Hsa_circ_0019054 up-regulates HIF1A through sequestering miR-340–5p to promote the tumorigenesis of intrahepatic cholangiocarcinoma

Abstract

Background

Circular RNAs (circRNAs) have been uncovered to play an important regulatory function in the tumorigenesis of intrahepatic cholangiocarcinoma (ICC). Hsa_circ_0,019,054 was found to be increased in ICC. Here, we aimed to explore the action and mechanism of hsa_circ_0,019,054 in ICC carcinogenesis.

Methods

Quantitative real-time PCR (qRT-PCR) and western blotting were used to detect the levels of genes and proteins. The functional experiments were performed using in vitro 5-ethynyl-2’-deoxyuridine (EdU) assay, cell counting Kit-8 (CCK-8) assay, flow cytometry, and in vivo murine xenograft model. The glycolysis was analyzed by detecting glucose uptake and lactate level. The binding between miR-340–5 p and hsa_circ_0,019,054 or HIF1A (Hypoxia-inducible factor 1-alpha) was validated using pull-down, dual-luciferase reporter and RNA immunoprecipitation assays.

Results

Hsa_circ_0,019,054 expression was higher in ICC tissues and cells. Functionally, hsa_circ_0,019,054 silencing could suppress ICC cell proliferation and glycolysis active, as well as induce apoptosis. Mechanistically, hsa_circ_0,019,054 was demonstrated to act as a sponge for miR-340–5 p, which directly targeted HIF1A. Hsa_circ_0,019,054/miR-340–5 p/HIF1A formed a feedback loop. HIF1A was up-regulated, while miR-340–5 p was decreased in ICC tissues and cells. MiR-340–5 p re-expression attenuated ICC cell growth. Besides that, rescue experiments suggested that HIF1A overexpression or miR-340–5 p knockdown reversed the anti-proliferation and glycolysis arrest effects mediated by hsa_circ_0,019,054 silencing. Importantly, hsa_circ_0,019,054 silencing also impeded the growth of ICC in nude mice.

Conclusion

Hsa_circ_0,019,054 deficiency could attenuate the proliferation and glycolysis of ICC cells via miR-340–5 p/HIF1A axis.

Keywords

hsa_circ_0019054 miR-340–5 p HIF1A intrahepatic cholangiocarcinoma glycolysis

Introduction

Intrahepatic cholangiocarcinoma (ICC) arises from the epithelial cells of the intrahepatic and extrahepatic bile ducts, which represents 5%–30% of all primary liver cancers with an increasing incidence over the last several decades.^1–3 ICC is highly aggressive, currently, surgery is still the only potentially curative treatment for ICC, which is accompanied with a high rate of tumor recurrence.² Therefore, further investigations on the pathogenesis of ICC is necessary for fighting against this aggressive cancer.

Circular RNAs (circRNAs) are one of a new type of non-coding RNAs (ncRNAs) possessing a circular configuration formed by alternative splicing of pre-messenger RNA (mRNA).⁴ Due to the continuous covalently closed loop, circRNAs can against the degradation of RNase R exonuclease and exhibit highly stable in comparison to the typical linear ncRNA or mRNA.^5,6 CircRNAs are abundantly expressed in various cell types and organisms, in recent years, they have been revealed to play pivotal role in modulating a wide range of biological processes.^7,8 Besides, more and more findings indicated that circRNAs are abnormally expressed in many types of diseases, including cancers, moreover, altered circRNAs have been showed to be involved in the progression of cancers.^9,10 In addition, it has been proposed that circRNA can act as sponge for certain microRNAs (miRNAs) to isolate the degradation of target mRNAs mediated by miRNAs to exert their function in regulating cancer development.^11,12 For example, Yang et al. showed that circAGFG1 acted as an oncogene to accelerate the tumorigenesis and metastasis of breast cancer via miR-195–5 p/CCNE1 axis.¹³ CircHIPK3 was demonstrated to perform anticancer effects in bladder cancer that could repress cancer growth and metastasis via elevating HPSE through miR-558.¹⁴ As another example, circACTN4 promoted ICC cell metastasis and proliferation through inducing Frizzled-7 transcription via miR-424–5p/YAP1 axis.¹⁵ Hsa_circ_0,019,054 is produced by back-splicing of the exon 5 to 6 of ATAD1 (ATPase Family AAA Domain Containing 1) gene on chr10: 89,536,077–89,544,427. A recent research showed that hsa_circ_0,019,054 was highly expressed in cholangiocarcinoma tissues.¹⁶ However, the action of hsa_circ_0,019,054 in ICC remain vague.

