Increased New lncRNA–mRNA Gene Pair Levels in Human Cumulus Cells Correlate With Oocyte Maturation and Embryo Development

Abstract

The close relationship between cumulus cells and oocyte indicates that the analysis of cumulus gene expression is a potential noninvasive method to aid embryo selection and in vitro fertilization outcome. Long noncoding RNAs (LncRNAs) could regulate essential pathways that contribute to human oocyte maturation, fertilization, and embryo development, which indicates that lncRNA would be valuable biomarkers. In our previous study, AK124742 is a newly detected lncRNA that was identified as being natural antisense to PSMD6, but its role in oocyte and embryo development is still not elucidated and needs to be investigated. Here, the expression of AK124742 and PSMD6 was measured in 40 pairs of cumulus cells from oocytes that result in high-quality embryos (HCCs) and from oocytes that result in poor-quality embryos (PCCs) by real-time quantitative reverse transcriptase polymerase chain reaction. The predictive value of AK124742 and PSMD6 was evaluated using a receiver–operating characteristic (ROC) curve. Notably, elevated expression levels of AK124742 and PSMD6 were observed in HCCs compared to PCCs (72.5% and 62.5%, respectively; P < .01). Expression of AK124742 was potentially positively associated with the PSMD6 levels. The relative expression levels of AK124742 and PSMD6 in the pregnancy group were significantly higher than those in the nonpregnancy group (P < .01).The area under the ROC curve of AK124742 was 0.78 (95% confidence interval: 0.64-0.93). In conclusion, AK124742 and PSMD6 as a new lncRNA–messenger RNA gene pair in human cumulus cells may be considered as potential biomarkers to aid embryo selection.

Keywords

cumulus cells lncRNA AK124742 PSMD6 embryo developmental potential

Introduction

Single-embryo transfers (SETs) are increasingly used in assisted reproductive technology (ART) in order to avoid multiple pregnancies. When performing SET, more criteria to select the embryo with the highest implantation potential are necessary to improve the pregnancy chance per cycle. To date, the only main tool for selecting embryos for transfer is visual morphological assessment, which often does not accurately predict the health of the embryo. Each oocyte is surrounded by several layers of cumulus cells (CCs) that play an important role as mediators of oocyte paracrine signals and developmental potential, providing nutrients, maturation-enabling factors, and an optimal microenvironment for the oocytes to ensure successful maturation and further developmental competence.^1

–4 The close relationship between CCs and oocyte indicates that analysis of gene expression of cumulus is a potential noninvasive method to aid embryo selection.^5

–8

Long noncoding RNAs (lncRNA) are a significant new class of transcripts that are longer than 200 nucleotides and do not function as templates for protein synthesis.⁹ They account for the majority of the transcripts in mammalian genome and were first revealed following the large-scale sequencing of a full-length complementary DNA (cDNA) library in mouse.^10,11 Emerging evidences demonstrate that lncRNAs have multiple biological functions widely involved in the regulation of gene expression network, such as chromosome imprinting, cell growth, and tumorigenesis.^12

–15

The interdependency between cumulus cells and oocyte is a set of complex 2-way signaling system involving multiple changes in gene expression.^2,16 In the past, researchers have mainly been focused on protein-coding genes.^17,18 Recently, Yerushalmi et al showed that 1746 differentially expressed genes between compact and expanded CCs using global transcriptome sequencing and first found that lncRNAs may contribute to the regulation of cumulus expansion and oocyte maturation.¹⁹ In our previous study, we conducted a genome-wide screen of expression of lncRNAs and coding RNAs in CCs from oocytes that result in high-quality embryo (HCCs) and from oocytes that result in poor-quality embryos (PCCs). We identified differentially expressed lncRNAs that are colocated and coexpressed with differentially expressed coding RNAs in PCCs, and the results point to a potential interaction between lncRNAs and neighboring coding genes, and the interaction may contribute to the oocyte maturation and embryo development. Here, with bioinformatics analysis, we found a novel lncRNA–AK124742, which is situated at chromosome 3p14 and transcribed in complex loci with natural antisense patterns relative to adjacent protein-coding gene PSMD6. Previous study showed that upregulation of PSMD6 in CCs and granulosa cells are associated with embryo competence and pregnancy.⁵ Furthermore, studies have reported that antisense lncRNA can regulate the expression of neighboring messenger RNA (mRNA) genes.^20,21 Considering the predictive value of PSMD6, we speculated AK124742 may be functionally involved in oocyte maturation and embryo development.

