Evaluation effect of alginate hydrogel containing losartan on wound healing and gene expression

Abstract

Skin tissue engineering has become an increasingly popular alternative to conventional treatments for skin injuries. Hydrogels, owing to their advantages have become the ideal option for wound dressing, and they are extensively employed in a mixture of different drugs to accelerate wound healing. Sodium alginate is a readily available natural polymer with advantages such as bio-compatibility and a non-toxicological nature that is commonly used in hydrogel form for medical applications such as wound repair and drug delivery in skin regenerative medicine. Losartan is a medicine called angiotensin receptor blocker (ARB) that can prevent fibrosis by inhibiting AT₁R (angiotensin II type 1 receptor). In this research, for the first time, three-dimensional scaffolds based on cross-linked alginate hydrogel with CaCl₂ containing different concentrations of losartan for slow drug release and exudate absorption were prepared and characterized as wound dressing. Alginate hydrogel was mixed with 10, 1, 0.1, and 0.01 mg/mL of losartan, and their properties such as morphology, chemical structure, water uptake properties, biodegradability, stability assay, rheology, blood compatibility, and cellular response were evaluated. In addition, the therapeutic efficiency of the developed hydrogels was then assessed in an in vitro wound healing model and with a gene expression. The results revealed that the hydrogel produced was very porous (porosity of 47.37 ± 3.76 µm) with interconnected pores and biodegradable (weight loss percentage of 60.93 ± 4.51% over 14 days). All hydrogel formulations have stability under various conditions. The use of CaCl₂ as a cross-linker led to an increase in the viscosity of alginate hydrogels. An in vitro cell growth study revealed that no cytotoxicity was observed at the suggested dosage of the hydrogel. Increases in Losartan dosage, however, caused hemolysis. In vivo study in adult male rats with a full-thickness model showed greater than 80% improvement of the primary wound region after 2 weeks of treatment with alginate hydrogel containing 0.1 mg/mL Losartan. RT-PCR and immunohistochemistry analysis showed a decrease in expression level of TGF-β₁ and VEGF in treatment groups. Histological analysis demonstrated that the alginate hydrogel containing Losartan can be effective in wound repair by decreasing the size of the scar and tissue remodeling, as evidenced by future in vivo studies.

Keywords

Alginate losartan skin wound dressing and VEGF

Introduction

Damage to the skin’s integrity, resulting from a variety of causes, including trauma, surgery, diabete, and burns, is identified as an injury.^1,2 Traditional wound dressings like gauze and cotton wool account for a large portion of the wound dressing market, yet there has been a considerable increase in the application of more advanced dressings like hydro fibers, hydrogels, foams, and super absorbents which provide wounds with the moist environment.^3–5

Hydrogels, owing to their copious advantageous characteristics, have become the ideal option for wound healing practices, and are extensively employed.^6,7 Hydrogel is a 3D construct composed of hydrophilic polymers, enabling them to retain significant amounts of water and possess a soft texture similar to tissue. These properties make hydrogel an appropriate choice for medical purposes.⁸ Certainly, topical drug delivery is an effective process of providing drugs for injuries, with negligible side effects. Therefore, hydrogels are the ideal material for wound dressings considering their many advantages.⁹

Sodium Alginate is an anionic linear polysaccharide derived from algae or bacteria and consists of repeating units of β-1, 4-linked D-mannuronic acid (M), and L-guluronic acid (G) in a variety of ratios.¹⁰ Alginate is an approved material by the U.S. FDA, and has been generally implemented in biomedical and engineering areas owing to its advantageous properties.¹¹ The promising characteristics of alginate as an appealing wound dressing are hydrophilicity, remarkable biocompatibility, and significant liquid-retaining ability.¹² Additionally, the permeability of alginate hydrogel due to its porous structure makes a suitable environment for entrapping/ immobilizing therapeutic elements (drugs, growth factors, etc.) to be released at the injury site.^13,14 But alginate alone has low mechanical stability, which makes its use as a wound dressing difficult without improving the mechanical properties because it can lead to rapid and uncontrolled release of the drug in contact with liquids due to the biodegradable nature of this polymer.¹⁵

The usual method for forming hydrogels is the chemical and physical cross-linking of alginates, and their physicochemical properties mostly depend on the type of structure, molecular weight, and composition of alginate (G Block, M block, and their ratio).¹⁶ Per previous investigations,¹⁷ reducing the crosslinking ion radius leads to a systematic reduction in the polymer chain order. They ordered gels to be anchored to relatively large alkali metal cations (Ba²⁺, Sr²⁺, or Ca²⁺) and crosslinked alginate chains with divalent transition metal (Zn²⁺) ions as well as trivalent metal (Al³⁺), but binding to zinc and aluminum is associated with a significant amount of disorder. On the other hand, it is important to note that the disorder in alginate chains is caused only by M residues in contrast, all guluronic acid (G) residue remains are found in structurally well-defined gels. Hence, the crucial role of units in gel strength was illustrated. A A study on the synergistic effect of divalent cations on network alginate showed that 4:1 Ca²⁺/Zn²⁺ is due to electrostatic interactions that act as a “symbol” with the guluronic groups of calcium alginate and the ability of Zn²⁺ to alginate uses guluronic and mannuronic groups to form covalent bonds with carboxylate groups.¹⁸ In another study, Martina Urbanova and colleagues determined the structure, dynamics, and functional properties of double-linked alginate-pectin hybrid gels using Ca²⁺ and Zn²⁺ ions, proposing that the plasticizing effect can be controlled by the amount of pectin macromolecules whose interaction with alginate chains strengthens the polysaccharide network. Alginate-pectin composite gels made from external ionic gel are shown to have a domain-like structure. The efficacy of synthesized systems on living organisms was demonstrated by in vivo biological experiments.¹⁹

Alginate’s functional groups, such as -COOH or -OH, can create covalent hydrogels through its use.²⁰ The cross-linking process allows the alginate hydrogel to be obtained in a wide variety of shapes. Also due to its stability within the network, it was formed under different biological conditions, including the use of wound dressings, as part of their performance, degradation in a controlled way, improvement of the mechanical properties of the frame is considered.²¹ The use of calcium chloride (CaCl₂) for the cross-linking of sodium alginate is a reliable method for improving the mechanical strength of the prepared scaffold. The calcium ions are placed inside the egg box as eggs, forming an egg structure together with the G block after a cross-link reaction of sodium alginate and CaCl₂ has occurred. The synergistic effect is stronger when the molecular chains of sodium alginate are combined more tightly.²² Sodium alginate sodium ions are replaced by calcium ions in this experiment. Since each calcium ion is capable of bonding to two carboxylate groups, the ions can crosslink the polymer chains, the outcome is a gel-like substance.²³ In this study, the importance of using calcium for cross-linking alginate is underscored, considering its role in wound healing. Calcium is particularly important because it is involved in the activation of important downstream molecules that are important for membrane closure and repair during the injury response. For example, Annexins (Anxs), which are calcium-dependent molecules, are rapidly absorbed into damaged cell membranes to aid in the healing process.²⁴

Activation of AT₁R prompts the TGF-β/Smad pathway to be set into motion, this subsequently triggers the recruitment of inflammatory cells, including monocytes, and activation and proliferation of local fibroblasts, besides extracellular matrix proteins such as collagen and fibronectin.²⁵ Anti-inflammatory and anti-fibrotic effects are likely associated with angiotensin receptor antagonists, which target the tissue renin-angiotensin system (tRAS). The heart, lungs, kidneys, liver, and all other organs and tissues in the body contain an intrinsic tRAS that can be found within the skin.²⁶ Studies have shown that after injury, AT₁ receptors are increased in activation.²⁵ So promising therapeutic approach to inhibit tissue fibrosis is the manipulation of the TGF-β via the AT₁ blockade.

Losartan is an orally active and nano peptide drug that is also an antagonist of the selective angiotensin subtype 1 (AT₁) receptor. Its inhibitory effects on angiotensin II are more precise and complete than renin or Angiotensin-Converting Enzyme (ACE) inhibitors leading to an equivalent increase in renin and angiotensin I levels.²⁷ It is more than 10,000 times more specific for the AT₁ receptor than its AT₂ counterpart and has a strong binding affinity with it.²⁸

Johanneke J. et al suggested the first day after burn treatment, atorvastatin, losartan, or their combination was administered orally for 28 days. Losartan therapy and to some extent combination therapy resulted in increased wound contraction and poorer of scarring.²⁹ Wan-Yi Zhao et al. developed a triamcinolone-like cream for scar prevention, known as losartan cream. The ointment is composed of Asiaticoside, Chitosan, and losartan and tested using in mouse model. The TGF-/Smad pathway was found to be involved in the prevention of scarring in losartan cream, according to their study.³⁰ In another study Keshvad Hedayatyanfard et al evaluated losartan ointment on hypertrophic scars and keloid. A test was performed on losartan cream to determine its sensitivity, allergy, and hypotensive effect. Their team monitored the effectiveness and side effects of patients who used the creams twice a day for 3 months. Losartan potassium cream (5%) was found to be effective in treating keloid and hypertrophic scars without any allergy effects, according to their findings.³¹

The increased levels of TGF-β₁ induce myofibroblast migration, which contributes to fibrosis.²⁹ Based on the presence of angiotensin II and AT₁R in the skin and the effectiveness of AT₁R blockers to inhibit tissue fibrosis, Losartan, a reversible AT₁R inhibitor, was hypothesized to be effective in reducing skin fibrosis. According to past studies and the lack of similar knowledge in using alginate hydrogel as a substrate and carrier for the controlled release of losartan in the treatment of skin wounds and investigating the various characteristics of the designed dressing, including mechanical, biological, hematological and histological characteristics. For the first time in this study, we expect to reach a more realistic insight regarding the effectiveness of losartan in the wound healing process by characterizing this dressing.

