Evaluating strawberry resistance and the early transcriptional responses of cinnamyl alcohol dehydrogenase genes to three pathogens

Collection of strawberry pathogens

Diseased strawberry plants were sampled in China and the prevailing causal agents including two species of fungi and one species of bacterium from crown parts were used in this work (Table 1). C. siamense strain GQH140 (CGMCC3.33997) and F. oxysporum f.sp. fragariae strain XueSH06 (CGMCC3.40050) were isolated from strawberry cv. Shenyi and cv. Zijinxiangxue, respectively. X. fragariae strain W2R from cv. Akihime was generously provided by Prof. Bo Zhu of Shanghai Jiao Tong University. Molecular identification of these pathogens was performed by PCR with specific primers listed in Table 2. Crude extract of fungal DNA for PCR template was obtained from fresh hypha in TE buffer (B548106-0500, Sangon Biotech Co. Ltd, Shanghai, China) via centrifugation at 5000 rpm for 30 s. ⁵⁹ Bacterium culture was directly diluted in water and used as PCR template. PCR products were sequenced (BioSune Biotech Co. Ltd, Shanghai, China) and further validated via BLASTN analysis at NCBI (identity threshold, ≥98%).

OPEN IN VIEWER

Table 1.

Detailed information for strawberry pathogens in this work.

Species	Strain	Host	Collection site	Collection time	Identifier	Referencea
Colletotrichum siamense	GQH140 (CGMCC3. 33997)	Crown (cv. Shenyi)	Jiading, Shanghai	2022.9	Ke Duan	Li 2024 60
Fusarium oxysporum f.sp. fragariae	XueSH06 (CGMCC3.40050)	Crown (cv. Zijinxiangxue)	Kunming, Yunnan	2025.7	Xue Li	First reported
	,
Xanthomonas fragariae	W2R	Crown (cv. Akihime)	Pudong, Shanghai	2024.4	Peihong Wang	Wang et al. 2025 61

^a

Genome resource of C. siamense strain CGMCC3.33997 had been reported. ⁶⁰ XueSH06 was featured with DNA barcodes C_AA159910.1 to C_AA159912.1.

OPEN IN VIEWER

Table 2.

Primers for identifying strawberry pathogens.

Gene	Primer sequences (5'-3’)	Amplicon (bp)	Target (s) and reference (s)
ITS	F: TCCGTAGGTGAACCTGCGGR: TCCTCCGCTTATTGATATGC	577(Cs)/ 546(Fof)	Fungi 62
CAL	F: GAATTCAAGGAGGCCTTCTCR: CTTCTGCATCATGAGCTGGAC	776(Cs)/ 757(Fof)	Fungi 63
EF1α	F: GTAAGGAGGASAAGACTCACCR: AGGAACCCTTDCCGAGCTC	604	C. siamense 64
CGSC	F: CTAGGCTCYTCCGTYGTCATCGTGACR: TGCATACTTSTCAAACGCCCATTCA	3018	C. siamense 65
RPB2	F: GGGGWGAYCAGAAGAAGGCR: CCCATRGCTTGYTTRCCCAT	1011	F. oxysporum 64,66
FoFra	F: CAGACTGGGGTGCTTAAAGTTR: AACCGCTAGGGTCGTAACAAA	239	F. oxysporum f.sp. fragariae 67
Bacter16S	F: ACTCCTACGGGAGGCAGCAR: GGACTACHVGGGTWTCTAAT	470	Bacteria. Forward 68 , Reverse 69
XfoG4	F: ACATCAACCGCAGACCTGTCATTGR: TGGCTGTTGCTGGCAAGAACC	99	X. fragariae 61

Plant materials and growth conditions

The woodland strawberry ‘Hawaii4’ (F. vesca) and commercial strawberry (F. × ananassa) varieties ‘Benihoppe’ (HY) and ‘Shenyi’ (SY) were assessed in this work. Young stolon-derived seedlings collected from nursery or greenhouse were cultivated in pots filled with mixed substrate containing moss peat and perlite (of 3:1 v/v). These plants were grown in a greenhouse at 24 ± 2°C under a 12h-dark/ 12h-light rhythm for one and a half months. Uniform healthy plants with 4–5 fully expanded leaves were moved to a growth chamber (GZX-1000; Jiangnan Brand, Ningbo, China) under similar conditions two weeks before inoculation. Five plants per strawberry variety were used for pathogen inoculation or mock treatment in one independent experiment.

