Epigenetic control of hypersensitivity in chronic inflammatory pain by the de novo DNA methyltransferase Dnmt3a2

Animals

All animal procedures were carried out in accordance with the local governing body for animal welfare (Regierungspräsidium Karlsruhe). Throughout all experiments, 8–14-week-old male C57Bl/6N (Charles River) mice were used. Mice were housed under ambient humidity and light conditions on a 12-h light-dark cycle and had ad libitum access to food and water. All nociceptive tests were conducted in awake and unrestrained animals.

Quantitative reverse transcriptase PCR

Spinal cord tissue (L3-L5) was harvested and rapidly frozen. The ventral part was dissected and discarded. In the case of viral-injected mice, only infected tissue was dissected for further analysis using Green Fluorescent Protein (GFP) fluorescence as guidance. Total RNA was extracted from the dorsal spinal cord using the RNeasy Mini Kit (Qiagen) including an optional DNase I treatment at room temperature for 15 min according to manufacturer’s instructions (Qiagen). Extracted RNA was reverse transcribed into first strand cDNA using High Capacity cDNA Reverse Transcription kit (Applied Biosystems). Quantitative reverse transcriptase PCR (QRT-PCR) was done on a StepOne plus real-time PCR system using TaqMan gene expression assays for the indicated genes (Applied Biosystems). The following TaqMan gene expression assays were used in this study: Dnmt3a1 (Mm00432870_m1), Dnmt3a2 (Mm00463987_m1), cFos (Mm00487425_m1), Bdnf (Mm00432069_m1), Arc (Mm00479619_g1), Ptgs2 (Mm00478374_m1). Expression of target genes was normalized against the expression of Gusb (Mm00446953_m1) which was used as an endogenous control gene.

Recombinant adeno-associated viruses

ecombinant adeno-associated viruses (rAAVs) 1/2 were produced by co-transfection of HEK293 cell by standard calcium phosphate precipitation. HEK293 cells were grown in high-glucose-containing (4.5 g/litre) Dulbecco’s Modified Eagle Medium (DMEM; Life Technologies) supplemented with 10% foetal bovine serum, 100 units/ml penicillin and 100 µg/ml streptomycin (Sigma). Before transfection, culture medium was replaced with fresh modified Dulbecco medium (Iscove’s Modified Dulbecco's Medium; Life Technologies) containing 5% foetal bovine serum without antibiotics. Packaging of rAAVs was carried out with helper plasmids pFΔ6, pRV1, and pH21 together with either pAAV-shDnmt3a2 or pAAV-shControl. After transfection, the medium was replaced with fresh DMEM containing 10% foetal bovine serum and antibiotics. Cells were collected at low speed centrifugation, resuspended in  150 mM NaCl-10 mM Tris-HCl (pH 8.5) and lysed by incubation with 0.5% sodium deoxycholate followed by freeze-thaw cycles. rAAVs were purified using heparin affinity columns (HiTrap Heparin HP; GE Healthcare). rAAVs stocks were concentrated using Amicon Ultra-4 centrifugal filter devices (Millipore). ²¹

The rAAV-shControl and rAAV-shDnmt3a2 viruses used in this work have been previously extensively characterized in vitro and in vivo for their specificity and efficacy.^10,13 They both carry an additional cassette for GFP expression under the control of a beta actin promoter. The Dnmt3a2-targeting shRNA sequence recognizes the 5′UTR sequence unique to Dnmt3a2. The Dnmt3a2-specific sequence is cccggacgggcagctatttacagagcctcgaggctctgtaaatagctgcccgttttttgaagctt. The control sequence is cgactaccgttgttataggtgttgatatccgcacctataacaacggtagttttt ttccaa. ¹⁰

Spinal cord neuronal cultures and stimulation

Spinal cord cultures were prepared from mouse pups at postnatal day 1. Pups were quickly decapitated and kept in cold phosphate-buffered saline (PBS) buffer. The complete spinal cord was quickly removed and cleaned from meningeal tissue. Tissue was homogenized and neurons plated following previously established protocols for primary neuronal cultures. ²²