In this study, we reported the expression patterns of AK124742 and PSMD6 in HCCs and PCCs and analyzed the correlation between gene expressions for the first time. Then, we evaluated the predictive value of the AK124742 and PSMD6 in CCs for predicting pregnancy outcome. In all, this study was to offer a new functional lncRNA–mRNA pair in the cumulus that contribute to the processes of oocyte and early embryo development and may be considered as new biomarker to aid embryo selection.

Material and Method

Patient Selection

This study was reviewed and approved by the Ethics Committee of Anhui Medical University (NO.2013009). Written consents for the use of cumulus cells for research was obtained from 40 normoresponder patients who started their first in vitro fertilization (IVF) cycle for female Tubal factor at the reproductive medicine center of the First Affiliated Hospital of Anhui Medical University. Patients with clinical indications of polycystic ovary syndrome were not included in this study.

Ovarian Stimulation Protocol

The patients were stimulated using a long downregulation protocol by administration of GnRH antagonist (1.25mg, Ipsen Pharma Biotech, Paris, France) combined with recombinant follicle-stimulating hormone (GonalF, 150-300 IU; Merck Serono, Darmstadt, Germany). Follicular monitoring was performed via ovarian ultrasonography and serum estradiol measurements. All patients were administered human chorionic gonadotropin (HCG; 10 000 IU, Northern Pharma In, Rostov-Na-Dony, Russia) 34 to 36 hours before transvaginal oocyte collection under ultrasound guidance. Details of the IVF treatment have been described elsewhere.¹⁷

Collection of CCs

Oocyte–cumulus complexes were aspirated from ovarian follicles 36 hours after administration of HCG. The outer layers of CCs were removed from the oocyte using a micropipette and collected into individual microcentrifuge tubes before insemination and frozen at −80°C. Cumulus cells isolated from 594 oocyte–cumulus complexes (average = 14.9 oocytes per patient, range 7-23) from 40 patients were analyzed. The oocytes were kept individually throughout the culture period, allowing correlation with their respective CCs. Fertilization and subsequent embryo development for each oocyte was recorded 16 to 18 hours and 64 to 66 hours after insemination, respectively. This study excluded CCs from oocytes that were fertilized by the means of intracytoplasmic sperm injection.

Assessment of Embryos

The quality parameters of individually cultured embryo were evaluated on day 2 (42-44 hours postinsemination) and day 3 (66-68 hours postinsemination) according to the number of blastomeres, equal-sized blastomeres, and the degree of fragmentation as specified in the previously reported grading system.²² Embryos on day 3, having ≥7 blastomeres, equally sized blastomeres, and ≤20% fragmentation would be considered good quality; having <7 blastomeres, no equally sized blastomeres, and >20% fragmentation would be considered poor quality.

Pregnancy Outcomes

One or two embryos were transferred on day 3 after oocyte retrieval. Clinical pregnancy was evaluated 2 and 6 weeks after embryo transfer based respectively on serum β-HCG and ultrasound examination (presence of gestational sac with heart beat).

RNA Extraction and cDNA Synthesis

Cumulus cells of each patient were grouped into 2 classes depending on the fate of the oocytes from which they were isolated, those from oocytes that result in HCCs and those from oocytes that result in PCCs. Total RNA from the CCs was extracted using a commercial RNA isolation kit (Total RNA Isolation Kit I, Omega, US, catalogue no. R6834-01). Total RNA was eluted in 30 mL of diethylpyrocarbonate (DEPC) water and stored at −80°C. The concentration and A260–280 ratio were measured by NanoVue Plus (GE Healthcare, Shanghai, China). RNA integrity was assessed using standard denaturing agarose gel electrophoresis.