To evaluate strawberry resistance, inoculation experiment was independently repeated three times per host × pathogen. For the quantitative-PCR (qPCR) analysis of one subclade of strawberry ELI3-like CADs (FvCAD10, −11 and −12)^22,58 to C. siamense infection or whole CAD family members in strawberries, experiments were independently repeated three times.

Preparation of C. siamense inoculum and inoculation

The method for inoculum preparation and whole plant inoculation with C. siamense (Cs) was performed largely as recently reported. ⁷⁰ Ten plants of each variety were equally divided into control (mock) and inoculation groups in one experiment. About 20 ml conidial solution (2 × 10⁶ cfu) with 0.01% Tween-20 was sprayed on one plant. Leaf necrosis symptoms were scored at 4, 7, 14 and 21 days post inoculation (dpi). Leaves with anthracnose lesions were rated in 0, 1, 3, 5, 7 to 9 scales as previously reported. ⁷¹ Disease index (DI, %) was calculated following the same publication.

To analyze the dynamic expression of the ELI3-like representative genes FvCAD10, −11 and −12, one and a half month old Hawaii4 young seedlings were spray-inoculated. The third and forth fully-expanded leaves were sampled at 5 min, 10 min, 15 min, 30 min, 1 h, 2 h post pathogen inoculation or mock treated simultaneously. The experiment was independently performed three times.

For analysis of the expression responses of whole CAD family to Cs, two-month old Hawaii4, cultivar Shenyi and Benihoppe plants were spray-inoculated. The third and fourth fully-expanded leaves were sampled at 30 min and 2 h post Cs inoculation or mock treatment. The experiment was independently performed three times.

Preparation of F. oxysporum f.sp. fragariae inoculum and inoculation

Single-conidia strain of F. oxysporum f.sp. fragariae (Fof) was isolated from crowns as other pathogenic fungi of strawberry. ⁷⁰ The preparation of F. oxysporum inoculum was largely similar with that for C. siamense. Briefly, about 10 pieces of fresh Fof mycelial culture were cut from the margin of 5- or 6-d PDA (Difco Potato Dextrose Agar, Becton, Dickinson Company, USA) plate, transferred to a 250 mL conical flask with 100 mL PDB (Potato Dextrose Broth, BD Company, USA), and incubated in a shaker at 200 rpm in dark for 24 h under 25°C. Conidia were filtered through two-layer lens tissue and diluted with distilled water to expected concentration 1x 10⁶ conidia per mL. ⁷²

Each plant was sprayed with about 20 mL Fof conidial suspension or mock-treated with sterile water, consistently added with 0.01% Tween-20 (v/v). After spray inoculation, plants were maintained under conditions as 25°C, 12 h/12 h light/dark rhythm. Humidity was maintained over 90% for the first three days, and later kept in a range of 70–80%. The incidence of disease was observed from 7 dpi till 19 dpi. Symptoms were recorded and graded on the crown longitudinal section of each plant at 19 dpi following previous report. ⁷³ DI was similarly calculated as for crown rot caused by C. siamense. The experiment was independently performed three times.

Preparation of X. fragariae inoculum and inoculation

The W2R strain of X. fragariae) ⁶¹ was first cultivated on Nutrient Broth (NB) medium (Cat. 022010#, Guangdong Huankai Microbial Sci. & Tech. Co., Ltd，Guangdong, China) plate with 15 g/L agar (Cat. A037#, Caisson Lab Inc., USA) for 3 days under 28°C in dark. Single clone of W2R was then grown in liquid NB medium under 25°C at 200 rpm for 24–48 h. This culture was centrifuged and re-suspended in sterile water to OD₆₀₀ = 0.9 ⁷⁴ with Tween-20 (0.01%, v/v) added. Each plant was sprayed with about 20 mL bacterial suspension or distilled water for mock treatment. After inoculation, plants were maintained under conditions as 25°C, 12 h/12 h light/dark rhythm for disease development. Humidity was maintained over 90% for the first three days, and later kept around 70–80%. Water-soaked lesions on the abaxial surface of each leaflet were observed at 4, 7, 14, 18, 19 and 21 dpi, and scored following the same criteria as for anthracnose leaf lesions. Briefly, the severity of lesions on each leaflet was assessed using the following grades: 0, asymptomatic; 1, lesion cover ≤5%; 3, lesion cover above 5% and ≤10%; 5, lesion cover over 10% and ≤25%; 7, lesion cover over 25% and ≤50%; 9, lesion cover > 50% of leaf area. DI was similarly calculated as for two fungal pathogens. The experiment was independently performed three times.