On day 7 in vitro, the cultures were infected with rAAV-shControl and rAAV-shDnmt3a2 viruses, and then maintained at 37°C, 5% CO₂ for one additional week prior to harvesting for RNA extraction. Primary spinal cord neuronal cultures maintained in culture medium containing 114 mM NaCl, 26 mM NaHCO₃, 5.3 mM KCl, 1 mM MgCl₂, 2 mM CaCl₂, 10 mM HEPES, 1 mM glycine, 30 mM D-glucose and 0.5 mM sodium pyruvate, supplemented with 10% minimum essential medium with Earle’s salts (Life Technologies), insulin-transferrin-sodium selenite media supplement (72 μM, 7.2 μM and 2.9 μM, respectively; Sigma Aldrich), and 100 units/ml each penicillin and streptomycin were depolarized by adding to the medium 0.41 volumes of KCl depolarization solution containing 10 mM HEPES, pH 7.2, 170 mM KCl, 1 mM MgCl₂, 2 mM CaCl₂. ²³

In vivo injections of rAAV

Adult male C57Bl/6N mice at 8 to 10 weeks of age were anesthetized with fentanyl/medetomidine/midazolam (50 µg/kg; 5 mg/kg; 500 µg/kg), and laminectomy was performed. Five hundred nanolitres of a 2:1 mixture of rAAV stocks with 20% mannitol were injected into the spinal cord dorsal horn of the L3-L5 segments on each side (total of two injections per mouse) using a microprocessor-controlled minipump and a 35 gauge bevelled NanoFil needle (World Precision Instruments, Sarasota, FL) at a flow rate of 100 nl/min. Animals were assigned to the different groups (rAAV-shControl or rAAV-shDnmt3a2) randomly. Mice were allowed to recover for at least three weeks after surgery before further analysis. Following behavioural studies, animals were sacrificed and viral spread was assessed by fluorescence microscopy.

Models of pain

For the induction of long-lasting inflammatory pain, 20 µl Complete Freund’s Adjuvant (CFA; Sigma Aldrich) was injected under isoflurane anaesthesia subcutaneously into the plantar surface of one hindpaw as previously described. ²⁴ Control animals were injected with 0.9% saline. Acute inflammatory pain was induced by injecting 20 µl of a 0.03% capsaicin (Tocris) solution in PBS into the plantar surface of one hindpaw.

Immunohistochemistry

Mice were perfused with PBS and then 10% formalin (Sigma Aldrich). Spinal cords were isolated and post-fixed for 2.5 h in 10% formalin. Cryosections of the L3-L5 segments of the spinal cord (20 µm, Leica C1950 Cryostat) were mounted on Superfrost Plus Adhesion Microscope Slides™ (Thermo Scientific). Antibodies were diluted in 10% normal goat serum in 0.2% gelatin, 0.6% Triton X-100, 33 mM Na₂HPO₄, 900 mM NaCl, and sections were incubated overnight at 4°C with primary antibodies (mouse monoclonal anti-NeuN, 1:1000; Merck Millipore) and 90 min at RT with secondary antibodies (Alexa 594 goat anti-mouse, 1:1000; Life Technologies). Hoechst 33258 was used for visualization of nuclei. Coverslips were mounted with Mowiol 4–88 (Calbiochem).

Nociceptive tests

In all behavioural tests, the experimenter was blinded to the identity of the treatments that mice received and the same experimenter analysed all mice. Briefly, mice were acclimatized to the testing environment of the von Frey test and of the Hargreaves test for 1 h per day prior to behavioural testing and also on the day of testing. Responses to paw pressure were determined, as previously described, ²⁵ using a graded series of von Frey filaments (Ugo Basile) of 0.07, 0.16, 0.4, 0.6, and 1 g strength. Each filament was tested five times in increasing order starting with the filament producing the lowest force. To assess mechanical sensitivity, all filaments were applied and the number of withdrawals was recorded. Withdrawal frequency was calculated as a percentage of withdrawals out of the total number of von Frey applications per filament. Thermal hypersensitivity was assessed, as previously described, ²⁵ using the Hargreaves test (Ugo Basile) in which infrared heat is applied to the plantar surface of the hindpaw. Latency to the withdrawal of the paw was measured with a 15 s cut-off. For testing acute sensitivity, the duration of nocifensive behaviours, such as licking, shaking or flicking of the injected paw, was measured over a time period of 5 min after injection of capsaicin. At the end of behavioural tests, animals were sacrificed and viral expression was confirmed by fluorescence microscopy.

Data analysis

Data are presented as mean ± SEM. Statistical analyses were performed using Student's t-test, one-way analysis of variance (ANOVA) with Dunnett’s post hoc test or, when appropriate, two-way ANOVA for repeated measures. Details are available in the respective figure legends.