Here, we speculated that hsa_circ_0,019,054 might be involved in the tumorigenesis of ICC. The action of hsa_circ_0,019,054 on ICC cell tumorigenic phenotypes and glycolysis was investigated. Besides that, this work also explored the potential underlying miRNA/mRNA axis of hsa_circ_0,019,054 in ICC growth.

Materials and methods

Clinical tissue specimens

In total, 63 pairs of ICC tissues and adjacent normal tissues were collected from Cancer Hospital Affiliated to Xinjiang Medical University and immediately preserved at −80°C until use. All patients were diagnosed by pathological and clinical examinations and did not received preoperative treatment. Written informed consent had been collected before sample collection and this research was permitted by the Ethics Committee of Cancer Hospital Affiliated to Xinjiang Medical University according to the Declaration of Helsinki.

Cell culture

Human normal intrahepatic biliary epithelial cell line HIBEC, as well as cholangiocarcinoma cell lines RBE and HuCC-T1 were purchased from Procell (Wuhan, China), and maintained in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS) (Invitrogen, Camarillo, CA, USA) at 37 with 5% CO2.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted using Trizol reagent (Invitrogen). RNAs from nucleus and cytoplasm of BC cells were separated as per the protocol of the PARIS™ Kit (Invitrogen). Approximately 3 µg of total RNAs were treated with RNase R (3 U/μg, Geneseed, Guangzhou, China) or Mock at 37°C for 3 h to identify the cyclization of circRNA. Then the synthesis of cDNA was conducted using the PrimeScript RT Master Mix (Takara, Dalian, China) or TaqMan MicroRNA Reverse Transcription kit (Invitrogen) under the recommended condition. Next, TB Green Premix Ex Taq (Takara) exploited for the qRT-PCR analysis with U6 or β-actin as the reference control. The relative fold changes were calculated by 2^−ΔΔCt method. Specific primer sequences for qRT-PCR are listed in Table 1.

Table 1.

Primers sequences used for qRT-PCR.

Name		Primers for qRT-PCR (5’-3’)
hsa_circ_0019054	Forward	TCTGACCATGAAGCTACAGCC
hsa_circ_0019054	Reverse	ATAGAGAAGAACACCTGGCAGC
HIF1A	Forward	CGGCGCGAACGACAAGAAAA
HIF1A	Reverse	GAAGTGGCAACTGATGAGCA
miR-140–3 p	Forward	TCCGAGTACCACAGGGTAG
miR-140–3 p	Reverse	CTCAACTGGTGTCGTGGAG
miR-340–5 p	Forward	GTCCGAGTTATAAAGCAATGAG
miR-340–5 p	Reverse	GTCCGAGTTATAAAGCAATGAG
ATAD1	Forward	GCCATAAAGCTACAACCATCCA
ATAD1	Reverse	TCCCAGAGACTCATAAACTGAGC
U6	Forward	CTTCGGCAGCACATATACT
U6	Reverse	AAAATATGGAACGCTTCACG
β-actin	Forward	CTTCGCGGGCGACGAT
β-actin	Reverse	CCACATAGGAATCCTTCTGACC

Vector construction and transfection

Short hairpin RNAs (shRNAs) targeting hsa_circ_0,019,054 (sh-hsa_circ_0,019,054) and nontarget shRNAs (sh-NC), miR-340–5 p mimic (miR-340–5 p), inhibitor (anti-miR-340–5 p) and the negative controls (miR-NC or anti-miR-NC) were procured from RiboBio (Guangzhou, China). Then lentivirus plasmids carrying sh-hsa_circ_0,019,054 or sh-NC were provided by HanBio (Shanghai, China) for animal experiments. The transfection was conducted using the lipofectamine 3000 provided by Invitrogen.

5-ethynyl-2’-deoxyuridine (EdU) assay

After indicated transfection, transfected RBE and HuCC-T1 cells were reacted with 50 μM EdU solution at 37°C for 2 h incubation in a 96-well plate with fresh DMEM. Following the incubation with Apollo reaction mixture and DAPI counterstaining, EdU positive cells were visualized using a fluorescence microscope (Leica, Wetzlar, Germany).

Cell counting Kit-8 (CCK-8) assay

Transfected RBE and HuCC-T1 cells were placed into a 96-well plate with culture medium all night. Then each well was added with 10 μL CCK-8 (5 mg/mL) (Solarbio, Beijing, China) for 2 h incubation at the culture of 0, 24, 48, or 72 h. Lastly, the absorbance measured at 450 nm to plot proliferation curves.