Method & material

Materials

Sodium alginate ((C₆H₇NaO₆)n), medium molecular weight (216.121 g/mol) purchased from Sigma-Aldrich (St Louis, USA), pure Losartan (C₂₂H₂₃ClN₆O) manufactured by Dana Pharmaceuticals, penicillin, streptomycin, phosphate-buffered saline (PBS), and calcium chloride (CaCl₂) were procured from Sigma-Aldrich (St Louis, USA). 3-(4, 5- dimethylthiazol-2-yl)-2, 5 diphenyl tetrazolium bromide (MTT), Dulbecco’s modified Eagle’s medium: nutrient mixture F-12 (DMEM/F12) and fetal bovine serum (FBS) were obtained from Gibco, BRL (Eggenstein, Germany). Vascular endothelial growth factor (VEGF) and Transforming Growth Factor-β (TGF-β₁) antibodies were purchased from Sama Tashkhis (Tehran, Iran).

Hydrogel fabrication

The Alginate/Losartan (Alg/Los) hydrogel was prepared by dissolving alginate polymer (1.5% w/v) in deionized H₂O for 12 h on a stirrer (400 rpm) and then adding various concentrations of Losartan (10, 1, 0.1, 0.01 mg/mL). Subsequently, to cross-link the hydrogel in a glass beaker, 75 mM calcium chloride solution (CaCl₂) was added drop by drop (50 µl CaCl₂ per ml hydrogel) and stirred for 1 hour at 400 rpm. The homogeneous solution was stored at 4°C and refrigerated overnight. Finally, we added phenoxyethanol to 0.9 v/v% of the final volume of the prepared hydrogel to increase its stability.

Lyophilization

After synthesis, the hydrogels were stored in a glass beaker for 16 h at −80°C and then transferred to a freeze dryer (Terrace, Spain) at −54°C for 2 days to form a porous structure.³²

Hydrogel characterization

Morphological properties

After being freeze-dried, the samples were cut into 7 mm diameters and gold was applied using a sputter coater for 250s (SCD 004, Balzers, Germany) and their structure was evaluated by scanning electron microscopy (SEM; DSM 960A, Zeiss, Germany). The average diameter of pores was evaluated by Image J software (National Institutes of Health, Bethesda, USA), Origin Pro 2015 software (Origin Lab., Northampton, USA), and scanning through 20 random points in each image.

Fourier transforms infrared spectroscopy (FTIR)

The chemical structures of the pure Losartan, lyophilized hydrogel with (Alg/Los 10 mg/mL) and without Losartan were analyzed using FTIR Spectroscopy by the potassium bromide (KBr) pellet method. The KBr was mixed with about 10 mg of the samples, which had a similar weight. Using a mixer and pestle, the mixture has been sufficiently grinded. By compressing the mixture under a hydraulic pressure of 600 dyn/m², the pellets were formed. The transparent particles formed in this manner are scanned. The Bruker Aquinox 55 instrument (Germany) was employed to measure FTIR spectroscopy in the 4000-400 cm⁻¹ range.³³

¹H NMR

The ¹HNMR analyzer (Bruker spectrometer) was used to measure the protons nuclear magnetic resonance (¹H NMR) spectrum of the polymers and hydrogels at room temperature, operating at 400 MHz. Tetramethylsilane (TMS) was utilized as an internal standard for the samples that were weighed and dissolved in deutrateum water (D₂O), with approximately 5 mg/mL of samples.³⁴

Swelling studies

When assessing biodegradable materials for drug delivery purposes, it has been widely accepted that swelling characteristics must be taken into account.²³ The lyophilized hydrogel was weighed and then 5 mg of freeze-dried hydrogels were immersed in 10 mL PBS at room temperature for 3 days (2h, 4h, 6h, 24h, 48h, and 72h) at 37°C. Samples were periodically removed from PBS and quickly weighed, and the amount was calculated.

Equation (1)³⁵:

Equilibrium mass swelling = (m_{1} - m_{0}) / m_{0} \times 100

(1)

M₀ is the dried mass and m₁ is swollen mass.

Weight loss analysis

The degradation rate was determined by measuring hydrogels mass loss. Three lyophilized hydrogel per group were weighed and then kept in PBS at 37°C. After 24h, 72h, and 7, and 14 days, the samples were removed from PBS and kept in a 50°C incubator until the PBS completely evaporated and the scaffolds dried. The degree of weight loss was analyzed by equation (2), where W₀ is the initial weight of scaffolds and W₁ is the dry weight post-removal from water.³⁶

Weight loss % = (W_{1} - W_{0}) / W_{0} \times 100

(2)

Release of losartan

Was utilized to analyze the release of Losartan from the Alg/Los hydrogel. Calculation of the amount of drug released from the hydrogel needs to draw a standard plot of losartan, and for this, use 20 values (0.001 to 10 mg/mL SBF). In the following, Alg/Los hydrogels (1 mL) were placed in simulation body fluid (SBF, 5 mL) in a shaker incubator at a room temperature with a rotational speed of 45 rpm. To evaluate the released Losartan, the absorption intensity of the supernatants was observed at 205 nm with UV-visible spectroscopy at different time (2h, 4h, 6h, 24h, 48h, and 72h) intervals.³⁷ Finally, convert the results obtained from spectroscopy into quantitative values by analyzing the standard plot of losartan.

Hemolysis

In this experiment, a 2 mL solution of fresh anticoagulated human blood was prepared with 2.5 mL sodium chloride 0.9%. 200 μL of diluted fresh anticoagulated blood was mixed with 100 μL of hydrogel, and room-temperature incubation for 60 min was followed by a 10-min centrifuge operation at 1500 rpm. Transferring the extracted supernatants onto a 96-well plate resulted in an absorbance of 545 nm (Dt). Deionized H₂O served as negative control (Dnc) and 0.2 mL of diluted blood in 10 mL solutions of normal saline was considered as a positive control (Dpc). Determined by equation (3), the degree of hemolysis was determined³⁸:

Hemolysis % = (D_{t} - D_{nc}) / (D_{pc} - D_{nc}) \times 100

(3)

Blood clotting index (BCI)

As in previous reports, the blood clotting index has been used to assess the coagulation properties of the composite hydrogel. The lower value of the BCI indicated a higher coagulation effect. To be used as an anticoagulant, human fresh blood was collected from evacuated blood tubes containing sodium citrate and kept at 4°C. The hydrogel (0.5 mL) was placed at the end of a glass beaker in a thermostatic water bath at 37°C, and 100 microliters of anticoagulated human blood and 20 μL of 0.2 mol/L CaCl₂ solution were added and incubated for 5 min, and then 25 mL of distilled water was slowly added. A well-shaken sample was performed at 37°C, and absorbances were determined at 545 nm. In the control group, there were no hydrogels, and the anticoagulated blood was taken as 100 after contact with distilled water and its absorbance measurement.³⁹ The BCI of samples can be calculated using equation (4):

Blood clotting index (%) = A_{sample} / A_{control} \times 100 %

(4)

Cell viability study

The MTT assay was employed to evaluate the biocompatibility of prepared hydrogel. For this purpose, a 3T3 murine fibroblast cell line at a density of 1 $\times$ 10⁴ cells/hydrogel was cultured in prepared media (DMEM/F12, 10 % FBS, 100 unit/ml penicillin, and 100 μg/mL streptomycin) in cell culture incubator. 1-, 2-, and 3-days post-cell seeding, the culture medium was substituted with 150 μL of MTT (0.5 mg/mL) and after 3 h, it was substituted with 0.1 mL DMSO. After 20 min gentle and slow shaking of the cell suspension containing DMSO in the absorbance at wavelengths 570 and 690 nm (DMSO background wavelength) was measured in the dark condition by using a microplate reader. The control was comprised of cells cultured on a tissue culture plate (TCP) and all experiments were conducted in triplicate.⁴⁰ The IC₅₀ value for % cell viability refers to the concentration of pure Losartan that is required to bring this curve to a point halfway between maximum and minimum plateaus, based on nonlinear regression analysis, the percent cell viability and log concentration dose-response curve was computed using GraphPad Prism 9.

Wound scratch assay

This experiment was performed by a previously established and standardized protocol.⁴¹ In summary, 3T3 cells were seeded in 24-well plates at a concentration of 10⁴ cells/mL and cultured with prepared media until a confluent monolayer was formed. The media were then aspirated and discarded, while a 200 μL pipette tip was used to scratch a small area. Subsequently, the cells were rinsed with PBS to remove any detached debris. Serial dilutions of Alg/Los extract (100 µl of hydrogel with 900 µl of complete culture medium containing FBS and DMEM in shaker incubator at 37°C for 24 h) in fibroblast media were added to the wells and microscopic examinations of the scratched area at 0, 24, 48, and 72 hours revealed that the 3T3 cells migrated to fill the scratched area. Digital images of this migration process were taken using a microscope connected to a computer system, and the area of the scratched area and the rate of cell migration was calculated using Image J software (National Institutes of Health, Bethesda, USA).