RNA samples were processed for further analysis only if the absorbance ratio at wavelengths of 260/280 nm was greater than 1.8 and the ratio of 28s–18s ribosomal RNA was greater than 2.0. The cDNA was synthesized from 200 to 400 ng of total RNA using the PrimeScript RT reagent Kit (Takara, Dalian, China), according to the manufacturer’s protocol. All cDNA were stored at −20°C until polymerase chain reaction (PCR) analysis.

Real-Time PCR

Real-time PCR (RT-PCR) was employed to determine the relative expression level of target genes by the SYBR Premix ExTaq II kit (Takara) according to the manufacturer’s instructions on the Applied Biosystems 7300 Fluorescent Quantitative PCR System (Applied Biosystems, Foster City, California). The primers were designed as follows: PSMD6, (Forward) 5′- TCTCATCACACGAAACACAGAA -3′, (Reverse) 5′- GCCACACAATAAAGACCCTGA -3′; AK124742, (Forward) 5′- CCGAATGCCGTAAGTGAGAC -3′, (Reverse) 5′- TTCTGAGGTGTTGTGGAAGG -3′; GAPDH,(Forward) 5′- GGGAAACTGTGGCGTGAT-3′, (Reverse) 5′- GAGTGGGTGTCGCTGTTGA-3′. Glyceraldehyde 3-phosphate dehydrogenase was used to normalize the target gene expression. Briefly, the 20 μL reaction mixtures were incubated at 95°C for 30 seconds, followed by 40 amplification cycles of 95°C for 5 seconds and 60°C for 34 seconds. The comparative cycle threshold (CT) method was applied to quantify relative expression of mRNA and lncRNA. All the experiments were conducted 3 times and the average was determined. The relative expression levels of genes were was represented as fold change using the 2^−ΔΔCt method.

Statistical Analysis

All statistical analyses were performed using SPSS version 18.0 (SPSS Inc, Chicago, Illinois). The 1-sample Kolmogorov-Smirnov test was used to examine the normal distribution of all data. All quantitative variables were expressed as means ± standard deviation (SD). The comparison of RNA levels between the groups were done by t test. Correlation between gene expressions was analyzed using Pearson correlation coefficient. The comparison of relative expression level of gene in the pregnancy group between the nonpregnancy group were done by t test. Receiver–operating characteristic (ROC) curves were constructed to evaluate the predictive value of AK124742 and PSMD6 for predicting pregnancy. A 2-tailed P value of .05 or less was considered statistically significant.

Result

AK124742 and PSMD6 Were Co-Upregulated in HCCs Compared to PCCs

By RT quantitative reverse transcriptase PCR, we examined the expression levels of lncRNA-AK124742 and mRNA-PSMD6 in a total of 40 paired HCCs and PCCs from patients with infertility and found that 29 (72.5%, P < .01) of 40 patients showed significantly higher expression of lncRNA-AK124742 in HCCs compared to the PCCs (Figure 1A), and 25 (62.5%, P < .01) of the 40 patients exhibited remarkably higher expression of mRNA-PSMD6 in HCCs than in PCCs (Figure 1B). Furthermore, the average relative expression levels of AK124742 and PSMD6 in HCCs compared to PCCs were 2.85-fold and 3.05-fold, respectively. In particular, the relative expression of mRNA-PSMD6 was positively correlated with that of lncRNA-AK124742 in CCs (R ² = .606, P < .01; Figure 1C).

Figure 1.

Expression of AK124742 and PSMD6 in 40 paired HCCs and PCCs from patients with infertility. A, The expression level of AK124742 in HCCs was remarkably higher than those in PCCs (P < .01). B, The expression level of PSMD6 in HCCs was also significantly higher than those in PCCs (P < .01). C, Linear regression analysis was performed on expression levels of mRNA-PSMD6 and LncRNA-AK124742 in 40 paired HCCs and PCCs (R ² = .606, P < .01). RNA expression levels are calculated using the Δcycle threshold (ΔCt) method. The ΔCt value is determined by subtracting the GAPDH ΔCt value from the RNA ΔCt value. Larger ΔCt value indicates lower expression. HCC indicates high-quality embryos; LCC, low-quality emryos; mRNA, messenger RNA; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Correlation Between the Expression of AK124742 and PSMD6 and Physiological Parameters