Flow cytometry

For cell cycle analysis, transfected RBE and HuCC-T1 cells were fixed in 75% ethanol, followed by dyeing with propodium iodide (PI) solution (BD Biosciences, Franklin Lakes, NJ, USA) for 15 min at room temperature. For cell apoptosis analysis, RBE and HuCC-T1 cells underwent assigned transfection were stained with FITC-conjugated Annexin V (BD Biosciences) and PI away from light for 15 min. Finally, the flow cytometry (FACScan™, BD Biosciences) was utilized to analyze cell distribution or apoptotic cells.

Glucose uptake and lactate product assay

RBE and HuCC-T1 cells with assigned transfection were collected, lysed, and centrifuged, and the medium was collected. Then the relative glucose uptake and lactate production were assayed using a Glucose Uptake Assay Kit or a Lactate Assay Kit, respectively.

Western blotting

The proteins were extracted using RIPA lysis buffer (Beyotime, Shanghai, China) and qualified by a BAC method. Then about 30 μg proteins were separated by SDS-PAGE and electrophoretically transferred onto PVDF membranes. Next, the specific primary antibodies against Cyclin D1 (ab16663, 1:200), BCL2 (ab32124, 1:1000), GLUT1 (ab14683, 1:2500), β-actin (ab8226, 1:1000) (Abcam, Cambridge, MA, USA) and HIF1A (20,960-1-AP, 1: 2000) (Proteintech, Wuhan, China) were used to incubate with the membranes all night at 4°C, followed by the incubation with secondary antibodies at 37°Cfor 2 h. Protein bands were observed using an ECL reagent (Beyotime) and the gray value was analyzed with Image J software.

Pull-down assay

Biotinylated hsa_circ_0,019,054 probes or oligonucleotide probe (oligo probes) were synthesized by Genepharma (Shanghai, China), and co-incubated the with C-1 magnetic beads to establish probe-coated beads. Then RBE and HuCC-T1 cells were lysed, the lysates were reacted with probe-coated beads mixture for 12 h at 4°C. Finally, the bound RNAs were isolated by TRIzol and assayed by qRT-PCR.

RNA immunoprecipitation (RIP)

The RBE and HuCC-T1 cells were lysed, 200 μL of lysates were reacted with magnetic beads and anti-Ago2 antibody or the negative control anti-IgG antibody overnight at 4°C. Following centrifugation and proteinase K treatment, immunoprecipitated RNAs were isolated for qRT-PCR.

Dual-luciferase reporter assay

Sequences containing wild-type (WT) miR-340–5 p binding site in the 3’-UTR of hsa_circ_0,019,054 or HIF1A or the site sequences mutation (MUT) were cloned into the pGL3-basic vectors (Realgene, Nanjing, China) to construct luciferase reporter vector (WT/MUT-hsa_circ_0,019,054 or WT/MUT-HIF1A 3’UTR). Then RBE and HuCC-T1 cells were co-transfected with recombinant plasmids and pRL-TK vectors together with miR-340–5 p mimic or the control for 48 h, and dual-luciferase reporter assay system (Invitrogen) was applied for the detection of Firefly and Renilla luciferase activities.

Animal experiments

A total of 10 BALB/c nude mice (5–6 weeks old) were obtained from Charles River Labs (Beijing, China) and kept under controlled conditions. This experimental procedures were approved by Cancer Hospital Affiliated to Xinjiang Medical University Animal Care and Use Committee. HuCCT-1 stably transfected with lentivirus plasmids of sh-hsa_circ_0,019,054 or sh-NC were subcutaneously injected into the nude mice. The tumor size was measured every 5 days and tumor volume was calculated by the formula: volume = (length × width2)/2. At days 30, all mice were euthanized via overdose of pentobarbital sodium, and xenograft tumors were isolated and weighed.

Immunohistochemistry staining

Paraffin embedded xenograft tumors were dewaxed and rehydrated, then the sections were incubated with Cyclin D1 (ab16663, 1:100), BCL2 (ab32124, 1:200), GLUT1 (ab14683, 1:250) (Abcam) and HIF1A (20,960-1-AP, 1: 100) (Proteintech) 4°Call night, followed by the incubation with secondary antibody labeled with HRP for 1 h at 37°C. Next, sections were reacted with diaminobenzidine (DAB) substrate and was used for the observation of positive staining.

Statistical analysis

Each experiment was repeated three times and the result data were manifested as mean ± standard deviation (SD). The comparisons were conducted using analysis of variance with Tukey’s post-test, Student’s t test, or Mann-Whitney. The expression correlation was analyzed using Pearson’s assay. p < 0.05 suggested statistically significant.