RNA extraction, rt-PCR and qPCR

The leaf blades of the third or the fourth fully expanded compound leaves collected from 5 plants per strawberry variety × treatment (pathogen or mock) at certain timepoint post inoculation were pooled as a biological replicate. Leaves were wrapped in tin foil and stored immediately at −80°C for RNA purification in one month. RNA was isolated using All-In-One DNA/RNA mini-Preps Kit (Cat. B618203-0050#, Sangon Biotech (Shanghai) Co., Ltd, China). The first strand cDNA was synthesized using the SynScriptⅢ One-Tube RT superMix (+gDNA Remover) kit (Cat. DLR102#, DaLing Bio, Hubei Tsingke, China). Quantitative RT-PCR (qPCR) was performed using the ArtiCan^ATMSYBR qPCR Mix (Cat. DLQ102#, DaLing Bio, Hubei Tsingke, China) in a reaction volume 12 μl in Light Cycler 480 (Roche, USA). qPCR analysis was performed for individual cDNAs using the 2^−ΔΔCT method combined with a geometric mean for normalization of the Ct values of two reference genes EF1a and GAPDH2. ⁷⁵ All primers used were the same as previously reported ⁵⁸ with the exception of those for CAD11 and CAD12. Forward primers specific to CAD11 and CAD12 were TACGGAAGTAGGGAGCAAAG (5’-3’) and GACGGAAGTAGGAAGCAGTG (5’-3’), respectively. Their shared reverse primer was GTCAGAGTAACCGCCATA (5’-3’).

For dynamic expression profiling of ELI3-like CAD genes at 6 timepoints post C. siamense inoculation, three independent biological repeats, each with four technical replicates were studied in qPCR and the relative expression values with similar alteration patterns were used for further analysis. For analysis of the early responses of whole CAD family to distinct pathogens, three independent biological repeats, each with four technical replicates were applied in qPCR and the mean of relative expression values were used. All results were illustrated using GraphPad Prism 10.1.2 software.

Assessing strawberry susceptibility to C. siamense

Fungal pathogens of strawberry were isolated and identified from diseased strawberry samples in whole China. In Colletotrichum spp., the C. siamense strain Cs:GQH140 (deposited under the accession number CGMCC3.33997 in Chinese General Microbiological Culture Collection Center) with high sporulation and moderate pathogenicity under 25°C was selected as a model organism in current lab, with its genome sequenced. ⁶⁰

Cs:GQH140 was isolated from the crown of cv ‘Shenyi’ in the field of Jiading District, Shanghai (Table 1). It forms gray to white colonies characterized by abundant and floccose aerial mycelia with entire margin on PDA plate. The reverse sides of the colonies are gray to black with a few black conidial masses near the inoculum origin and the conidia are long elliptical or cylindrical with bluntly rounded ends (Figure 1(a) to (c)).

OPEN IN VIEWER

Figure 1.

The biological features of Colletotrichum siamense strain GQH140 (CGMCC3.33997) and the disease it caused in three strawberry varieties after non-wound spray inoculation. (a) Mycelial morphology on PDA plate (upper side, Φ = 9 cm). (b) The reverse side of mycelia. (c) The conidia morphology (scale bar, 20μm). (d) Necrotic lesions on the first and second compound leaves of F.×ananassa var. ‘Shenyi’ at 4 d post inoculation (dpi). (e) Leaf lesions in F. vesca var. ‘Hawaii4’ at 4 dpi. (f) Leaf lesions in F.×ananassa var. ‘Benihoppe’ at 4 dpi. (g) Percentage of relative leafblade lesion area and Disease index (%) at 4-, 7-, 14- and 21 dpi.