Pearson correlation analysis was used to analyze the correlation between RNA expression and general physiological parameters, including maternal age, basis of sex hormone levels, and body mass index (BMI). We found no relationship between patient’s general physiological parameters and gene expression (data not shown)

Comparison of the Expression Levels of AK124742 and PSMD6 Between the Pregnancy Group and Nonpregnancy Group

For all pregnancy analysis, only the transferred oocytes were considered, and 1 or 2 embryos of all patients were transferred on day 3 after oocyte retrieval (pregnant n = 21; nonpregnant n =19). The relative expression level of AK124742 in the pregnancy group (3.91 ± 2.55) was significantly greater than that in the nonpregnancy group (2.09 ± 1.48; P < .01, F = 3.14, Figure 2A). Also, the PSMD6 mRNA level in the pregnancy group (4.00 ± 1.48) was significantly greater than that in the nonpregnancy group (1.57 ± 0.94; P < .01, F = 3.25; Figure 2B).

Figure 2.

Comparison of the relative expression level of RNA between the pregnancy group and the nonpregnancy group. A, The relative expression of AK124742 in the pregnancy group and the nonpregnancy group. B, The relative expression of PSMD6 in the pregnancy group and the nonpregnancy group.

Predictive value of AK124742 and PSMD6 Levels for Predicting Pregnancy Outcome

The predictive values of AK124742 and PSMD6 for predicting pregnancy outcome were investigated through the construction of ROC curve for relative expression levels of AK124742 and PSMD6 are summarized in Table 1. The area under the curve (AUC) of AK124742 for predicting pregnancy was 0.78 (95% confidence interval [CI]: 0.64-0.93; Figure 3A). The AUC of PSMD6 for predicting pregnancy was 0.88 (95% CI: 0.78-0.98; Figure 3B), suggesting that AK124742 and PSMD6 have potential predictive value in CCs for predicting pregnancy outcome.

Table 1.

Predictive Value of AK124742 and PSMD6 for Predicting Pregnancy.

RNA	AUC	P value	Threshold	Sensitivity	Specificity
AK124742	0.78	<.01	2.40	85.7%	68.4%
PSMD6	0.88	<.01	2.89	71.4%	94.7%

Abbreviation: AUC, area under the receiver–operating characteristic curve.

Figure 3.

ROC curves analysis to analyze the predictive values of AK124742 (A) and PSMD6 (B) in culumus cells. AUC indicates the predictive values of the relative expression levels of AK124742 and PSMD6 in HCCs compared with PCCs. HCC indicates high-quality embryos; LCC, low-quality emryos; AUC, area under the ROC curve; ROC, receiver–operating characteristic.

Discussion

Selecting embryos with higher implantation potential has been one of the major challenges in ART. To date, noninvasive embryo selection has been based mainly on morphological assessment. However, morphological evaluation is often inadequate to identify the oocyte quality and embryo development competence.²³ Bidirectional communication exists between oocytes, and the surrounding CCs are critical for both oocyte and CCs competence acquisition.²⁴ In this respect, the analysis of CCs gene expression, in conjunction with morphological criteria, is an appropriate approach for selecting oocytes for fertilization or embryos for replacement.

The interdependency between CCs and oocyte is a set of complex 2-way signaling system involving multiple changes in gene expression.^2,16 Previous studies mainly focused on protein-coding genes in CCs. Recently, advances in high-throughput sequencing has helped help us to obtain a global profile of gene expression in human CCs and to correlate the gene expression patterns with the developmental status of the oocytes enclosed by these CCs. Numerous new lncRNA molecules have been proved to play significant roles in cumulus-oocyte complex (COC) maturation and cumulus expansion.¹⁹ In our previous study, we conducted a genome-wide screening of the expression of lncRNAs and coding RNAs in HCCs and PCCs. However, the expression and functional roles of most lncRNAs are still unknown in CCs.