Results

Hsa_circ_0,019,054 is highly expressed in ICC tissues and cells

Hsa_circ_0,019,054 is produced by back-splicing of the exon 5–6 of ATAD1 gene on chr10: 89,536,077–89,544,427 with a length of 308 bp (Figure 1(a)). It was observed that hsa_circ_0,019,054 expression was higher in ICC tissues than those in normal tissues (Figure 1(b)). Also, hsa_circ_0,019,054 level was elevated in ICC cell lines (HuCC-T1 and RBE) compared with normal HIBEC cells (Figure 1(c)). Then, we found that hsa_circ_0,019,054 but not linear ATAD1 was resistant to efficient RNase R digestion in HuCC-T1 and RBE cells (Figure 1(d)). Furthermore, subcellular localization of hsa_circ_0,019,054 was determined, the results exhibited that hsa_circ_0,019,054 was mainly distributed in the cytoplasm of HuCC-T1 and RBE cells (Figures 1(e) and (f)). These results indicated that hsa_circ_0,019,054 is a stable circular RNA and might be involved in ICC progression by functioning as a miRNA sponge.

Figure 1.

Hsa_circ_0,019,054 is highly expressed in ICC tissues and cells. (a) The genomic locus and the back-spliced junction of hsa_circ_0,019,054 were indicated. (b) Increased levels of hsa_circ_0,019,054 in ICC tissues and normal tissues, as well as in ICC cell lines (HuCC-T1 and RBE) and normal HIBEC cells. (d) The stability analysis of hsa_circ_0,019,054 by RNase R treatment. (e, f) Nuclear-cytoplasmic fractionation assay showed that hsa_circ_0,019,054 was mainly localized in the cytoplasm of HuCC-T1 and RBE cells. ***p < .001.

Knockdown of hsa_circ_0,019,054 suppresses ICC cell tumorigenic phenotypes

Next, loss-of-function assay was performed to determine the action of hsa_circ_0,019,054 in ICC process. In EdU and CCK-8 assays, hsa_circ_0,019,054 knockdown was found to markedly inhibit HuCC-T1 and RBE cell proliferation (Figures 2(a) and (b)). Flow cytometry showed that hsa_circ_0,019,054 silencing progressively increased the proportion of HuCC-T1 and RBE cells in G0/G1 phase to the detriment of the S phase, indicating cell cycle arrest at S phase (Figure 2(c)). Moreover, flow cytometric analysis also displayed an increase of the apoptosis rate in HuCC-T1 and RBE cells (Figure 2(d)). Besides that, the relative glucose uptake and lactate production were also reduced after hsa_circ_0,019,054 down-regulation in HuCC-T1 and RBE cells (Figures 2(e) and (f)), implying the inactive glycolysis. In line with the results generated above, we analyzed the changes of Cyclin D1 (cellular proliferation regulator), BCL2 (anti-apoptosis protein) and GLUT1 (glucose transporter) in HuCC-T1 and RBE cells, western blot analysis showed that the expression of Cyclin D1, BCL2 and GLUT1 was decreased after hsa_circ_0,019,054 down-regulation (Figure 2(g)). Altogether, knockdown of hsa_circ_0,019,054 suppressed ICC cell growth by inhibiting cell proliferation and glycolysis and inducing cell apoptosis.

Figure 2.

Knockdown of hsa_circ_0,019,054 suppresses ICC cell tumorigenic phenotypes. (a–g) HuCC-T1 and RBE cells were transfected with sh-hsa_circ_0,019,054 or sh-NC. (a, b) Cell proliferation was detected by using EdU and CCK-8 assays. (c, d) Flow cytometry for cell cycle and cell apoptosis analysis. (e, f) Evaluation of glycolysis by detecting glucose uptake and lactate production. (g) Western blot analysis for the levels of Cyclin D1, BCL2 and GLUT1. ***p < .001.

HIF1A is highly expressed in ICC tissues and cells

It has been showed that intratumoral HIF1A regulated malignant behaviors and predicted the poor prognosis of ICC.¹⁷ The expression profile of HIF1A was then analyzed. HIF1A expression was higher in ICC tissues than those in normal tissues (Figures 3(a) and (b)). Similarly, an increased HIF1A was also observed in ICC cell line (HuCC-T1 and RBE) compared with the normal HIBEC cells (Figures 3(c) and (d)). Interestingly, a positive correlation between hsa_circ_0,019,054 and HIF1A mRNA was observed in ICC tissues (Figure 3(e)). Besides that, hsa_circ_0,019,054 down-regulation was accompanied by a decreased HIF1A level in HuCC-T1 and RBE cells (Figures 3(f) and (g)). These results implied that hsa_circ_0,019,054 might exert its effects via regulating HIF1A.