Dnmt3a2 is upregulated upon induction of chronic inflammatory pain

Previous work using primary mouse hippocampal neurons revealed that Dnmt3a2 expression is robustly induced following synaptic activity. ¹⁰ Moreover, Dnmt3a2 expression is triggered by activation of dopaminergic signalling in primary striatal cultures and in the Nucleus Accumbens Shell (NAcSh) upon cocaine administration. ¹⁴ To investigate whether nociceptive activity could affect Dnmt3a2 levels in the dorsal spinal cord, we used the CFA model of inflammatory pain and injected CFA into the intra-plantar surface of the hindpaw of adult mice. We sacrificed the animals 1, 3 or 6 h post-CFA injection, extracted the L3-L5 spinal cord segments and dissected the dorsal portion. QRT-PCR analysis revealed that upon induction of paw inflammation, Dnmt3a2 expression is significantly increased in the dorsal spinal cord (Figure 1(a)). In addition, we measured the levels of Dnmt3a1, whose transcriptional regulation in the hippocampus is not dependent on neuronal activity. ¹⁰ Consistent with our previous findings, here we found that CFA intra-plantar administration did not induce Dnmt3a1 expression (Figure 1(b)). The immediate early genes cFos, Bdnf and Arc, whose transcription was shown to be regulated by Dnmt3a2,^10,13 also displayed significantly higher levels following CFA intra-plantar injection (Figure 1(c) to (e)).^3,26 Importantly, we also detected a significant increase in the mRNA levels of Ptgs2 (Figure 1(f)), which encodes for the enzyme Cox-2, a critical mediator of pain responses.^3,27,28 Moreover, we analysed the expression level of the same genes at later time points, 24 h and 48 h, following CFA injection. None of the analysed immediate early genes or Dnmts showed any changes in comparison to saline controls (Figure 1(g)). We still detected a significant upregulation of Ptgs2 (Figure 1(g)).

OPEN IN VIEWER

Figure 1.

Dnmt3a2 expression level is increased after intra-plantar CFA injection. QRT-PCR analysis of Dnmt3a2 (a), Dnmt3a1 (b), cFos (c), Bdnf (d), Arc (e), and Ptgs2 (f) expression in the dorsal spinal cord of adult mice 1, 3, or 6 h after intra-plantar injection of CFA. Tissue was collected at the indicated time points. n = 4–9 mice per time point. (g) QRT-PCR analysis of Dnmt3a2, Dnmt3a1, cFos, Bdnf, Arc, and Ptgs2 expression in the dorsal spinal cord of adult mice 24 or 48 h after intra-plantar injection of CFA as indicated. n = 6 mice per time point. *p<0.05; **p<0.01; ****p<0.0001 One-way ANOVA, Dunnett’s post hoc test. Graphs represent mean ± SEM. CFA: Complete Freund’s Adjuvant.

Dnmt3a2 expression modulates the induction of gene transcription triggered by inflammatory pain

The observed upregulation of Dnmt3a2 in the dorsal spinal cord following CFA injection (Figure 1) and its known capacity to modulate adaptive processes suggests that Dnmt3a2 might be important for central sensitization. To address this question, we manipulated Dnmt3a2 expression levels using RNA interference by injecting rAAVs into the dorsal spinal cord of adult mice. Stereotaxic injection of rAAVs into the spinal parenchyma is a robust method used successfully by our groups and others to achieve long-lasting, stable gene delivery.^3,29,30 We used rAAV vectors that contain DNA sequences encoding short hairpin RNAs (shRNAs) designed to target mouse Dnmt3a2 mRNA (rAAV-shDnmt3a2) or a control sequence that does not target any gene (rAAV-shControl). Both shRNA sequences were expressed under the control of the U6 promoter (Figure 2(a)). rAAV-shDnmt3a2 and rAAV-shControl additionally contain an expression cassette for GFP under the control of a modified beta actin promoter (Figure 2(a)). The efficacy of rAAV-shDnmt3a2 to decrease specifically Dnmt3a2 expression at both resting conditions and after stimulation has previously been demonstrated in vitro and in vivo.^10,13,14 We confirmed the efficacy of rAAV-shDnmt3a2 to interfere with Dnmt3a2 expression in cultured spinal cord neurons both at resting conditions and after depolarizing stimulation (Figure 2(b)). Three weeks after spinal injection, we detected GFP expression of both rAAVs specifically in the dorsal horn (Figure 2(c)), thus confirming the localization and expression of the injected rAAVs. A recovery period of at least three weeks post-injection was observed in order to ensure that no lingering damage or inflammation might still be present at the time of the analyses.^3,31

OPEN IN VIEWER

Figure 2.