Rheological studies

Viscosity measurements were performed in this study for hydrogels before and after cross-linking with CaCl₂ using a cone and plate viscometer with a spindle 7 (Lamy Rheology, France). By connecting to a water bath, and regulating it through the use of rotary controls, the device was maintained at 25°C. At different shear rates, the viscosity of the samples was measured. In 60 s, the shear rate was increased from 1-30 s⁻¹ to 1-200 s⁻¹. The determination of viscosity was made using the flow curve obtained at different shear rates. The samples in this study were subjected to a constant stress of 100 Pa. All measurements were made in a triplicate procedure.

Stability studies

Hydrogels (Alginate, Alg/Los 0.1, Alg/Los 1, and Alg/Los 10 mg/mL) were kept at cold (4 ± 2°C), room (27 ± 2°C), and hot (40 ± 2°C) temperatures for 60 days to test the stability. Finally the appearance feature and pH of samples were evaluated at every temperature.⁴²

Antibacterial assay

In some studies, they evaluated antibacterial activity against Staphylococcus aureus and Pseudomonas aeruginosa using the hydrogel-based antimicrobial solution.^38,43,44 The hydrogels were used to alter a bacterial solution that contained 1 × 10⁷ CFU/ml of bacteria at concentrations that were half of the minimum inhibitory concentrations (MIC). The suspension was then incubated for 24 h at room temperature in a shaking water bath. 100 μL Alginate, and Alg/Los (0.01, 0.1, 1, and 10 mg/mL) hydrogels were administered to 5x MIC bacteria, and sterile water was added to bacterial broth as a control. 10 μL of the resulting mixture was serially diluted and plated on agar plates after incubation. In duplicate tests, the number of viable colonies following 37°C aerobic incubation for 1, 2, 4, and 6 h was counted. To prevent interference in the obtained results, the hydrogels synthesized for this experiment did not contain phenoxyethanol.

In vivo wound healing study

To assess the efficacy of hydrogels containing Losartan 0.1 mg/mL for wound healing, a full-thickness excisional wound model was employed on eighteen healthy adult male Wistar rats (200-220 g) of 2 months of age from the Shahroud Medical Institute (Semnan, Iran). These animal experiments were performed following the guidelines of the Shahroud University of Medical Sciences (ethical code: IR.SHMU.REC.1400.059).

Full-thickness are wounds that extend beyond the two layers of skin and go into the subcutaneous tissue or even to the bone and muscle. These are very serious and need a lot of care for proper healing. A mixture of ketamine (100 mg/1 kg body weight) and xylazine (10 mg/1 kg body weight) was injected to induce general anesthesia. A full-thickness wound with dimensions of 1.50 × 1.50 cm² was excised on back skin and then animals were randomly divided into three groups (6 rats per group), with wounds being treated with alginate hydrogel without Losartan, alginate hydrogel with 0.1 mg/mL/ml Losartan (Alg/Los 0.1 mg/mL; the optimum concentration of losartan achieved from MTT assay test), and sterile gauze as the negative control (NC) and then the wounds were covered with an elastic adhesive bandage. A digital camera was used 7- and 14-days post-surgery to evaluate wound closure rate by recording reductions in wound size. In addition, wound closure was measured by an image analyzing program (Digimizer, Ostend, Belgium) and equation (5)⁴⁰:

Wound Closure (%) = (1 - (open wound area / initial wound area)) x 100

(5)

Histopathology study

Rats were ethically sacrificed 2 weeks after treatment and their skin tissues were fixed in 10% neutral buffered formalin (PH 7.26) for 2 days. The samples were obtained from fixed tissue, which was then placed in a paraffin-coated medium and sectioned to 5 m thickness for subsequent stained with hematoxylin and eosin (H&E) and Verhoeff-Van Gieson (VVG). Using light microscopy, an independent reviewer examined histological slides and found that epithelialization, angiogenesis, fibroplasia, and granulation tissue formation between groups could be evaluated independently.

Histomorphometric analysis

Histomorphometric analysis was performed to assess epithelialization and vascularization. In this study, Re-Epithelialization and Blood vessel formation analysis on day 14 was assessed semi-quantitatively on a 5-point scale: 0 (without new epithelialization and neovascularization), 1 (few), 2 (moderate), 3 (many), and 4 (100%). The parameters were found to be consistent by a single independent observer who blinded all treatment groups during the analysis.⁴⁵

Immunohistochemical staining

Standard immunohistochemical staining protocol was followed for immunohistochemical staining as studies reported.⁴⁶ Briefly, 3 µm thick sections of skin were deparaffinized and washed 3 times with diluted water for 5 min. The antigen retrieval was then performed in a microwave oven at room temperature for 30 min before being blocked by 3% serum. Next, the primary TGF-β₁ and VEGF antibody was incubated in the slides. Subsequently, secondary antibodies were used to incubate them at 37°C for 20-30 min. The tissue slices were reacted with 3, 3′-diaminobenzidine (DAB) for 20 min. Staining with hematoxylin for 7 min revealed the cell nucleus of the tissue samples. Immunostaining images were obtained through light microscopy (Olympus CX40, Japan). Two blind observers took a look at it.

RNA extraction

After 7 and 14 days, samples were taken from Wistar rat skin and an RNA extraction kit (Parstous kit, Tous, Mashhad, Iran) was used for skin samples of wounded and unwounded rats for the extraction of total RNA. NanoDrop UV-Vis Spectrophotometer was used to determine the concentration of RNA in OD₂₆₀.

Real-time RT-PCR

The Parstous High Capacity cDNA Synthesis Kit (Tous, Mashhad, Iran) was utilized to reverse transcript the purified RNA (200 ng). Quantitative real-time RT-PCR employing primers from Applied Biosystems and a BioRad Real-Time PCR System (Applied Biosystems, USA) was used to analyze the expression levels of TGF-β₁, VEGF, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNAs. GAPDH served as control. A List of all primers employed is presented in the Table 1 below. The thermal program was managed in 3 steps (Roche LightCycler 96, SYBER green method): denaturation at 95°C (5 min), for amplification and quantification in 45 cycles, of 30 s at 95°C, 30 s at 60°C, and 15s at 72°C. The data were analyzed using Prism 9 software and the differences in gene counts have been determined the 2^-(∆∆ct). GAPDH has been used as a housekeeping gene.

Table 1.

Designated primer for RT-PCR.

Gene	Forward primer	Reverse primer
VEGF	TGCGGATCAAACCTCACCAA	TCTGGCTTTGTTCTATCTTTCTTTG
TGF-β₁	CGTCAGACATTCGGGAAGCA	GTATCAGTGGGGGTCAGCAG
GAPDH	AGTGCCAGCCTCGTCTCATA	TGAACTTGCCGTGGGTAGAG

Statistical analysis

GraphPad Prism9 software and SPSS 20 were used to analyze all data. To compare the groups, one-factor analysis of variance (ANOVA) with Tukey’s post-hoc test. Data were compared using the Kruskal-Wallis H non-parametric ANOVA test and then the Mann-Whitney U test when significant. Data were presented as the mean ± standard deviation (SD). The p-value was taken into account and statistical significance was assigned to the value p < 0.05.

Results

Morphological properties

SEM was utilized to inspect the morphology of Alginate and Alg/Los 0.1 mg/mL (Figure 1). The hydrogels were found to have highly porous structures with pores that were interconnected due to phase separation during lyophilization. The mean size of pure Alginate hydrogel and Alg/Los 10 mg/mL were approximated as 108.29 ± 8.78 and 85.27 ± 6.27 μm, respectively. The porosity of Alginate hydrogel was measured to be 47.37 ± 3.76%. The addition of Losartan to the hydrogel resulted in a decrease in porosity, with the Alg/Los 10 mg/mL sample reaching 41.37 ± 5.01%. The difference was found to be statistically significant (p < 0.05). The image analysis revealed a pore size of 75–135 μm which is favorable for cell adhesion and migration.⁴⁷

Pure losartan FTIR analysis

Figure 2 shows the FTIR spectrum of losartan’s solid phase, taken in the 400-4000 cm⁻¹ range. The spectrums were analyzed based on primary patterns, makeup, and pitch ranges. Quantum chemical methods were used to optimize the molecule’s structure and determine its structural features. Losartan potassium’s FTIR spectrum displayed a wide absorption band at 3169.34 cm⁻¹, along with twin bands at 994.92 and 1007.09 cm⁻¹ related to the tetrazole ring, and a distinct band at 1459.68 cm⁻¹ linked to the imidazole ring. The O-H and C-O stretch bands are observed at 933.71 and 1074.42 cm⁻¹, respectively. There is a band at 2956.49 cm⁻¹ due to N-H stretch, and another one at 1423.04 cm⁻¹ due to C = N stretch. 1258.86 cm⁻¹ is the wavelength of the tertiary amine band (C-N stretch). Previously, comparable results were documented.^48,49

Hydrogels FTIR analysis

FTIR spectra of the compounds that have been synthesized are shown in Figure 3, alginate–Ca²⁺ displaying broadband associated with the –OH stretching at 3410 cm⁻¹, absorption bands assigned to the carbonyl (C = O) asymmetric and symmetric stretching at 1618 and 1425 cm⁻¹, and a C–O–C stretching at 1037 cm⁻¹.^33,50 An analysis of pure losartan potassium demonstrated highly intense absorption peaks at wave numbers of 1256.53 cm⁻¹, 2870.26 cm⁻¹, 3172.30 cm⁻¹, and 762.24 cm⁻¹ which are attributed to cyclic amines, C-H stretches, O-H bending, Chlorine, respectively,⁵¹ and N-H stretch gives a band at 1454 cm⁻¹.²⁹ The interaction between the carbonyl group of alginate and amine in losartan can lead to the establishment of a link between these two compounds. In addition, the peaks related to losartan in Figure 3(B) show the correct incorporation of the drug without changing its main structure.