The relative resistance of three strawberry varieties to Cs:GQH140 was assessed following spray inoculation. The development of necrotic lesions on leaves was recorded. At 4 dpi, small leaf lesions were observed on the first and second compound leaves of all three varieties (Figure 1(d) to (f)), with a relatively higher DI in cv. ‘Benihoppe’. Pathogenesis varied with host variety. ‘Shenyi’ displayed the slowest development of necrosis within the first 14 dpi (Figure 1(g)). By 21 dpi, disease progression accelerated in all three varieties. At all stages recorded, ‘Benihoppe’ had the highest DI being most susceptible, ‘Shenyi’ had the lowest DI being most resistant, and F. vesca ‘Hawaii4’ was moderate susceptible. The relative resistance of three varieties to Cs:GQH140 was also evident in macroscopic symptoms shown in Supplementary Figure S1(b) and (e).

Assessing strawberry susceptibility to F. oxysporum f.sp. fragariae

To study strawberry resistance to Fusarium wilt, the F. oxysporum f.sp. fragariae strain XueSH06 (CGMCC3.40050) isolated from the crown of cultivar ‘Zijingxiangxue’ in Kunming, Yunnan Province was selected for its high sporulation and moderate pathogenicity. Barcode sequences of ITS (Internal transcribed spacer ribosomal DNA), CAL (Calmodulin) and RPB2 (RNA polymerase second largest subunit) for Fof:XueSH06 had been deposited in the GenBase ⁷⁶ in National Genomics Data Center, ⁷⁷ Beijing Institute of Genomics, Chinese Academy of Sciences/China National Center for Bioinformation, under accession numbers C_AA159910.1 to C_AA159912.1 (https://ngdc.cncb.ac.cn/genbase). This Fof strain develops gray to white colony with well-developed aerial mycelium and a regular margin on PDA medium; the reverse side of the colony is gray with a faint purple cycle (Figure 2(a) and (b)). The macroconidia are rod-shaped with tapered ends, while the microconidia are oval (Figure 2(c)).

OPEN IN VIEWER

Figure 2.

The biological features of Fusarium oxysporum f. sp. Fragariae strain XueSH06 and the disease it caused in three strawberry varieties after non-wound spray inoculation. (a) Mycelial morphology on PDA plate (upper side, Φ = 9 cm). (b) The reverse side of mycelia. (c) The conidia morphology (scale bar, 20μm). (d) Mock and Fof-inoculated F.×ananassa var. ‘Shenyi’ with necrosis and coloration on the longitudinal section of crown parts at 19 dpi. (e) Mock and Fof-inoculated var. ‘Benihoppe’ with longitudinal crown sections at 19 dpi. (f) Mock and Fof-inoculated F. vesca var. ‘Hawaii4’ with longitudinal crown sections at 19 dpi. (g) Percentage of relative crown longitudinal section lesion area and Disease index (%) at 19 dpi.

The susceptibility of three strawberry varieties was assessed following leaf spray inoculation of Fof:XueSH06 conidia. No wilt symptom was perceived directly on any of three varieties during 18 days post inoculation, although a light decoloration observed in Hawaii4 leaves (Supplementary Figure S1(d)). At 19 dpi, strawberry crowns were examined via longitudinal sectioning. As shown in Figure 2(d) to (f), reddish-brown lesions were observed in the crown of all three varieties. The lower part of crown was rot in cultivar ‘Shenyi’ and ‘Benihoppe’, which indicated that Fof colonized commercial cultivars from root upward, meeting with the general character of a soilborne and vascular pathogen. But in F. vesca ‘Hawaii4’, lesions occurred in the upper part of crowns, which might result from a direct contact between the inoculum and the upper crown tissues, thus effectively bypassing the natural root barriers. According to grading the relative crown rot area (Figure 2(g)), the DI of ‘Shenyi’ at 19 dpi was the lowest and relatively more resistant than cv. ‘Benihoppe’ and diploid ‘Hawaii4’. As compared with cultivated strawberries, ‘Hawaii4’ had thinner crowns and displayed relatively the weakest resistance to Fof in sheltered and moist environments.