Levels of Dnmt3a2 in the spinal cord dorsal horn are important for the expression of pain-induced genes. (a) Schematic representation of the rAAVs used for in vivo RNA interference-dependent knockdown. (b) QRT-PCR analysis of Dnmt3a2 expression in primary spinal cord neuronal cultures infected with rAAVs carrying a control shRNA sequence (rAAV-shControl) or a Dnmt3a2-specific sequence (rAAV-shDnmt3a2) as indicated at resting or KCl-stimulated conditions. n=4 independent preparations. *p<0.05; ****p<0.0001 two-tailed Student’s t-test. (c) Immunolabeling of transverse spinal cord slices for neuronal (NeuN) marker protein and the nuclear marker Hoechst revealed that GFP fluorescence is detected in the dorsal horn (scale bar = 100 μm). (d-g) QRT-PCR analysis of the expression of the pain-induced genes cFos (d), Bdnf (e), Arc (f) and Ptgs2 (g) in the dorsal spinal cord of mice intra-spinally injected with rAAV-shControl or rAAV-shDnmt3a2 3 h after intra-plantar injection of saline or CFA as indicated. n=6 mice per experimental group. *p<0.05; **p<0.01; one-way ANOVA, Bonferroni’s post hoc test. Graphs represent mean ± SEM. CFA: Complete Freund’s Adjuvant; rAAV: recombinant adeno-associated virus.

We previously found that Dnmt3a2 regulates permissiveness for activity-regulated transcriptional responses.^10,13,14 In this study, we investigated if lowering the expression of Dnmt3a2 would affect the CFA-mediated induction of such genes. Mice were injected with rAAV-shDnmt3a2 or rAAV-shControl in the dorsal spinal cord and, after a recovery and incubation period allowing the RNAi to be effective, CFA was injected in the paw. After 3 h (a time point that allows the detection of CFA-induced expression for all analysed genes), we quickly isolated the dorsal spinal cord L3-L5 segment and evaluated the mRNA levels of cFos, Bdnf and Arc. rAAV-shControl-injected mice displayed, in agreement with what we previously observed (Figure 1), a significant induction of the analysed immediate early genes (Figure 2(d) to (f)). Mice expressing the shRNA targeting Dnmt3a2, however, did not show a significant induction of cFos and Bdnf upon CFA stimulation (Figure 2(d) and (e)). CFA-mediated induction of Arc was not disturbed by rAAV-shDnmt3a2 delivery (Figure 2(f)). Ptgs2 is an activity-regulated gene induced following CFA plantar injection (Figure 1) and a crucial part of the signalling cascade of inflammatory pain.^3,27,28 We observed that in mice intra-spinally injected with rAAV-shDnmt3a2, intra-plantar application of CFA failed to elicit an increase in Ptgs2 levels in the dorsal spinal cord, while control mice showed the expected CFA-mediated induction (Figure 2(g)). Taken together, these data indicate that Dnmt3a2 renders the genome permissive for stimulus-dependent gene transcription. In the spinal cord, it is required for the induction of genes caused by CFA plantar injection and thus involved in the regulated expression of key players in inflammatory pain.

Lowering Dnmt3a2 level in spinal cord dorsal horn neurons does not affect acute nociceptive responses

Since decreasing the expression level of Dnmt3a2 in the dorsal horn blunts the induction of genes associated with inflammatory pain (Figure 2), we next investigated its possible impact on inflammatory nociception using the capsaicin model. This test relies on intra-plantar injection of capsaicin as a peripheral nociceptive stimulus and monitors acute nociceptive behaviour spanning from seconds to minutes. Mice were intra-spinally injected with rAAV-shDnmt3a2 or rAAV-shControl and, after a recovery and incubation period allowing the shRNA to be effective, capsaicin was unilaterally injected in the plantar surface of the hindpaw. Both groups of mice showed similar acute nocifensive behaviours after capsaicin injection (Figure 3). These results indicate that interfering with Dnmt3a2 expression in the spinal cord dorsal horn does not affect the early and acute inflammatory nociceptive behaviour.

OPEN IN VIEWER

Figure 3.

Acute inflammatory pain does not require Dnmt3a2 expression in the spinal cord dorsal horn. Analysis of nocifensive behaviour following intraplantar injection of capsaicin in mice intra-spinally injected with rAAV-shControl or rAAV-shDnmt3a2 as indicated. n = 11 mice per experimental group. n.s.: not significant; two-tailed Student’s t-test. Graphs represent mean ± SEM.

