Evaluation of Glycyrrhizin on MCF 7 Breast Cancer Cells: A Molecular and Pharmacological Analysis

Introduction

Breast cancer remains one of the most frequently diagnosed malignancies worldwide, with approximately one in eight women at risk of developing invasive disease during their lifetime. ¹ In 2022, an estimated 2.3 million new cases were reported globally, accounting for nearly 666,000 deaths. ² Although historically more prevalent in industrialized nations, the incidence has increased substantially in developing countries, including Pakistan, which reported 34,038 new cases in 2012 and the highest breast cancer–related mortality rate (25.2%) among Asian countries. ³ These trends emphasize the growing global burden of breast cancer and the urgent need for more effective therapeutic and preventive strategies. ⁴

Breast cancer is a multifactorial disease resulting from complex interactions among genetic, hormonal, and environmental factors. ⁵ Recent evidence suggests that endocrine regulators beyond estrogen may contribute to breast tumorigenesis. Elevated levels of thyroid hormones, particularly fT3 and fT4, have been associated with increased breast cancer risk, especially in HER2-positive tumors. ⁶

At the molecular level, breast cancer progression is driven by dysregulated gene expression involving proto-oncogenes and tumor suppressor genes that promote uncontrolled proliferation, resistance to apoptosis, invasion, and metastasis.^7,8 Recent genomic studies have identified additional breast cancer susceptibility genes beyond BRCA1/BRCA2, including CHEK2, PALB2, and TP53, expanding the genetic landscape of breast cancer risk. ⁹

Environmental factors may also influence tumorigenesis. Persistent pollutants such as polychlorinated biphenyls (PCBs) have been implicated in endocrine disruption and breast cancer development through modulation of oncogenic pathways including PI3K-Akt, MAPK, and HIF-1, involving genes such as BRCA1, AKT1, EGF, and IL6. ¹⁰

Diagnosis typically relies on clinical evaluation supported by imaging and histopathology. ¹¹ Recent advances in artificial intelligence–assisted imaging have improved breast cancer diagnosis and treatment planning. Deep learning models analyzing tumor and axillary lymph node ultrasound images can accurately predict pathological response after neoadjuvant therapy, potentially reducing unnecessary axillary surgery. ¹²

Standard treatment strategies include surgery, chemotherapy, radiotherapy, and targeted therapies such as endocrine therapy for hormone receptor–positive disease. ¹³

Tamoxifen, a selective estrogen receptor modulator, has long been a cornerstone therapy for hormone-responsive breast cancer; however, prolonged treatment frequently leads to drug resistance. ¹⁴ Similarly, Aromatase inhibitor therapy in ER+/HER2+ tumors can induce early molecular responses, including reduced Ki67 proliferation and shifts from Luminal B to Luminal A subtype, which are associated with improved outcomes. ¹⁵

Dysregulated cell-cycle control is a hallmark of cancer. CDK4/6 inhibitors targeting the G1–S transition are effective in HR-positive/HER2-negative breast cancer, but resistance can arise through activation of MAPK/PI3K-AKT pathways and mutations such as NF1 that disrupt RAS signaling. ¹⁶

In addition to resistance, tamoxifen therapy has been associated with adverse effects including endometrial hyperplasia, thromboembolic complications, and hepatic dysfunction, which has prompted interest in alternative or adjunct therapeutic approaches. ¹⁷ Natural products and plant-derived compounds have therefore gained increasing attention as potential anticancer agents. Bioactive phytochemicals—including flavonoids, alkaloids, terpenoids, and polyphenols—can modulate multiple cellular processes involved in cancer progression, including oxidative stress, inflammation, and gene expression. ¹⁸

Several plant-derived metabolites, including epiberberine, crocin, evodiamine, and Halodule uninervis extracts, show antiproliferative and pro-apoptotic effects in cancer models, while nanoformulations may enhance their bioavailability and targeted delivery. ¹⁹

Among these natural compounds, Glycyrrhiza glabra (licorice root) and its principal bioactive constituent glycyrrhizin have attracted considerable interest due to their anti-inflammatory, antioxidant, and antiproliferative properties observed in several cancer models. ²⁰ Glycyrrhizin has been reported to modulate tumor suppressor genes and oncogenic signaling pathways involved in cell survival and apoptosis and may enhance anticancer activity by promoting DNA damage, apoptosis, and G2-phase cell-cycle arrest. ²¹

The present study aimed to comparatively evaluate the in vitro antiproliferative and gene-expression modulatory effects of glycyrrhizin and tamoxifen in the MCF-7 breast cancer model. Specifically, the study investigated their effects on cell viability and the transcriptional regulation of selected oncogenes and tumor suppressor genes involved in breast cancer progression, with the objective of elucidating potential mechanistic differences and therapeutic implications.