Determination of the chemical composition by ¹H NMR

The properties of alginate can be significantly affected by its chemical composition, which differs across material batches. Therefore, it is essential to analyze the chemical structure of alginate to comprehend how this polysaccharide behaves during gelation, its interactions with metals and salts, its solubility, degradation patterns, and the release kinetics of drugs. The physical structure (strength and porosity) of alginates is significantly impacted by the gelation process and is influenced by the preference of specific ions for the G units, the M/G ratio, and the quantity of repeated sequential G and M units.^52,53 The chemical composition analysis of the raw Alginate powder enables the quantification of the M/G ratio and the sequence of the blocks along the polymeric chain, both of which impact the properties of the resulting hydrogels.

The sodium alginate sample’s ¹H NMR spectrum is shown in Figure 4 and is comparable to the spectrum of an alginate that is rich in M units.⁵⁴ According to the ASTM Standard F 2259⁵⁵: alpha reducing ends (α); beta reducing ends (β); proton 1 from the guluronic unit (A); proton 5 from the GGM unit (B₁) and MGM unit (B₂); proton 1 from the MG unit (B₃), MM unit (B₄) and GG unit (C). The mannuronic acid anomeric proton (M-1) and the C-5 of the alternate blocks (GM-5) overlapped at 4.66 ppm, the guluronic acid anomeric proton (G-1) at 5.03 ppm, and the guluronic acid H-5 (G-5) at 4.37 ppm were all identifiable.⁵³ The strength of the signal, which indicates the presence of the relevant chemicals, was used to determine the chemical composition of G and M units in the framework of sodium alginate, so it can be seen based on Figure 4 that the alginate used in making the hydrogel dressing is rich in M units (about 55%).

Swelling study

Figure 5(A) Swelling behavior of Alginate and Alg/Los hydrogels. Interaction between Alg/Los chains and water molecules can induce swelling of the polymer, which is limited by cross-linking. This swelling behavior of Alg/Los hydrogel prepared a suitable three-dimensional construct that is the same as the native microenvironment of cells, thereby promoting cell survival, proliferation, and migration. The outcomes indicate that the highest swelling rate of Alginate hydrogel without Losartan was 61.73 ± 1.34% at 72 h post-incubation, which is probably due to the increase in the strength of the scaffold as a result of the connection between the chemical groups of losartan and alginate. Previous studies have established that swelling rate plays an essential role in providing long-term drug delivery at the site of wound healing.⁵¹

Weight loss analysis

The rate of wound dressing degradation needs to be commensurate with the rate of wound healing; a slower rate can impede the substitution of the wound dressing with formed tissue, while a faster one can result in an incomplete recovery process. The weight loss results of the prepared hydrogels are described in Figure 5(B). It can be deduced that Alg/Los 0.1 mg/mL yielded a weight loss of approximately 60.93 ± 4.51% after 2 weeks and with an increasing dose of losartan, the biodegradability decreases slightly.

Release of losartan

The cumulative release profile of Losartan, with different doses, is depicted in Figure 5(C). The release of Losartan from Alg/Los 10 mg/mL was 290 µg and 315 µg after the first 2 and 6 h, respectively, and then a sustained release of 836 µg over 3 days. The results a show slow release of losartan at all concentrations from alginate hydrogel.

Blood compatibility results

It is essential for successful wound healing that the prepared wound dressing is compatible with blood cells, particularly erythrocytes.³⁶ The interaction between the implanted wound dressing and erythrocytes is a primary event that triggers inflammatory responses. To assess compatibility, alginate with and without Losartan (0, 0.01, 0.1, 1, 10 mg/mL/ml) was tested with erythrocytes. The results from Figure 6(A) demonstrates that hemolysis induced by different prepared groups is notably lower than the positive control, which suggests that the prepared hydrogels are hemocompatible. However, an increase in the dosage of Losartan leads to a rise in hemolysis.

BCI results

Platelet aggregation and blood clotting are integral components of the hemostasis process.³⁷ The blood clotting assay is an effective method to measure the antithrombotic properties of biomaterials. Generally, a higher BCI suggests a slower clotting rate, and therefore, improved compatibility with blood.³⁸ Figure 6(B) demonstrates the consequence of Losartan concentration on the BCI of hydrogel fibers when exposed to ACD blood for 5 min. The BCI measurements were 47.34%, 47.21%, 43.65 %, 49.6%, and 56.21% for the Alginate, Alg/Los 0.01 mg/mL, Alg/Los 0.1 mg/mL, Alg/Los 1 mg/mL and Alg/Los 10 mg/mL samples respectively, implying that Losartan at concentrations of 10 mg/mL can significantly improve the hemocompatibility of hydrogels. So according to the results, the blood compatibility of Alg/Los 0.1 mg/mL is more excellent than that of other groups.

Cell viability results

The cytotoxic effects of the hydrogels prepared for analysis by the MTT assay are presented in Figure 6(C). These results show the hydrogels they produce are both biocompatible and promote cell proliferation. The alginate hydrogel was not significantly different from the control at 24 h; however, after 72 h of cell seeding, it was notably higher than the control. Additionally, with an increasing concentration of Losartan, cell proliferation decreased. This suggests that including Losartan in Alginate hydrogel can affect cellular viability depending on its concentration. The IC₅₀ values of pure Losartan were calculated for treatment with 3T3 fibroblasts (Figure 6(D)). The IC₅₀ value is 6.366 mg after 72 h of treatment.

Wound scratch assay

The scratch assay is a commonly used in vitro technique for studying cell migration.³⁹ An experiment (0-72 h) was conducted to evaluate the effectiveness of hydrogels in facilitating the migration of 3T3 fibroblasts, as illustrated in Figure 7. Fibroblast wound healing was noticeably improved with the application of Alginate and Alg/Los hydrogels in concentrations of 0, 0.01, 0.1, 1, and 10 mg/mL. A critical element in the wound-healing process is the native cells’ migration from the periphery of the wounds.⁵⁶ Recent studies have demonstrated that an increased dose of losartan in alginate hydrogel can influence the contraction and migration of fibroblasts. A 10 mg dose of Alg/Los was found to result in dead cells while a 1 mg dose was associated with reduced migration. The Alg/Los 0.1 mg/mL led to increased migration and wound closure which indicates fibroblast migration within the wound area is essential for the replacement of inflammatory cells with collagen and native tissue during the inflammatory process. Consequently, these findings suggest that varying concentrations of losartan in alginate hydrogel can affect cell migration (improving wound closure to causing death).

Rheological results

The viscosity of Alginate hydrogel and Alg/Los 10 mg/mL prepared hydrogel before and after crosslinking with CaCl₂ was calculated (Figure 8). The high viscosity of the alginate hydrogel before and after crosslinking was 58,930 mPas and 64,350, the viscosity of the Alg/Los 10 mg/mL was 60,674 mPa.s and 66,389. According to these findings, the viscosity of alginate hydrogel can be slightly increased with the proportion of losartan, which is probably due to the establishment of a bond between alginate and losartan. The interaction between alginate and CaCl₂ is a possible outcome, potentially increasing hydrogel structure stability.

Stability results

The hydrogel formulations were subjected to a stability test lasting 60 days at different temperatures, including cold, room, and hot, to ensure their continued properties after production and compliance with the parameters for storage.⁴² The stability test is designed to ensure that the sample is stored under conditions that allow for rapid changes under normal conditions, resulting in the identification of the most suitable hydrogel composition. All hydrogel formulations exhibit uniform color and consistency at different test temperatures for 60 days, based on the results. Furthermore, these formulations have pH values that still meet the requirements for hydrogel formulation as presented in Table 2.

Table 2.

Stability assay of alginate hydrogel with Losartan after 60 days.

Condition		pH test temperatures				pH test temperatures				pH test temperatures
Condition		4 ± 2 °C				27 ± 2 °C				40 ± 2 °C
Observation days	Hydrogel formulations	Color	Homogeneity	Form	Consistency	Color	Homogeneity	Form	Consistency	Color	Homogeneity	Form	Consistency
1	Alginate	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 0.1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 10	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc
7	Alginate	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 0.1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 10	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc
15	Alginate	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 0.1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 10	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc
30	Alginate	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 0.1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 1	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc	beige	Hmgs	SS	Exc
	Alg/Los 10	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc	cream	Hmgs	SS	Exc

Condition		pH test temperatures	pH test temperatures	pH test temperatures
Observation days	Hydrogel formulations	4 ± 2 °C	27 ± 2 °C	40 ± 2 °C
1	Alginate	6.61	6.52	6.44
	Alg/Los 0.1	6.66	6.62	6.41
	Alg/Los 1	6.24	6.15	6.13
	Alg/Los 10	5.24	5.11	5.03
7	Alginate	6.55	6.49	6.48
	Alg/Los 0.1	6.61	6.53	6.45
	Alg/Los 1	6.12	6.15	6.12
	Alg/Los 10	5.18	5.12	5.12
15	Alginate	6.45	6.44	6.40
	Alg/Los 0.1	6.48	6.45	6.44
	Alg/Los 1	6.12	6.09	6.1
	Alg/Los 10	5.14	5.14	5.12
30	Alginate	6.46	6.47	6.46
	Alg/Los 0.1	6.45	6.43	6.46
	Alg/Los 1	6.11	6.06	6.07
	Alg/Los 10	5.07	5.06	5.07
45	Alginate	6.46	6.43	6.41
	Alg/Los 0.1	6.47	6.43	6.4
	Alg/Los 1	6.11	6.07	6.08
	Alg/Los 10	5.01	5.02	5.01
60	Alginate	6.45	6.43	6.43
	Alg/Los 0.1	6.43	6.41	6.42
	Alg/Los 1	6.14	6.09	6.1
	Alg/Los 10	5.03	5.04	5.02

Hmgs: homogeneous. SS: semisolid. Exc: excellent.