Emerging evidences have demonstrated that PSMD6 mRNA was upexpressed in CCs, and granulosa cells are associated with embryo competence and pregnancy.⁵ In this study, we found a new lncRNA AK124742 that was identified as being antisense to PSMD6 through bioinformatics analysis. The lncRNAs do not encode any proteins but are involved in a variety of biological functions; they are transcribed in complex loci where there are overlapping and antisense patterns are relative to adjacent protein-coding genes.^25,26 Current evidence has shown a variety of regulatory roles for cis-antisense lncRNAs, such as reprogramming of chromatin, RNA interference, alternative splicing, genomic imprinting, and X-chromosome inactivation.^27,28 So, we speculated that lncRNA AK124742 and mRNA PSMD6 may constitute a new functional lncRNA–mRNA gene pair.

In this study, it is shown for the first time that the expression of both AK124742 and PSMD6 (lncRNA–mRNA gene pair) was identified to be frequently upregulated in HCCs compared to PCCs. Linear regression analysis revealed that a positive correlation between expression of AK124742 and PSMD6 exists in human CCs. It indicates that AK124742 may regulate the expression of PSMD6 by some specific mechanisms, which need further researches to be elucidated completely.

Furthermore, poor morphology assessment of an embryo could be due to multiple factors, including sperm quality and the maturity of the oocyte. Here, the possibility of poor sperm quality was eliminated because these patients were referred to our center for IVF for female tubal factor excluding male factor. Accordingly, embryo quality is closely related to oocyte qualities such as oocyte maturation and spindle structure.²⁹ Hill et al also confirmed that poor-quality oocytes often have a lower chance of developing into HCCs.³⁰ Our results indicated that the expression of both AK124742 and PSMD6 was identified to be frequently upregulated in HCCs compared to PCCs, and there was a statistically significant difference. Accordingly, patients with a higher expression of AK124742 and PSMD6 in culumus cells were positively related to oocyte maturation, fertilization, and embryo development.

Although maternal age, BMI, and basic hormone levels are important factors that may affect the ovarian response and pregnancy outcome of ART, we found no direct relationship between general physiological parameters of the patient and the expression of AK124742 and PSMD6.

Clinical pregnancy is an important indicator for evaluating embryo quality. Although the pregnancy outcome is determined by several factors, the oocyte is the most important factor for clinical outcome. A high-quality oocyte more easily develops into a HCC; accordingly, the chance of clinical pregnancy is also increased. This study confirmed that the relative expression level of AK124742 and PSMD6 in the pregnancy group was significantly greater than that in the nonpregnancy group, suggesting that the relative expression of the AK124742 and PSMD6 may be used as an indicator to predict competence to establish a pregnancy. An ROC curve was constructed to evaluate the predictive value of relative expression levels of AK124742 and PSMD6. The results demonstrated that the AUC was 0.78 and 0.88, respectively. These results suggest that AK124742 and PSMD6 may play crucial roles during embryo development and establish a pregnancy.

In conclusion, the expression of AK124742 and PSMD6 was significantly correlated with oocyte maturation, fertilization, embryo quality, and clinical pregnancy outcome. Thus, AK124742 and PSMD6, as a new lncRNA–mRNA gene pair, are both novel upregulated functional molecules in CCs and may be considered as new potential biomarkers to aid embryo selection.

Footnotes

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

Scott

. The biological basis of non-invasive strategies for selection of human oocytes and embryos. Hum Reprod Update. 2003;9 (3):237–249.

Sugiura

Eppig

. Mouse oocyte control of granulosa cell development and function: paracrine regulation of cumulus cell metabolism. Semin Reprod Med. 2009;27 (1):32–42.

Richards

Pangas

. The ovary: basic biology and clinical implications. J Clin Invest. 2010;120 (4):963–972.

Uyar

Torrealday

Seli

. Cumulus and granulosa cell markers of oocyte and embryo quality. Fertil Steril. 2013;99:979–997.

Assidi

Montag

Van Der Ven

Sirard

. Biomarkers of human oocyte developmental competence expressed in cumulus cells before ICSI: a preliminary study. J Assist Reprod Genet. 2011;28 (2):173–188.

Sirard

. Follicle environment and quality of in vitro matured oocytes. J Assist Reprod Genet. 2011;28 (6):483–488.

Stouffer

Muller

. Dynamics of the transcriptome in the primate ovulatory follicle. Mol Hum Reprod. 2011;17 (3):152–165.