Figure 3.

HIF1A is highly expressed in ICC tissues and cells. (a–d) Increased levels of HIF1A in ICC tissues and normal tissues, as well as in ICC cell lines (HuCC-T1 and RBE) and normal HIBEC cells. (e) A positive correlation between hsa_circ_0,019,054 and HIF1A mRNA in ICC tissues. (f, g) Levels of HIF1A were detected by qRT-PCR and western blotting in HuCC-T1 and RBE cells transfected with sh-hsa_circ_0,019,054 or sh-NC. ***p < .001.

Hsa_circ_0,019,054/miR-340–5p/HIF1A forms a feedback loop

Subsequently, how hsa_circ_0,019,054 regulated HIF1A was investigated. Over-lapping analysis with starbase database revealed two target miRNAs containing the complementary sequences of both hsa_circ_0,019,054 and HIF1A (Figure 4(a)). The results of the pull-down assay with specific biotin-labeled hsa_circ_0,019,054 probes showed that miR-340–5 p but not miR-140–3 p was significantly captured in hsa_circ_0,019,054 probes compared with control probes (Figures 4(b) and (c)). Ago2 is required for miRNA-mediated gene silencing. RIP assay in ICC cells further showed that hsa_circ_0,019,054, miR-340–5 p and HIF1A were efficiently pulled down by anti-Ago2 antibodies compared with the IgG control (Figures 4(d) and (e)). Thus, we speculated that there might be a binding between miR-340–5 p and hsa_circ_0,019,054 or HIF1A. The luciferase reporter vectors with WT-hsa_circ_0,019,054, WT-HIF1A 3’UTR sequences and mutant version without miR-340–5 p binding sites were constructed (Figure 4(f)). Then dual-luciferase reporter assay was conducted and results showed that miR-340–5 p overexpression could significantly reduce the luciferase activities of wild-type hsa_circ_0,019,054 and HIF1A 3’UTR reporter vectors, but not affected the mutated one in 293T cells (Figures 4(g) and (h)). Besides, miR-340–5 p overexpression or down-regulation led to a decrease or an increase of HIF1A expression level in HuCC-T1 and RBE cells (Figures 4(i) and (j)). Importantly, knockdown of hsa_circ_0,019,054 was accompanied with the down-regulation of HIF1A expression, which was rescued by the inhibition of miR-340–5 p in HuCC-T1 and RBE cells (Figures 4(k) and (l)). Additionally, miR-340–5 p expression was decreased in ICC tissues and cells (Fig. 4M, N), which was contrary to the tendency of hsa_circ_0,019,054 and HIF1A. In all, miR-340–5 p was a target of hsa_circ_0,019,054, and miR-340–5 p directly targeted HIF1A.

Figure 4.

Hsa_circ_0,019,054/miR-340–5 p/HIF1A forms a feedback loop. (a) Venn diagram indicating the indicating the target miRNAs of both hsa_circ_0,019,054 and HIF1A based on starbase database. (b, c) RNA pull-down and qRT-PCR were executed to detect the enrichment of miR-340–5 p and miR-140–3 p with biotin-labeled hsa_circ_0,019,054 probes. (d, e) RIP assay and qRT-PCR were executed to detect the levels of hsa_circ_0,019,054, miR-340–5 p, and HIF1A. (f) The wild-type hsa_circ_0,019,054 and HIF1A 3’UTR sequences with miR-340–5 p binding sites and mutant version without miR-340–5 p binding sites were showed. (g, h) Dual-luciferase reporter assay for the luciferase activity analysis. (i, j) The effects of miR-340–5 p on HIF1A expression. (k, l) The effects of hsa_circ_0,019,054/miR-340–5 p axis on HIF1A expression. (m, n) Decreased levels of miR-340–5 p in ICC tissues and normal tissues, as well as in ICC cell lines (HuCC-T1 and RBE) and normal HIBEC cells. **p < .01, ***p < .001.

Overexpression of miR-340–5 p suppresses ICC cell tumorigenic phenotypes

Next, the functions of miR-340–5 p in ICC process were studied. Overexpression of miR-340–5 p was found to suppress HuCC-T1 and RBE cell proliferation (Figures 5(a) and (b)). Flow cytometry indicated that miR-340–5 p up-regulation induced cell cycle arrest and apoptosis in HuCC-T1 and RBE cells (Figures 5(c) and (d)). Besides, we also observed the reductions of relative glucose uptake and lactate production in HuCC-T1 and RBE cells after miR-340–5 p up-regulation (Figures 5(e) and (f)). Western blot analysis showed that miR-340–5 p mimic transfection suppressed the expression of Cyclin D1, BCL2 and GLUT1 in HuCC-T1 and RBE cells (Figure 5(g)). Collectively, up-regulation of miR-340–5 p could repress ICC cell proliferation and glycolysis.