Antibacterial assay analysis

The results of the antibacterial growth test are illustrated in Figure 9, testing the effectiveness of the Alg/Los hydrogel group against the non-treatment group by showing a decrease in colony count. However, incorporating Losartan into the wound dressing did not decrease the number of colonies. This indicates that the addition of Losartan did not have antibacterial effects.

In vivo wound healing study

Figure 8 illustrates the healing impact of an Alginate hydrogel lonely and Alg/Los 0.1 mg/mL which are the optimal concentrations of Losartan through in vitro testing. Sterile gauze was used to treat wounds, as seen, in alginate hydrogel, and Alg/Los 0.1 mg/mL in Figure 10(A). The image demonstrates that the group treated with Losartan showed better results compared to the NC and Alginate hydrogel-treated group. The highest performance was observed in the Alg/Los 0.1 mg/mL group. The image reveals that there were no signs of infection or inflammation, representing a successful healing process. The wound closure rate was evaluated through a calculation (Figure 10(B)). The wound closure rate of the sterile gauze after one- and 2 weeks post-surgery was 27 ± 3.66% and 62.1 ± 4.6%, respectively. Meanwhile, the wound closure rate of the Alginate hydrogel group after the mentioned time points was 41 ± 2.38% and 79.8 ± 3.5%, respectively. Incorporating Losartan into the formulated hydrogel increased the wound closure rate significantly to 49 ± 4.2% and 81 ± 6.87% after 7- and 14-days post-injury, respectively (p < 0.001).

Histopathological results

H&E histopathological findings of all groups are illustrated in Figure 11(A-L).

In 7^th day negative control, Alg, and Alg/Los treated groups, the wound was covered with a layer of crusty scab (Figure 11. E, G, K, L- yellow thin arrow). Alg and Alg/Los treated group showed the initiation of epidermal proliferation and re-epithelialization (Figure 11. H, K – red star). Blood vessel formation in animals treated with the Alg/Los group was higher than the negative control and Alg groups (Figure 11. I, L-red thin arrow).

VVG study findings of all groups are illustrated in Figure 12 A-L. According to the finding, the elastin fibers (black thin arrow) formation in the Alg/Los group was higher than the other treated groups. The mature collagen formation in the Alg/los group was higher than the other treated groups which was illustrated in Figure 11 20 L with a red arrowhead.

On the 14^th day H&E study findings of all groups are illustrated in Figure 11 A′-L'. The regeneration of wounds in Alg/Los treated animals was better than those of Alg and negative control (NC) groups, complete growth and reorganization of the epidermis occurred (Figure 11. L′- red star). In animals treated with the alginate group, blood vessel formation was significantly greater than in the Alg/Los groups (Figure 11. I' -red thin arrow). Animals treated with Alg/Los more closely resembled normal skin tissue (positive control) and hair follicles were rejuvenated compared to other groups, sebaceous glands, and typical epidermis (Figure 11- L′, K′ red and black thick arrow). Also, the rate of synthesis of collagen fibers, collagen deposition and collagen maturation were maximum in Alg/Los groups (Figure 11- L′, K′ red arrowhead).

The histological findings in the 14^th day of VVG during the experimental groups, and stained sections demonstrated that the Alg/Los group had the greatest elastin fiber synthesis, maturation, and arrangement (Figure 12 – L′ black thin arrow).

Histomorphometric analysis

The histomorphometric evaluation of the experimental groups is shown in Figure 13. The Alg and Alg/Los groups exhibit the most potent re-epithelialization. The blood vessels of animals treated with Alg were significantly larger than those of Alg/Los groups. Among the experimental groups, the best results for regeneration were observed in the Alg/Los group.

Immunohistochemistry

TGF-β₁ is a potential therapeutic target for hypertrophic scars and keloids, which has been shown to induce differentiation of myofibroblasts. In IHC staining of TGF-β₁ (Figure 14), dark and brown shades were present on the positive cells. We found the large number of cells and areas in the negative control group and alginate hydrogel are more intensely stained, which indicates more gene expression in these treatment groups 7 days after treatment (Figure 14(A) and (C), thin black arrow). According to Figure 14(E) and (F), the treatment group containing losartan showed TGF-β₁ reduction at 7 and 14 days. After 14 days of treatment, TGF-β₁ showed a decrease in all 3 treatment groups.

Angiogenesis, in particular granulation tissue formation, is important for healing wounds and provides supplementary sources of nutrition and oxygen to the site. In this experiment for wound tissue 14 days after injury, we performed Immunohistochemistry on VEGF to detect an angiogenic response (Figure 14). Angiogenesis on the 7^th day after treatment in all 3 treatment groups is not similar. The expression level of VEGF in the group containing losartan was low after 14 days of treatment because, despite the presence of colored areas in this group, mature vessels and capillaries are not clearly visible (Figure 14, f, thin yellow arrow). The level of VEGF in capillary endothelial cells in the negative control and alginate hydrogel was higher and led to the creation of mature vascular structures in the alginate group, but in the negative control group, capillaries are mainly seen (Figure 14(a), (b), and (d), thin yellow arrow).

Real-time RT-PCR

Real-time PCR analysis revealed a gene expression profile that was in line with the protein expression pattern. A real-time RT-PCR assay revealed that the TGF-β₁ mRNA levels were scar tissue had been significantly diminished of in the Alg/Los 0.1 mg/mL group when compared to the control groups (Figure 15(A)), and the VEGF mRNA levels were upregulated in Alginate hydrogel and reduced in Alg/Los 0.1 mg/mL treated groups (Figure 15(B)).

Discussion

Wound care specialists are increasingly facing the challenge of facilitating the healing of wounds, necessitating specialized therapeutic approaches to expedite the healing of damaged dermal tissues.^43,57 Alginate is an attractive material for wound dressing due to its hydrophilicity, excellent biocompatibility, and large liquid-absorbing capacity.¹² Alginate hydrogel has been widely used in wound healing due to its hemostatic ability.⁴³ Additionally, it has been determined to be a favorable environment for cell proliferation.⁵⁸ Studies indicate a strong correlation between AT₁R and tissue fibrosis. When AT₁R was removed from fibroblasts, the Ang II-mediated fibrosis was attenuated, as shown by a decrease in medial hyperplasia of the ascending aorta.⁵⁹ Losartan exhibits a high affinity and specificity for AT₁R coupled with a slow dissociation rate, demonstrating a 30,000-fold higher selectivity for AT₁R than AT₂R. Additionally, losartan has demonstrated an in vivo anti-fibrotic effect in Marfan syndrome and colorectal fibrosis, among other fibrosis-related diseases.^60–62 Based on these studies, AT₁R antagonism may be a promising therapeutic approach for anti-fibrotic treatments. However, no information has yet been provided on the effects of these pharmacological agents on the healing of full-thickness wounds, such as Losartan, in the bed of a hydrogel dressing with controlled release to reduce drug dose and side effects. The aim of this study is to evaluate the effect of a hydrogel containing different concentrations of losartan on skin wound healing. The preparation of Alg/Los hydrogel involved a combination of mechanical, chemical, and biological testing.

Porosity in hydrogel can facilitate cell migration and attachment, while its interconnected structure can promote gas exchange and permit the diffusion of nutrients.⁶² It has been suggested that a pore size of 20 to 120 micrometers is an appropriate range for the facilitation of wound healing.⁶³ Our research showed that the average pore size of Alg/Los hydrogels is in the range of 32 to 119 μm, which indicates a suitable environment for cell adhesion and motility, and therefore may provide an extracellular matrix-like substrate for cell anchoring and facilitates the repair process.

This study clarified the interaction between alginate hydrogel and losartan. As it is known in the FTIR method, the presence of carboxyl group (COOH) in the structure of alginate hydrogel and amine agent (N-H) in losartan can cause the connection of these two substances, which ultimately increases the mechanical strength of the scaffold containing losartan compared to the scaffold Without Losartan. Therefore, it can be concluded that the hardening/strengthening of alginate gel can be caused by non-specific hydrogen bonding interactions of alginate hydroxyl groups with losartan. In past studies, some types of such non-specific interactions have recently been found between alginate and pectin chains,¹⁹ which can be replicated in our synthesized structure. In addition, there are several studies that the use of calcium chloride to establish cross-linking can lead to mechanical stiffness, improved viscosity, and greater stability.⁶⁴ This mechanical strength has been aided by the use of CaCl₂ for the polymer’s cross-linking. When looking at the rheological features, the results from the FTIR study may be confirmed because the group with losartan and calcium chloride has the greatest viscosity. Based on the viscosity study, an increase in the dose of Losartan combined with alginate hydrogel resulted in increased viscosity volume which prevented rapid drug release and improved its structural stability.