Borgbo

Povlsen

Andersen

Borup

Humaidan

Grondahl

. Comparison of gene expression profiles in granulosa and cumulus cells after ovulation induction with either human chorionic gonadotropin or a gonadotropin-releasing hormone agonist trigger. Fertil Steril. 2013;100 (4):994–1001.

Wapinski

Chang

. Long noncoding RNAs and human disease. Trends Cell Biol. 2011;21 (6):354–361.

10.

Kapranov

Cheng

Dike

. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science. 2007;316 (5830):1484–1488.

11.

Okazaki

Furuno

Kasukawa

. Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature. 2002;420 (6915):563–573.

12.

Vance

Sansom

Lee

. The long non-coding RNA Paupar regulates the expression of both local and distal genes. EMBO J. 2014;33 (4):296–311.

13.

Xuan

Liu

. Long non-coding RNAs and complex human diseases. Int J Mol Sci. 2013;14 (9):18790–18808.

14.

Clark

Mattick

. Long noncoding RNAs in cell biology. Semin Cell Dev Biol. 2011;22 (4):366–376.

15.

Wang

Ren

Sun

. Overexpression of the long non-coding RNA MEG3 impairs in vitro glioma cell proliferation. J Cell Biochem. 2012;113 (6):1868–1874.

16.

Matzuk

Burns

Viveiros

Eppig

. Intercellular communication in the mammalian ovary: oocytes carry the conversation. Science. 2002;296 (5576):2178–2180.

17.

Gebhardt

Feil

Dunning

Lane

Russell

. Human cumulus cell gene expression as a biomarker of pregnancy outcome after single embryo transfer. Fertil Steril. 2011;96 (1):47–52. e2.

18.

Cillo

Brevini

Antonini

Paffoni

Ragni

Gandolfi

Association between human oocyte developmental competence and expression levels of some cumulus genes. Reproduction. 2007;134 (5):645–650.

19.

Yerushalmi

Salmon-Divon

Yung

. Characterization of the human cumulus cell transcriptome during final follicular maturation and ovulation. Mol Hum Reprod. 2014;20 (8):719–735.

20.

Cao

Shi

. Integrated analysis of long noncoding RNA and coding RNA expression in esophageal squamous cell carcinoma. Int J Genomics. 2013;2013:480534.

21.

Pandey

Mondal

Mohammad

. Kcnq1ot1 antisense noncoding RNA mediates lineage-specific transcriptional silencing through chromatin-level regulation. Mol Cell. 2008;32 (2):232–246.

22.

Veeck

LL.

An Atlas of Human Gametes and Conceptuses: An Illustrated Reference of Assisted Reproductive Technology. Boca Raton, Florida: CRC Press; 1999.

23.

Assou

Haouzi

De Vos

Hamamah

. Human cumulus cells as biomarkers for embryo and pregnancy outcomes. Mol Hum Reprod. 2010;16 (8):531–538.

24.

Ouandaogo

Frydman

Hesters

. Differences in transcriptomic profiles of human cumulus cells isolated from oocytes at GV, MI and MII stages after in vivo and in vitro oocyte maturation. Hum Reprod. 2012;27 (8):2438–2447.

25.

Mercer

Dinger

Sunkin

Mehler

Mattick

. Specific expression of long noncoding RNAs in the mouse brain. Proc Natl Acad Sci U S A. 2008;105 (2):716–721.

26.

Pang

Dinger

Mercer

. Genome-wide identification of long noncoding RNAs in CD8+ T cells. J Immunol. 2009;182 (12):7738–7748.

27.

Gupta

Shah

Wang

. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 2010;464 (7291):1071–1076.

28.

Ogawa

Sun

Lee

. Intersection of the RNA interference and X-inactivation pathways. Science. 2008;320 (5881):1336–1341.

29.

Watson

. Oocyte cytoplasmic maturation: a key mediator of oocyte and embryo developmental competence. J Anim Sci. 2007;85 (13 suppl):E1–E3.

30.

Hill

Freeman

Bastias

. The influence of oocyte maturity and embryo quality on pregnancy rate in a program for in vitro fertilization-embryo transfer. Fertil Steril. 1989;52 (5):801–806.