Figure 5.

Overexpression of miR-340–5 p suppresses ICC cell tumorigenic phenotypes. (a–g) HuCC-T1 and RBE cells were transfected with miR-340–5 p or miR-NC. (a, b) Cell proliferation was detected by using EdU and CCK-8 assays. (c, d) Flow cytometry for cell cycle and cell apoptosis analysis. (e, f) Evaluation of glycolysis by detecting glucose uptake and lactate production. (g) Western blot analysis for the levels of Cyclin D1, BCL2 and GLUT1. ***p < .001.

MiR-340–5 p down-regulation or HIF1A up-regulation attenuates the inhibition of hsa_circ_0,019,054 knockdown on ICC cell tumorigenic phenotypes

Furthermore, we ascertain the regulatory effects of hsa_circ_0,019,054/miR-340–5 p/HIF1A axis in ICC. Western blot analysis showed that HIF1A expression was decreased by hsa_circ_0,019,054 knockdown and subsequently up-regulated in response to the transfection of miR-340–5 p inhibitor or HIF1A vector (Figure 6(a)). Then a series of rescue experiments were conducted. The results confirmed that the introduction of miR-340–5 p inhibitor or HIF1A vector reversed hsa_circ_0,019,054 knockdown-evoked proliferation inhibition (Figures 6(b) and (c)), cell cycle arrest (Figure 6(d)) and apoptosis enhancement (Figure 6(e)). In addition, the decreased glucose uptake and lactate production in HuCC-T1 and RBE cells mediated by hsa_circ_0,019,054 deficiency was also rescued by miR-340–5 p inhibition or HIF1A overexpression (Figures 6(f) and (g)). Besides that, the levels of markers Cyclin D1, BCL2 and GLUT1 in HuCC-T1 and RBE cells were decreased after hsa_circ_0,019,054 silencing, while this condition was counteracted by miR-340–5 p inhibition or HIF1A overexpression (Figure 6(h)). Taken together, hsa_circ_0,019,054 regulated ICC cell tumorigenic phenotypes via miR-340–5 p/HIF1A axis.

Figure 6.

MiR-340–5 p down-regulation or HIF1A up-regulation attenuates the inhibition of hsa_circ_0,019,054 knockdown on ICC cell tumorigenic phenotypes. (a–h) HuCC-T1 and RBE cells were transfected with sh-hsa_circ_0,019,054 and HIF1A, or sh-hsa_circ_0,019,054 and anti-miR-340–5 p. (a) Western blot analysis for the levels of HIF1A in HuCC-T1 and RBE cells. (b, c) Cell proliferation was detected by using EdU and CCK-8 assays. (d, e) Flow cytometry for cell cycle and cell apoptosis analysis. (f, g) Evaluation of glycolysis by detecting glucose uptake and lactate production. (h) Western blot analysis for the levels of Cyclin D1, BCL2 and GLUT1. ***p < .001.

Knockdown of hsa_circ_0,019,054 hinders ICC growth in vivo

To explore the role of hsa_circ_0,019,054 in the in vivo growth of ICC, the murine xenograft models were established. As shown in Figures 7(a) and (b), hsa_circ_0,019,054 knockdown suppressed ICC growth in vivo, evidenced by significant decrease in tumor volume and weight of sh-hsa_circ_0,019,054 group compared with control group. Hsa_circ_0,019,054 knockdown led to the decrease of hsa_circ_0,019,054 in xenograft tumors (Figure 7(c)). Besides, IHC staining suggested that the activities of HIF1A, Cyclin D1, BCL2 and GLUT1 were lower compared with sh-NC group in xenograft tumors (Figure 7(d)). In summary, hsa_circ_0,019,054 silencing suppressed ICC growth in vivo.

Figure 7.

Knockdown of hsa_circ_0,019,054 hinders ICC growth in vivo. (a) Growth curves of mice subcutaneous xenograft tumors. (b) Representative xenograft tumors, and tumor weights were statistical assayed in dissected tumors. (c) qRT-PCR analysis for hsa_circ_0,019,054 expression in xenograft tumors. (d) IHC staining for HIF1A, Cyclin D1, BCL2 and GLUT1 in xenograft tumors. ***p < .001.