Based on the ¹H NMR data and the chemical makeup of alginate, alginate hydrogels should be less porous and have a softer shape. A high number of M units contributes to the alginate structure’s reduced elastic segments, resulting in a more cross-linked structure.⁶⁵ Gels also frequently experience significant swelling during calcium cross-linking, which is followed by shrinkage, and they likewise become less stable with time.⁶⁶ These features suggest that the produced alginate hydrogel might have beneficial qualities for drug distribution and degradation kinetics.

Recent investigations have revealed the existence of polymers that can generate hydrogels with either hydrophilic or hydrophobic functional groups and can undergo swelling upon absorption of water. This process results in an expansion of the pore size, thus allowing for increased cell attachment and growth.^8,67 Our results demonstrated that alginate hydrogel has a good ability to absorb liquids, and on the other hand, the hydrophilic nature of losartan leads to water absorption up to a concentration of 0.1 mg, but increasing the concentration of losartan leads to a decrease in the ability to swell and absorb liquids. It is probably due to the increased mechanical strength and viscosity of the hydrogel. The data of this study show that water absorption capacity is directly related to time and increased over time and can be considered as an effective factor for exudate absorption in wound healing.

It was observed that the incorporation of Losartan between the Alginate chain and hydrogel matrix had a prolonged effect on biodegradation and the release of the prepared hydrogel. This release of the drug may result in cell interaction and nutrient transfer due to standard degradation frequency.³² The outcome of this study corroborated this notion, demonstrating that an increase in the amount of loaded Losartan resulted in a decrease in weight loss. The reason for this can be related to the increase in hydrogel strength. Also, the slow release of the drug prevents drug accumulation at the wound site and possible complications.

Ahmadi F et al. reported that the rate of hemolysis is influenced by the compatibility of various materials; hemoglobin levels in the plasma are indicated by the amount of damage caused by erythrocytes.⁶⁷ Based on previous studies, the critical hemolytic limit is below 5%.⁶⁸ There is a considerable amount of research that demonstrates the impact of Losartan as an anti-inflammatory, antioxidant, and antiulcer medication, thus implying its crucial role in promoting the healing of surgical wounds.^69–72 In this study, the hemolysis rate of Alginate hydrogel with varying concentrations of Losartan was not the same; however, it was lower than the positive control. This means the homocompatibility of Alg/Los hydrogels, but up to a concentration of 0.1 mg/mL because it passes the critical hemolytic limit at higher concentrations, and therefore it was found that the amount of hemolysis changes depending on the concentration after incorporating losartan into the constructed hydrogel.

Losartan has been shown to reduce the activity of platelets and coagulation factors by a thromboxane A₂-induced mechanism in a dose- and time-dependent manner, based on prior studies.⁷³ The BCI test was used to assay the coagulation activity of dressings, and it was found that the Alg/Los hydrogel had better coagulation properties, platelet adhesion, fluid absorption capacity, and fluid balance on the wound bed than the control group. The lower the BCI value, the more effective the coagulation effect of the dressing.⁷⁴

Regulation of fibroblast proliferation can be beneficial in decreasing abnormal wound repair processes and the progression of fibrotic diseases.⁷⁴ The results from the MTT assay indicated that Losartan did not significantly alter cell proliferation and morphology at 72 h. Furthermore, the results confirmed that the hydrogel formulated with the recommended dose (losartan 0.1 mg/mL) has no cytotoxic effect on the cells and can be used as a candidate for an in vivo study.

Having antimicrobial properties is one of the advantages of a suitable wound dressing.⁷⁵ Sodium alginate is a natural polymer with low antimicrobial activity,⁷⁶ which shows better antibacterial effects compared to the control group when combined with various components of losartan, but it is suggested to improve the antibacterial properties of this wound dressing by using polymers such as chitosan, which have good antibacterial properties and can be used with alginate for future studies.

Previous studies have reported that AT₁R blockers can inhibit cell proliferation and migration in numerous cell lines.^77,78 Oral administration of losartan was found to protect retinal ganglion cells by decreasing the number of fibroblasts in the sclera and influencing scleral remodeling in a mouse model.⁷⁹ Our results show that losartan is effective in wound closure in vitro (scratched wound) by control and modulation of fibroblast migration following with concentration. A concentration of up to 0.1 mg/mL, such as alginate hydrogel, can be effective in cell migration to close the gap, but higher concentrations lead to reduced migration and cell death.

Anbara T et al. have demonstrated that Losartan may be effective in suppressing fibrosis formation.⁸⁰ This research concentrated on a pharmaceutical blockade of AT₁R, yet angiotensin II can also activate the angiotensin II type 2 receptor. Angiotensin II signaling via AT₁R has been linked to inflammation, fibrosis, and organ injury.²⁵ TGF-β₁ signaling has been demonstrated to have a significant function in numerous stages of wound healing, including angiogenesis.^81–83 Studies have indicated a clear correlation between angiotensin type 1 receptor (AT₁R) and tissue fibrosis. Transforming growth factor-β₁ has been identified as a key target for managing scarring due to its role in promoting excessive collagen deposition.⁸⁴ Although it has been demonstrated experimentally that gene transfection or the use of antibodies can reduce the expression of TGF-β₁, no medical product is available for regular usage yet.⁸⁵ Various genes associated with fibrosis are also modulated by TGF-β₁, which acts as both canonical and non-canonical pathways. Losartan was found to reduce scar formation induced by TGF-β₁ in vivo without affecting the general well-being of rats.

The administration of Losartan was found to diminish the production of vascular endothelial growth factor (VEGF) stimulated by angiotensin II.⁸⁶ Previous kinds of literature has reported that ACE inhibitors and AT₁-receptor blockers are effective in reducing the overproduction of VEGF caused by pro-inflammatory cytokines.⁸⁷ Our findings show that losartan can reduce VEGF mRNA expression levels and inhibit angiogenesis, but this level of inhibition of angiogenesis by the administered dose in an animal study did not prevent skin tissue repair.

Newly formed blood vessels in wounds are crucial for the nourishment of granulation tissue and the epidermis. In the Losartan group, after 14 days of treatment, immunohistochemistry revealed a decrease in angiogenesis compared to the other two groups when VEGF markers were stained on the wound site. This may be due to the inhibition of fibroblast VEGF secretion by Alg/Los hydrogels, but despite the reduction of angiogenesis in the group treated with this concentration of losartan, the healing process is not disturbed because vessel formation is still observed. Finally, the results obtained in the immunohistochemistry assay approved the molecular studies of gene expression by real-time PCR.

Based on these results, it has been reported that alginate hydrogel containing losartan meets the requirements of good hydrogel formulation at the recommended concentration. In addition, this research demonstrated that all formulas exhibited uniform stability at cold (4 ± °C), room (27 ± °C), and warm (40 ± °C) temperatures for 60 days as observed by color. In the stability test, viscosity and pH are measured. Therefore, losartan can be developed as an effective drug in improving the wound healing process incorporated in a hydrogel substrate.

Although we know the limitations of this study, such as pharmacology studies (pK/PD analysis), receptor availability under damaged tissue, and investigating the potential of systemic absorption of losartan, but the designed hydrogels can be more effective by improving the antibacterial properties and investigating the healing efficacy of the wound dressing in diabetic and burn wound models in future studies to provide a deeper insight into the mode of action and efficacy of losartan for preclinical studies.

Conclusion

Alginate gels are exceptional biomaterials with broad applications in the food and pharmaceutical sectors. This study investigated the effect of Alg/Los hydrogels on the healing of full-thickness skin wounds. The results showed that alginate has a high number of M units, which helps to reduce the elastic parts of the hydrogel structure and thus creates a more cross-linked structure and can help in skin wound dressing. In vitro cell growth study showed that no cytotoxicity was observed at the proposed dose of hydrogel. However, analysis with other cell lines and primary cell cultures is suggested. Although based on the results of this wound dressing, it is promising for successful wound healing, But it can be obtained by examining the pharmacology of losartan (pK/pD) and its bioavailability and by evaluating the accessibility of the drug-sensitive receptor in the wound site, a deeper insight into the logic of the action of this wound dressing for future studies. Also, by evaluating other alginate cross-linking methods such as using other cross-linking compounds (such as Zn²⁺, Mn²⁺, Ba²⁺, and Al³⁺) and comparing them with each other, he obtained the optimal mechanical structure.

Supplemental Material

Supplemental Material - Evaluation effect of alginate hydrogel containing losartan on wound healing and gene expression

Supplemental Material for Evaluation effect of alginate hydrogel containing losartan on wound healing and gene expression by Sepehr Zamani, Majid Salehi, Ghasem Abbaszadeh Goudarzi, Danial Cheraghali, Arian Ehterami, Samaneh Esmaili and Nariman Rezaei kolarijani in Journal of Biomaterials Applications.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The present study was supported by Shahroud University of Medical Sciences, Shahroud, Iran (Grant No. 99170).

Ethical statement

ORCID iDs

Sepehr Zamani

Majid Salehi

Supplemental Material

Supplemental material for this article is available online.

