecules 2023; 24(6): 2928–2941.

49.

Johari

Madaah Hosseini

Samadikuchaksaraei

. Mechanical modeling of silk fibroin/TiO2 and silk fibroin/fluoridated TiO2 nanocomposite scaffolds for bone tissue engineering. Iran Polym J (Engl Ed) 2020; 29(3): 219–224.

50.

Motasadizadeh

Tavakoli

Damoogh

, et al. Dual drug delivery system of teicoplanin and phenamil based on pH-sensitive silk fibroin/sodium alginate hydrogel scaffold for treating chronic bone infection. Biomater Adv 2022; 139: 213032.

51.

Huang

Wang

, et al. BMSCs-laden gelatin/sodium alginate/carboxymethyl chitosan hydrogel for 3D bioprinting. RSC Adv 2016; 6(110): 108423–108430.

52.

Tibbitt

Anseth

. Hydrogels as extracellular matrix mimics for 3D cell culture. Biotechnol Bioeng 2009; 103(4): 655–663.

53.

Xing

Sun

Tan

, et al. Covalently polysaccharide-based alginate/chitosan hydrogel embedded alginate microspheres for BSA encapsulation and soft tissue engineering. Int J Biol Macromol 2019; 127: 340–348.

54.

Chen

Fan

Tan

, et al. Magnetic and self-healing chitosan-alginate hydrogel encapsulated gelatin microspheres via covalent cross-linking for drug delivery. Mater Sci Eng C Mater Biol Appl 2019; 101: 619–629.

55.

Chahal

Kumar

Hussian

FSJ

. Development of biomimetic electrospun polymeric biomaterials for bone tissue engineering. A review. J Biomater Sci Polym Ed 2019; 30(14): 1308–1355.

56.

Zhou

Bei

Wei

, et al. Mussel-inspired injectable chitosan hydrogel modified with catechol for cell adhesion and cartilage defect repair. J Mater Chem B 2022; 10(7): 1019–1030.

57.

Chen

Liu

, et al. The effect of LyPRP/collagen composite hydrogel on osteogenic differentiation of rBMSCs. Regen Biomater 2021; 8(1): rbaa053.

58.

Dong

Xiong

, et al. Facile extrusion 3D printing of gelatine methacrylate/Laponite nanocomposite hydrogel with high concentration nanoclay for bone tissue regeneration. Int J Biol Macromol 2021; 188: 72–81.

59.

Song

Chen

, et al. Kaolin-loaded carboxymethyl chitosan/sodium alginate composite sponges for rapid hemostasis. Int J Biol Macromol 2023; 233: 123532.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.14 MB