Assessing strawberry susceptibility to X. fragariae

To assess strawberry resistance to the bacterial disease ALS, X. fragariae strain W2R isolated from the crown of cultivar ‘Akihime’ in the field of Pudong New District, Shanghai (Table 1) was used. The yellow colonies on NB agar are circular with smooth, well-defined margins. They appear opaque with a raised center. The colony surface is smooth, glistening, and mucoid in consistency (Figure 3(a) and (b)). This strain grows better in NB medium than in liquid R2A medium (Figure 3(c)).

OPEN IN VIEWER

Figure 3.

The biological features of Xanthomonas fragariae strain W2R and the disease it caused in three strawberry varieties after non-wound spray inoculation. (a) Clonal morphology of Xf: W2R on NB plate (upper side, Φ = 9 cm). (b) The reverse side of Xf: W2R clones. (c) The liquid culture of Xf: W2R in NB and R2A media. (d) and (g) The water-soaked lesions on the abaxial surface of leaflets in F.×ananassa var. ‘Benihoppe’ at 4 dpi and 19 dpi, respectively. (e) and (h) Leaf lesions in F.×ananassa var. ‘Shenyi’ at 7 dpi and 19 dpi, respectively. (f) and (i) Leaf lesions in F. vesca var. ‘Hawaii4’ at 7 dpi and 19 dpi, respectively. (g) Percentage of relative leafblade lesion area and Disease index (%) at 4-, 7-, 14- and 21 dpi.

Following inoculation with X. fragariae, pathogenesis was monitored by the occurrence of irregular water-soaked lesions on the abaxial surfaces of leaves viewed with transmitted light. No lesions were observed on the upper surface of the leaves within 18 days post inoculation. The lesion on leaf abaxial surface was easily observed in cv. ‘Benihoppe’ at 4 dpi and in F. vesca ‘Hawaii4’ at 7 dpi (Figure 3(d) to (f)). Bacterial ooze was observed following the water-soaked lesions coalesced and expanded like translucent necrotic patches in cv, Benihoppe and F. vesca Hawaii4 (Figure 3(g) to (i)). ‘Hawaii 4’ exhibited the most severe disease symptoms than two cultivated varieties (Figure 3(j)). In cv. ‘Shenyi’, lesion was obvious at 7 dpi, but no bacterial ooze was observed by 14 dpi, although plant death also was observed (Supplementary Figure S1(c) and (f)). Regarding disease indices recorded by 14 dpi, cv. ‘Shenyi’ was more resistant than cv. ‘Benihoppe’, but disease progressed more sharply in ‘Shenyi’ than in ‘Benihoppe’ at 21 dpi.

Expression profiling of ELI3-like CADs upon C. siamense infection

To answer how fast strawberry CADs can respond to biotic stress, dynamic changes in the relative expression of CAD genes were monitored from 5 min to 2 h post inoculation with C. siamense in F. vesca ‘Hawaii4’. It's worth noting that ELI3-like representative CADs tested were highly sensitive (Figure 4). Transient down-regulation was observed for all CADs examined just at 5 min post inoculation with C. siamense. That immediate suppression lasted till 10 min for CAD10 and −12 transcripts. Furthermore, all three genes were up-regulated at 30 min post inoculation, followed by a rapid decrease in relative expression. Accordingly, 30 min and 2 h post inoculation were chosen as time nodes for further analysis of whole CAD family.

OPEN IN VIEWER

Figure 4.

Quantitative RT-PCR analysis of the dynamic expression of ELI3-like genes FvCAD10, −11 and −12 in F. vesca var. ‘Hawaii 4’ post inoculation with C. siamense. The amount of the cDNA templates in each sample was normalized against two reference genes GAPDH2 and EF1α. ⁷⁵ Relative expression of CADs was calculated relative to the ‘Mock’ control at each specific time-point. Three independent biological repeats, each with four technical replicates were analyzed and the mean of similar results were shown.