References

Rani Raju

Silina

Stupin

, et al. Multifunctional and smart wound dressings—a review on recent research advancements in skin regenerative medicine. Pharmaceutics 2022; 14(8): 1574.

Selig

Lumenta

Giretzlehner

, et al. The properties of an “ideal” burn wound dressing–what do we need in daily clinical practice? Results of a worldwide online survey among burn care specialists. Burns 2012; 38(7): 960–966.

Ghadi

Jain

Khan

, et al. Microparticulate polymers and hydrogels for wound healing. In: Wound healing biomaterials. Amsterdam, The Netherlands: Elsevier, 2016, pp. 203–225.

Hatamzadeh

Najafi-Moghadam

Beygi-Khosrowshahi

, et al. Electrically conductive nanofibrous scaffolds based on poly (ethylene glycol) s-modified polyaniline and poly (ε-caprolactone) for tissue engineering applications. RSC Adv 2016; 6(107): 105371–105386.

Zhang

Zhou

Wei

, et al. Carboxyl-modified poly(vinyl alcohol)-crosslinked chitosan hydrogel films for potential wound dressing. Carbohydr Polym 2015; 125: 189–199.

Hamidi

Azadi

Rafiei

. Hydrogel nanoparticles in drug delivery. Adv Drug Deliv Rev 2008; 60(15): 1638–1649.

Hennink

van Nostrum

. Novel crosslinking methods to design hydrogels. Adv Drug Deliv Rev 2012; 64: 223–236.

Caló

Khutoryanskiy

. Biomedical applications of hydrogels: a review of patents and commercial products. Eur Polym J 2015; 65: 252–267.

Krausz

Adler

Cabral

, et al. Curcumin-encapsulated nanoparticles as innovative antimicrobial and wound healing agent. Nanomedicine 2015; 11(1): 195–206.

10.

Kikuchi

Kawabuchi

Sugihara

, et al. Pulsed dextran release from calcium-alginate gel beads. J Contr Release 1997; 47(1): 21–29.

11.

Chen

Horowitz

, et al. Towards an explanatory and computational theory of scientific discovery. Journal of Informetrics 2009; 3(3): 191–209.

12.

Varaprasad

Jayaramudu

Kanikireddy

, et al. Alginate-based composite materials for wound dressing application:A mini review. Carbohydr Polym 2020; 236: 116025.

13.

Eiselt

Yeh

Latvala

, et al. Porous carriers for biomedical applications based on alginate hydrogels. Biomaterials 2000; 21(19): 1921–1927.

14.

Laurienzo

. Marine polysaccharides in pharmaceutical applications: an overview. Mar Drugs 2010; 8(9): 2435–2465.

15.

Jang

Seol

Kim

, et al. Effects of alginate hydrogel cross-linking density on mechanical and biological behaviors for tissue engineering. J Mech Behav Biomed Mater 2014; 37: 69–77.

16.

Abdollahiyan

Oroojalian

Mokhtarzadeh

, et al. Hydrogel-based 3D bioprinting for bone and cartilage tissue engineering. Biotechnol J 2020; 15(12): e2000095.

17.

Brus

Urbanova

Czernek

, et al. Structure and dynamics of alginate gels cross-linked by polyvalent ions probed via solid state NMR spectroscopy. Biomacromolecules 2017; 18(8): 2478–2488.

18.

Cerciello

Del Gaudio

Granata

, et al. Synergistic effect of divalent cations in improving technological properties of cross-linked alginate beads. Int J Biol Macromol 2017; 101: 100–106.

19.

Urbanova

Macku

Kubova

, et al. Structure, dynamics, and functional properties of hybrid alginate-pectin gels dually crosslinked by Ca2+ and Zn2+ ions designed as a delivery device for self-emulsifying systems for lipophilic phytotherapeutics. Food Hydrocolloids 2024; 150: 109693.

20.

Zhang

Zhao

. Alginate hydrogel dressings for advanced wound management. Int J Biol Macromol 2020; 162: 1414–1428.

21.

Aguero

Alpdagtas

Ilhan

, et al. Functional role of crosslinking in alginate scaffold for drug delivery and tissue engineering: a review. Eur Polym J 2021; 160: 110807.

22.

Fang

Vreeker

, et al. Reexamining the egg-box model in calcium-alginate gels with X-ray diffraction. Biomacromolecules 2007; 8(2): 464–468.

23.

Zactiti

Kieckbusch

. Release of potassium sorbate from active films of sodium alginate crosslinked with calcium chloride. Packag Technol Sci 2009; 22(6): 349–358.

24.

Subramaniam

Fauzi

Lokanathan

, et al. The role of calcium in wound healing. Int J Mol Sci 2021; 22(12): 6486.

25.

Murphy

Wong

Bezuhly

. Modulation of angiotensin II signaling in the prevention of fibrosis. Fibrogenesis Tissue Repair 2015; 8: 7.

26.

Nehme

Cerutti

Dhaouadi

, et al. Atlas of tissue renin-angiotensin-aldosterone system in human: a transcriptomic meta-analysis. Sci Rep 2015; 5(1): 10035.

27.

Sica

Gehr

Ghosh

. Clinical pharmacokinetics of losartan. Clin Pharmacokinet 2005; 44(8): 797–814.

28.

Feng

Huo

, et al. Enalapril versus losartan for adults with chronic kidney disease: a systematic review and meta-analysis. Nephrology 2013; 18(9): 605–614.

29.

Akershoek

Brouwer

Vlig

, et al. Differential effects of Losartan and Atorvastatin in partial and full thickness burn wounds. PLoS One 2017; 12(6): e0179350.

30.

Zhao

W-Y

Zhang

L-Y

Wang

Z-C

, et al. The compound losartan cream inhibits scar formation via TGF-β/Smad pathway. Sci Rep 2022; 12(1): 14327.

31.

Hedayatyanfard

Ziai

Niazi

, et al. Losartan ointment relieves hypertrophic scars and keloid: a pilot study. Wound Repair Regen 2018; 26(4): 340–343.

32.

Hassani

Salehi

Ehterami

, et al. Evaluation of collagen type I and III, TGF-β1, and VEGF gene expression in rat skin wound healing treated by alginate/chitosan hydrogel containing crocetin. Biochem Eng J 2023; 195: 108895.

33.

Wang

. Alginate–konjac glucomannan–chitosan beads as controlled release matrix. Int J Pharm 2002; 244(1-2): 117–126.

34.

Liao

Wang

, et al. Genipin-crosslinked carboxymethyl chitosan nanogel for lung-targeted delivery of isoniazid and rifampin. Carbohydr Polym 2018; 197: 403–413.

35.

Hubbell

. Hydrogel systems for barriers and local drug delivery in the control of wound healing. J Contr Release 1996; 39(2-3): 305–313.

36.

Cheng

Jiang

, et al. Facile preparation of polysaccharide-based sponges and their potential application in wound dressing. J Mater Chem B 2018; 6(4): 634–640.

37.

Cha

Kwak

Park

, et al. Structural characteristics and biological performance of silk fibroin nanofiber containing microalgae Spirulina extract. Biopolymers 2014; 101(4): 307–318.

38.

Zhou

. Blood-compatibility of polyurethane/liquid crystal composite membranes. Biomaterials 1999; 20(22): 2093–2099.

39.

Ilina

Friedl

. Mechanisms of collective cell migration at a glance. J Cell Sci 2009; 122(18): 3203–3208.

40.

McDougall

Dallon

Sherratt

, et al. Fibroblast migration and collagen deposition during dermal wound healing: mathematical modelling and clinical implications. Philos Trans A Math Phys Eng Sci 2006; 364(1843): 1385–1405.

41.

Jagetia

Ravikiran

. Acceleration of wound repair and regeneration by Nigella sativa in the deep dermal excision wound of mice whole body exposed to different doses of γ-radiation. Am Res J Med Surg 2015; 1(3): 1–17.

42.

Farhamzah

Kusumawati

Alkandahri

, et al. Sun Protection factor activity of black glutinous rice emulgel extract (Oryza sativa var glutinosa). Indian Journal of Pharmaceutical Education and Research 2022; 56(1): 302–310.

43.

Jagetia

Rajanikant

. Topical application of curcumin augments healing of deep dermal excision wound of mice exposed to whole-body gamma radiation. J Nurs Healthc 2017; 2(1): 1–7.

44.

Segal

Hunt

Gilding

. The effects of alginate and non-alginate wound dressings on blood coagulation and platelet activation. J Biomater Appl 1998; 12(3): 249–257.

45.

Bagher

Ehterami

Safdel

, et al. Wound healing with alginate/chitosan hydrogel containing hesperidin in rat model. J Drug Deliv Sci Technol 2020; 55: 101379.

46.

Chen

Zhu

, et al. Promoting epithelium regeneration for esophageal tissue engineering through basement membrane reconstitution. ACS Appl Mater Interfaces 2014; 6(7): 4954–4964.

47.

Yang

Leong

, et al. The design of scaffolds for use in tissue engineering. Part I. Traditional factors. Tissue Eng 2001; 7(6): 679–689.

48.

Khattab

Gad

El-Sayed

, et al. Simple controlled release delivery system for an anti-hypertensive drug via buccal route. J Pharm Res Int 2014; 4(10): 1174–1195.

49.