Discussion

ICC is known to be one of the most malignant cancers, owing to the high propensity for metastasis and the lack of effective systemic therapy, the long-term survival of ICC patients is even worse than for HCC.³ CircRNA is highly expressed across species and has significant advantages as the focus of targeted clinical therapy, which may be a related to the high conservation and stability.¹⁸ Currently, circRNAs have been reported to be implicated in the progression of ICC. For instance, circNFIB was demonstrated to repress the metastasis and growth and promote trametinib sensitivity in ICC by blocking MEK1/ERK pathway.¹⁹ Xu et al. showed that high circHMGCS1-016 was associated with recurrence and unfavorable prognosis of ICC patients, and showed an immunosuppressive role to contribute to immune tolerance by reducing CD8⁺ T cells infiltration in ICC.²⁰ Thus, circRNAs have great potential as biomarkers for ICC molecular therapy. In our work, we found an increased level of hsa_circ_0,019,054 in ICC tissues and cells. Functionally, hsa_circ_0,019,054 deficiency induced apoptosis and inhibited proliferation of ICC cells in vitro. Besides, hsa_circ_0,019,054 silencing also led to the decreased glucose uptake and lactate production, and the GLUT1 reduction, implying the arrest of glycolysis. Alteration of energy metabolism has been revealed to be one of the hallmarks of malignancies, most cancer cells show increased glycolysis for their energy supply, pharmacological suppression of glycolysis is a promising therapeutic strategy for killing tumor cells.^21,22 Importantly, hsa_circ_0,019,054 deficiency impeded tumor growth and migration in murine xenograft model. Thus, targeted inhibition of hsa_circ_0,019,054 may be an effective therapeutic approach for ICC patients.

HIF1A, a member of HIF family of transcription factors, is a master modular of cellular and systemic homeostatic response to hypoxia, involving in regulating energy metabolism, cell survival, apoptosis, angiogenesis, and inflammation.^23,24 Intratumoral HIF1A was found to be related to aggressive progression of ICC.¹⁷ Besides that, Tang et al. suggested that circRTN4IP1 promoted the tumorigenic phenotypes of ICC via miR-541–5 p/HIF1A axis.²⁵ In this study, we also showed an increase of HIF1A in ICC, moreover, a positive correlation between HIF1A and hsa_circ_0,019,054 expression in ICC was observed. In addition, circRNAs can act as sponge for miRNAs to regulate mRNAs expression.^{11, 12} Thus, we speculated hsa_circ_0,019,054 might function as a miRNA sponge to modulate HIF1A expression. Further experiments confirmed that hsa_circ_0,019,054 up-regulated HIF1A expression by targeting miR-340–5p, there was a hsa_circ_0,019,054/miR-340–5 p/HIF1A axis in ICC cells. Previous studies have indicated the involvement of miR-340–5 p in regulating the progression of many types of cancers.^26-28 In cholangiocarcinoma, miR-340–5 p was demonstrated to suppress the growth of this cancer cell by inducing cell cycle and proliferation arrest.²⁹ Consistent with these findings, we also observed a decrease of miR-340–5p in ICC, and re-expression of miR-340–5 p suppressed the proliferation and glycolysis in ICC cells. Additionally, rescue experiments showed that miR-340–5 p down-regulation or HIF1A up-regulation attenuated the inhibitory action of hsa_circ_0,019,054 knockdown on ICC cell tumorigenic phenotypes.

In conclusion, hsa_circ_0,019,054 deficiency could attenuate the proliferation and glycolysis, and induce apoptosis in ICC cells via miR-340–5p/HIF1A axis, indicating a potential therapeutic target for ICC patients.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by Natural Science Foundation of Xinjiang Uygur Autonomous Region [2021D01C399].

Data availability

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

ORCID iD

Feng Xue

References

Kelley

Bridgewater

Gores

, et al. Systemic therapies for intrahepatic cholangiocarcinoma. J Hepatol 2020; 72: 353–363.

Lee

Chun

. Intrahepatic cholangiocarcinoma: the AJCC/UICC 8th edition updates. Chin Clin Oncol 2018; 7: 52.

Massarweh

El-Serag

. Epidemiology of hepatocellular carcinoma and intrahepatic cholangiocarcinoma. Cancer Control 2017; 24: 1073274817729245.

Chen

Yang

. Regulation of circRNA biogenesis. RNA Biol 2015; 12: 381–388.

Cieslik

Zhang

, et al. The landscape of circular RNA in cancer. Cell 2019; 176: 869–881. e813.