Persistent inflammatory pain is modulated by Dnmt3a2 expression

We next analysed the behavioural responses of mice to intra-plantar injection of CFA. Mice were injected in the dorsal spinal cord with either rAAV-shDnmt3a2 or rAAV-shControl followed, after an incubation period to allow for efficient virus expression, by a unilateral injection of CFA in the hindpaw. Assessments of thermal sensitivity revealed that both groups of mice displayed similar initial responses to heat indicating that Dnmt3a2 expression is not necessary for basal nociception (Figure 4(a)). Long-lasting thermal hyperalgesia developed normally in both groups of mice (Figure 4(a)). However, significant differences between the two groups started to be evident at 48 h post-CFA injection and lasted up to 10 days (Figure 4(a)). Mice with decreased expression of Dnmt3a2 displayed increased response latency times to thermal stimulation that is indicative of diminished thermal hyperalgesia (Figure 4(a)). The contralateral paw, which did not receive CFA injection, showed no development of thermal hyperalgesia and no differences between groups of mice (Figure 4(b)).

OPEN IN VIEWER

Figure 4.

Thermal inflammatory hypersensitivity is attenuated if Dnmt3a2 expression levels are reduced. Analysis of latency of the ipsilateral (a) or contralateral (b) paw withdrawal to infrared heat following intra-plantar CFA injection at the indicated time points in mice intra-spinally injected with rAAV-shControl or rAAV-shDnmt3a2 as indicated. n=11–12 mice per experimental group. *p<0.05; ***p<0.001; ^###p<0.001; two-way ANOVA with repeated measures, Dunnett’s post hoc test for comparisons to basal values multiple t-tests for comparisons between rAAV-shControl and rAAV-shDnmt3a2 were used. Graphs represent mean ± SEM. Asterisks (*) refer to statistical comparisons between rAAV-shControl and rAAV-shDnmt3a2 and hashtags (#) to comparisons relative to basal values. CFA: Complete Freund’s Adjuvant; rAAV: recombinant adeno-associated virus.

To monitor mechanical sensitivity, von Frey hairs were applied to the plantar surface. To summarize all responses to the different graded von Frey hairs, we calculated the sum of all responses to the different stimuli at a given time. Both groups of mice, rAAV-shControl-injected or injected with rAAV-shDnmt3a2, developed long-lasting mechanical hypersensitivity following CFA plantar application (Figure 5(a)). However, mice with decreased Dnmt3a2 expression had significantly lower total response frequencies to the different force filaments (Figure 5(a)). Analyses of the frequencies of paw withdrawal in response to application of the 0.07 g force von Frey filament indicate that decreasing the expression of Dnmt3a2 in the dorsal horn of mice results in reduced mechanical hypersensitivity in comparison to control mice (Figure 5(c)). Similar to what we observed for thermal sensitivity (Figure 4(a)), basal mechanical sensitivity did not differ between shDnmt3a2 and shControl for all forces tested (Figure 5(d)), further supporting the idea that the expression of this particular DNMT is not essential for basal nociception. The contralateral paws, which did not receive any inflammatory stimuli, did not show any differences over time and between experimental groups in the mechanical responses to any of the tested filaments (Figure 5(b)). Taken together, these results indicate that expression of Dnmt3a2 in dorsal horn neurons is required for the development of thermal and mechanical inflammatory hypersensitivity but is not needed for basal nociception.

OPEN IN VIEWER

Figure 5.

Mechanical inflammatory hypersensitivity is modulated by Dnmt3a2 expression. Sum of the response frequencies of the ipsilateral (a) or contralateral (b) paw to von Frey filaments (0.07–1 g) following CFA intra-plantar injection at the indicated time points in mice intra-spinally injected with rAAV-shControl or rAAV-shDnmt3a2 as indicated. (c) Analysis of mechanical inflammatory sensitivity following hindpaw CFA injection in mice intra-spinally injected with rAAV-shControl or rAAV-shDnmt3a2 as indicated. The graph shows the frequency of paw withdrawal after stimulation with the 0.07 g von Frey filament. (d) Analysis of basal mechanical sensitivity to von Frey filaments of increasing force. n=11–12 mice per experimental group. *p<0.05; **p<0.01; ***p<0.001; ^###p<0.0001; two-way ANOVA with repeated measures, Dunnett’s post hoc test for comparisons to basal values; multiple t-tests for comparisons between rAAV-shControl and rAAV-shDnmt3a2 were used. Graphs represent mean ± SEM. Asterisks (*) refer to statistical comparisons between rAAV-shControl and rAAV-shDnmt3a2, hashtags (#) to comparisons relative to basal values. CFA: Complete Freund’s Adjuvant; rAAV: recombinant adeno-associated virus.