Birajdar

Bhusnure Omprakash

Mulaje Suraj

. Formulation and evaluation of fast disintegrating losartan potassium tablets by formal experimental design. Seeds 2014; 5: 6.

50.

Cao

Wang

, et al. Phytochemical-mediated glioma targeted treatment: drug resistance and novel delivery systems. Curr Med Chem 2020; 27(4): 599–629.

51.

Ahmed

Ali

, et al. Spectroscopic and cytotoxic studies of losartan complexes. Pak J Pharm Sci 2018; 31(5): 1871–1879.

52.

Kim

Lee

C-G

Lee

. Alginate lyase: structure, property, and application. Biotechnol Bioproc Eng 2011; 16: 843–851.

53.

Torres

Sousa

Silva Filho

, et al. Extraction and physicochemical characterization of Sargassum vulgare alginate from Brazil. Carbohydr Res 2007; 342(14): 2067–2074.

54.

Astm F. 756-00 . Standard practice for assessment of hemolytic properties of materials. Philadelphia: American Society for Testing and Materials, 2000.

55.

International

(ed) Annual book of ASTM standards 2004: section 2, nonferrous metal products. Volume 02.04, nonferrous metals-nickel, cobalt, lead, tin, zinc, cadmium, precious, reactive, refractary metals and alloys, material for thermostats, electrical heating and resistance contacts, and connectors. West Conshohocken, Pennsylvania: American Society for testing and Materials, 2004.

56.

McDougall

Dallon

Sherratt

, et al. Fibroblast migration and collagen deposition during dermal wound healing: mathematical modelling and clinical implications. Philos Trans A Math Phys Eng Sci 2006; 364(1843): 1385–1405.

57.

Rao

Sudhakar

, et al. Synthesis and Characterization of biodegradable Poly (Vinyl caprolactam) grafted on to sodium alginate and its microgels for controlled release studies of an anticancer drug. J Appl Pharmaceut Sci 2013; 3(6): 61–69.

58.

Wang

Shelton

Cooper

, et al. Evaluation of sodium alginate for bone marrow cell tissue engineering. Biomaterials 2003; 24(20): 3475–3481.

59.

Poduri

Rateri

Howatt

, et al. Fibroblast angiotensin II type 1a receptors contribute to angiotensin II–induced medial hyperplasia in the ascending aorta. Arterioscler Thromb Vasc Biol 2015; 35(9): 1995–2002.

60.

Habashi

Judge

Holm

, et al. Losartan, an AT1 antagonist, prevents aortic aneurysm in a mouse model of Marfan syndrome. Science 2006; 312(5770): 117–121.

61.

Lacro

Dietz

Wruck

, et al. Rationale and design of a randomized clinical trial of beta-blocker therapy (atenolol) versus angiotensin II receptor blocker therapy (losartan) in individuals with Marfan syndrome. Am Heart J 2007; 154(4): 624–631.

62.

Wengrower

Zanninelli

Latella

, et al. Losartan reduces trinitrobenzene sulphonic acid-induced colorectal fibrosis in rats. Can J Gastroenterol 2012; 26(1): 33–39.

63.

Yannas

Lee

Orgill

, et al. Synthesis and characterization of a model extracellular matrix that induces partial regeneration of adult mammalian skin. Proc Natl Acad Sci USA 1989; 86(3): 933–937.

64.

Cao

Yuan

, et al. Effects of the incorporation of calcium chloride on the physical and oxidative stability of filled hydrogel particles. Foods 2022; 11(3): 278.

65.

Draget

Skjåk-Bræk

Smidsrød

. Alginate based new materials. Int J Biol Macromol 1997; 21(1-2): 47–55.

66.

Shilpa

Agrawal

Ray

. Controlled delivery of drugs from alginate matrix. J Macromol Sci Polym Rev 2003; 43(2): 187–221.

67.

Ahmadi

Oveisi

Samani

, et al. Chitosan based hydrogels: characteristics and pharmaceutical applications. Res Pharm Sci 2015; 10(1): 1–16.

68.

Sarika

James

. Polyelectrolyte complex nanoparticles from cationised gelatin and sodium alginate for curcumin delivery. Carbohydr Polym 2016; 148: 354–361.

69.

Kramer

Sunkomat

Witte

, et al. Angiotensin II receptor–independent antiinflammatory and antiaggregatory properties of losartan: role of the active metabolite EXP3179. Circ Res 2002; 90(7): 770–776.

70.

Yao

Fukuda

Matsumoto

, et al. Losartan improves the impaired function of endothelial progenitor cells in hypertension via an antioxidant effect. Hypertens Res 2007; 30(11): 1119–1128.

71.

Merai

Asad

Prasad

. Effect of centrally administered losartan on gastric and duodenal ulcers in rats. Pharmacology 2009; 84(2): 93–98.

72.

Galati

Trovato

Kirjavainen

, et al. Biological effects of hesperidin, a Citrus flavonoid. (Note III): antihypertensive and diuretic activity in rat. Farmaco 1996; 51(3): 219–221.

73.

Guerra-Cuesta

Monton

Rodriguez-Feo

, et al. Effect of losartan on human platelet activation. J Hypertens 1999; 17(3): 447–452.

74.

Yang

Liang

Chen

, et al. Mussel-inspired adhesive antioxidant antibacterial hemostatic composite hydrogel wound dressing via photo-polymerization for infected skin wound healing. Bioact Mater 2022; 8: 341–354.

75.

Matica

Aachmann

Tøndervik

, et al. Chitosan as a wound dressing starting material: antimicrobial properties and mode of action. Int J Mol Sci 2019; 20(23): 5889.

76.

Mohamed

Ahmed

Abdel-Gawad

. Preparation and evaluation of the antimicrobial activity of sodium alginate-grafted diphenylamine embedded with silver nanoparticles. Polym Bull 2023; 80(9): 9797–9810.

77.

Chen

Meng

Zhao

, et al. Angiotensin II type 1 receptor antagonists inhibit cell proliferation and angiogenesis in breast cancer. Cancer Lett 2013; 328(2): 318–324.

78.

Zhang

Wang

. Telmisartan inhibits NSCLC A549 cell proliferation and migration by regulating the PI3K/AKT signaling pathway. Oncol Lett 2018; 15(4): 5859–5864.

79.

Quigley

Pitha

Welsbie

, et al. Losartan treatment protects retinal ganglion cells and alters scleral remodeling in experimental glaucoma. PLoS One 2015; 10(10): e0141137.

80.

Anbara

Sharifi

Aboutaleb

. Endothelial to mesenchymal transition in the cardiogenesis and cardiovascular diseases. Curr Cardiol Rev 2020; 16(4): 306–314.

81.

Wahl

Hunt

Wakefield

, et al. Transforming growth factor type beta induces monocyte chemotaxis and growth factor production. Proc Natl Acad Sci U S A 1987; 84(16): 5788–5792.

82.

Goumans

Liu

ten Dijke

. TGF-beta signaling in vascular biology and dysfunction. Cell Res 2009; 19(1): 116–127.

83.

Pardali

Goumans

Ten Dijke

. Signaling by members of the TGF-beta family in vascular morphogenesis and disease. Trends Cell Biol 2010; 20(9): 556–567.

84.

Ignotz

Massague

. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J Biol Chem 1986; 261(9): 4337–4345.

85.

Karimizadeh

Motamed

Mahmoudi

, et al. Attenuation of fibrosis with selective inhibition of c-Abl by siRNA in systemic sclerosis dermal fibroblasts. Arch Dermatol Res 2015; 307(2): 135–142.

86.

Takagi

Kaji

Nishimura

, et al. The angiotensin II receptor blocker losartan sensitizes human liver cancer cells to lenvatinib-mediated cytostatic and angiostatic effects. Cells 2021; 10(3): 575.

87.

Sauter

Cohen

Wornle

, et al. ACE inhibitor and AT1-receptor blocker attenuate the production of VEGF in mesothelial cells. Perit Dial Int 2007; 27(2): 167–172.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.10 MB

Evaluation effect of alginate hydrogel containing losartan on wound healing and gene expression

Abstract

Keywords

Introduction

Method & material

Materials

Hydrogel fabrication

Lyophilization

Hydrogel characterization

Morphological properties

Fourier transforms infrared spectroscopy (FTIR)

1H NMR

Swelling studies

Weight loss analysis

Release of losartan

Hemolysis

Blood clotting index (BCI)

Cell viability study

Wound scratch assay

Rheological studies

Stability studies

Antibacterial assay

In vivo wound healing study

Histopathology study

Histomorphometric analysis

Immunohistochemical staining

RNA extraction

Real-time RT-PCR

Statistical analysis

Results

Morphological properties

Pure losartan FTIR analysis

Hydrogels FTIR analysis

Determination of the chemical composition by 1H NMR

Swelling study

Weight loss analysis

Release of losartan

Blood compatibility results

BCI results

Cell viability results

Wound scratch assay

Rheological results

Stability results

Antibacterial assay analysis

In vivo wound healing study

Histopathological results

Histomorphometric analysis

Immunohistochemistry

Real-time RT-PCR

Discussion

Conclusion

Supplemental Material

Supplemental Material - Evaluation effect of alginate hydrogel containing losartan on wound healing and gene expression

Footnotes

Declaration of conflicting interests

Funding

Ethical statement

ORCID iDs

Supplemental Material

References

Supplementary Material

¹H NMR

Determination of the chemical composition by ¹H NMR