Jeck

Sorrentino

Wang

, et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. Rna 2013; 19: 141–157.

Han

Chao

Yao

. Circular RNA and its mechanisms in disease: From the bench to the clinic. Pharmacol Ther 2018; 187: 31–44.

Kristensen

Hansen

Venø

, et al. Circular RNAs in cancer: opportunities and challenges in the field. Oncogene 2018; 37: 555–565.

Xie

, et al. Circular RNAs and cancer. Cancer Lett 2017; 396: 138–144.

10.

Chen

Shan

. CircRNA in cancer: undamental mechanism and clinical potential. Cancer Lett 2021; 505: 49–57.

11.

Hansen

Jensen

Clausen

, et al. Natural RNA circles function as efficient microRNA sponges. Nature 2013; 495: 384–388.

12.

Salmena

Poliseno

Tay

, et al.

A ceRNA hypothesis: the rosetta stone of a hidden RNA language?

Cell 2011; 146: 353–358.

13.

Yang

Xing

Zheng

, et al. The circRNA circAGFG1 acts as a sponge of miR-195-5p to promote triple-negative breast cancer progression through regulating CCNE1 expression. Mol Cancer 2019; 18: 4.

14.

Zheng

Xiao

, et al. CircHIPK3 sponges miR-558 to suppress heparanase expression in bladder cancer cells. EMBO Rep 2017; 18: 1646–1659.

15.

Chen

Wang

, et al. Circular RNA ACTN4 promotes intrahepatic cholangiocarcinoma progression by recruiting YBX1 to initiate FZD7 transcription. J Hepatol 2022; 76: 135–147.

16.

Gao

Wang

, et al. Circ-LAMP1 contributes to the growth and metastasis of cholangiocarcinoma via miR-556-5p and miR-567 mediated YY1 activation. J Cell Mol Med 2021; 25: 3226–3238.

17.

Morine

Shimada

Utsunomiya

, et al. Hypoxia inducible factor expression in intrahepatic cholangiocarcinoma. Hepatogastroenterology 2011; 58: 1439–1444.

18.

Liu

, et al. Targeting circular RNAs as a therapeutic approach: current strategies and challenges. Signal Transduct Target Ther 2021; 6: 185.

19.

Lan

Liao

, et al. CircNFIB inhibits tumor growth and metastasis through suppressing MEK1/ERK signaling in intrahepatic cholangiocarcinoma. Mol Cancer 2022; 21: 18.

20.

Dong

Wang

, et al. circHMGCS1-016 reshapes immune environment by sponging miR-1236-3p to regulate CD73 and GAL-8 expression in intrahepatic cholangiocarcinoma. J Exp Clin Cancer Res 2021; 40: 290.

21.

Pelicano

Martin

, et al. Glycolysis inhibition for anticancer treatment. Oncogene 2006; 25: 4633–4646.

22.

Ganapathy-Kanniappan

Geschwind

. Tumor glycolysis as a target for cancer therapy: progress and prospects. Mol Cancer 2013; 12: 152.

23.

Shukla

Purohit

Mehla

, et al. MUC1 and HIF-1alpha signaling crosstalk induces anabolic glucose metabolism to impart gemcitabine resistance to pancreatic cancer. Cancer Cell 2017; 32: 71–87. e77.

24.

Tiwari

Tashiro

Dixit

, et al. Loss of HIF1A from pancreatic cancer cells increases expression of PPP1R1B and degradation of p53 to promote invasion and metastasis. Gastroenterology 2020; 159: 1882–1897. e1885.

25.

Tang

Wang

Tang

, et al. CircRTN4IP1 regulates the malignant progression of intrahepatic cholangiocarcinoma by sponging miR-541-5p to induce HIF1A production. Pathol Res Pract 2022; 230: 153732.

26.

Zhao

, et al. Up-regulation of miR-340-5p promotes progression of thyroid cancer by inhibiting BMP4. J Endocrinol Invest 2018; 41: 1165–1172.

27.

Cui

Hao

, et al. SOX2 mediates cisplatin resistance in small-cell lung cancer with downregulated expression of hsa-miR-340-5p. Mol Genet Genomic Med 2020; 8: e1195.

28.

Algaber

Al-Haidari

Madhi

, et al. MicroRNA-340-5p inhibits colon cancer cell migration via targeting of RhoA. Sci Rep 2020; 10: 16934.

29.

Shi

Gong

Fujita

, et al. Aspirin inhibits cholangiocarcinoma cell proliferation via cell cycle arrest in vitro and in vivo. Int J Oncol 2021; 58: 199–210.