Transcriptional responses of CAD family to three pathogens

Early expression responses of strawberry CAD family were investigated in three varieties with varying resistance to three pathogens. The quality of cDNAs was assessed via RT-PCR using GAPDH and EF1α as internal controls. All 72 except for 2 (‘Hawaii4’ sampled at 30 min post inoculation with Fof in the second repeat and ‘Benihoppe’ (HY) sampled at 30 min post mock treatment in the third repeat) cDNA samples were of high quality (Supplementary Figure S2). To screen CAD family members for qRT-PCR analysis, 12 cDNAs for each strawberry variety (3 independent replicates×2 time nodes×2 treats (mock and Cs/Fof/Xf)) were pooled, resulting in 9 mixtures (3 hosts × 3 pathogens). Semi-RT-PCR selected a total of eight genes detectable belonging to all three subfamilies ⁵⁸ (CAD2, −3, −4, −9, −10, −11, −12, and −13) (Supplementary Figure S3) for further qPCR analysis with individual biological replicates (Figure 5).

OPEN IN VIEWER

Figure 5.

Quantitative RT-PCR analysis of eight strawberry CAD genes during early responses to distinct pathogens. Three strawberry varieties including F. vesca var. ‘Hawaii 4’, commercial cultivars ‘Shenyi’ and ‘Benihoppe’ were tested upon infection with three pathogens. Relative expression of CADs was calculated relative to the ‘Mock’ control at each specific time-point. Three independent biological repeats, each with four technical replicates were analyzed and the mean of similar results were shown. Mock for water treatment; Cs for C. siamense inoculation; Fof for F. oxysporum f. sp. Fragariae; Xf for Xanthomonas fragariae.

In ‘Hawaii4’, at least six CADs were quickly activated at 30 min post pathogen inoculation: CAD4, −11 and −13 were up-regulated by all three pathogens, and the rest three members CAD9, −10 and −12 were up-regulated by Fof and Xf. At 2 hpi, CAD3 was also up-regulated by Fof and Xf, while CAD2 was down-regulated by three pathogens.

As compared with that in F. vesca Hawaii4, fewer CADs were activated in the cultivated variety ‘Shenyi’. CAD13 was up-regulated by three pathogens at 30 min post inoculation; CAD4 was up-regulated by three pathogens at 2hpi; CAD9 was specifically induced at 2hpi by Xf. On the other hand, CAD2 was consistently down-regulated at 30 min post inoculation with three pathogens, and CAD11 and −12 were clearly down-regulated at 2 h post inoculation with three pathogens.

Differently, in ‘Benihoppe’, CAD3, −4, and −9 were uniformly induced at 2 hpi upon three pathogens infection. CAD4 also was up-regulated by Fof and Xf at 30 min. CAD10 was induced by the same two pathogens at 2hpi. At 30 min post inoculation, CAD3 and CAD12 were specifically induced by Xf and Cs, respectively. Also, CAD2 was induced by Cs at 2 hpi. In general, the early expression responses of CAD family were diversified in three strawberry varieties, and more members were markedly provoked in the susceptible cultivar ‘Benihoppe’.

Finally, the expression profiles of CAD family in strawberry early responses to distinct pathogens were summarized (Figure 6). Those genes with two folds or more changes in transcript levels upon pathogen infection were marked differentially. The alteration patterns in transcription levels of CADs were nearly identical in cv. ‘Shenyi’ threatened by Cs and Fof. Most changes in CADs expression were similar in ‘Shenyi’ exposed to Fof and Xf. In F. vesca ‘Hawaii4’, the expression profiles of CAD family members were largely similar when threatened by Fof and Xf. Noticeably, if altered, CAD4 and −9 were consistently up-regulated upon three biotic stresses in all strawberry varieties, while CAD2 was always down-regulated with the exception of at 2 h post exposure to Cs in cv. Benihoppe. In sum, the expression profiles of CAD family in strawberry early defense responses were largely host genotype-specific, but not pathogen-specific.

OPEN IN VIEWER

Figure 6.

Simplified cartoon overview of the early responses of CAD genes in strawberry leaves upon inoculation with distinct pathogens. Each square represents the expression level of a specific CAD gene relative to mock treatment in a strawberry variety at a given timepoint post inoculation. Scarlet squares, relative expression levels greater than 2; olive-green, less than 0.5; white, between 0.5 and 2 or data omitted.