Materials and Methods

RNA Isolation and RT-qPCR Analysis

For gene expression analysis, MCF-7 cells were seeded in 6-well plates at 1 × 10⁶ cells/well and grown to 80–90% confluence. Culture medium was replaced with maintenance medium, and cells were treated with IC25, IC50, and IC75 concentrations of glycyrrhizin and tamoxifen for 48 hours. Control wells without drug treatment were included for comparative analysis, and each condition was performed in six replicates.

Total RNA was isolated using the TRIzol method according to the manufacturer’s instructions. RNA concentration and purity were assessed spectrophotometrically using A260/A280 ratios. Complementary DNA (cDNA) was synthesized from 1 µg of total RNA using a commercial reverse transcription kit following the manufacturer’s protocol. Primers for p53, PTEN, RAN, c-Myc, Bcl-2, Stathmin, IFN-γ, Hsp84, Cyclin D1, α-tubulin, and GAPDH were designed using NCBI GenBank sequences and Primer3 software. Primer sequences, annealing temperatures, and amplicon sizes are detailed in Table 1.

OPEN IN VIEWER

Table 1.

Sequence of Gene Specific Primers for qRT-PCR With Their Annealing Temperatures and Product Size

Gene	Primers	Product size	Annealing temperature
GAPDH	Forward: TGGTCTACATGTTCCAGTATGACT	134	58°C
	Reverse: CCATTTGATGTTAGCGGGATCTC
c-Myc	Forward: GACTCGGTGCAGCCCTATTT	179	59°C
	Reverse: GCAACATAGGACGGAGAGCA
Stathmin	Forward: TCAAGGGGAGAAACTGAAAGT	185	57°C
	Reverse: ATCTAATGGGTTGGAAGAAGC
INFγ	Forward: ACTGGCAAAAGGACGGTAAC	205	55°C
	Reverse: GGGTTGTTCACCTCGAACTT
Bcl-2	Forward: ATCGCTCTGTGGATGACTGAGTAC	134	56°C
	Reverse: AGAGACAGCCAGGAGAAATCAAAC
PTEN	Forward: GGAAAGGACGGACTGGTGTA	139	59°C
	Reverse: CGCCTCTGACTGGGAATAGT
RAN	Forward: GGGATGCTGAAAGATGAATG	191	54°C
	Reverse: CGAAAAGAATGGGAATGACAG
p53	Forward: TTTGAGGTTCGTGTTTGTGC	150	58°C
	Reverse: CTTTTGCTGGGGAGAGGAG
α-tubulin	Forward: GACAATGAGGCCATCTATGACATCT	116	56°C
	Reverse: CTGAGGGAAGCAGTGATGGAA
Cyclin D1	Forward: GCGAGCCATGCTTAAGACTGA	65	59°C
	Reverse: TCTGCACGCACTTGAAGTAAGAA
HSP 84	Forward: AACGCGAGAAGGAGATCAGT	209	58°C
	Reverse: CCAGATGGGCTTCGTCTTAT

Quantitative real-time PCR was performed using SYBR Green chemistry on the Applied Biosystems QuantStudio™ 1 Real-Time PCR System. The amplification protocol included initial denaturation at 95°C for 10 minutes, followed by 40 cycles of denaturation (95°C for 20 seconds), annealing (Specific primer temperature for 40 seconds), and extension (72°C for 40 seconds).

Relative gene expression was calculated using the 2⁻ΔΔCT method, normalized to GAPDH as an internal control. Melt curve analysis was performed to confirm amplification specificity, and only reactions demonstrating a single peak were included in the final analysis.

Results

Discussion

Breast cancer remains a leading cause of cancer-related morbidity and mortality among women worldwide, ² and drug resistance and adverse effects associated with long-term tamoxifen therapy^14,17 continue to drive interest in alternative or adjunct therapeutic agents. Natural compounds have attracted attention due to their potential anticancer effects and comparatively favorable safety profiles. ¹⁸ Glycyrrhizin has previously demonstrated anti-proliferative and pro-apoptotic properties across several malignancies, ²⁰ prompting its evaluation as a potential transcriptionally active compound in breast cancer models.

The present study comparatively evaluated the cell viability and gene-expression modulatory effects of glycyrrhizin and tamoxifen in the MCF-7. Both agents demonstrated concentration-dependent inhibition of cell viability, with tamoxifen exhibiting lower IC25, IC50, and IC75 values, consistent with its established clinical potency.^21,22 These findings confirm tamoxifen’s role as an appropriate pharmacological comparator and position glycyrrhizin as a compound with measurable, albeit less potent, inhibitory activity.

Beyond cell viability, the primary objective of this study was to examine transcriptional modulation of cancer-related genes. Rather than acting on a single molecular target, both compounds influenced multiple pathways associated with proliferation, apoptosis, and cell-cycle regulation, suggesting coordinated regulatory effects at the gene-expression level.

Upregulation of p53 observed with both treatments is biologically relevant given p53’s central role in DNA damage sensing, cell-cycle arrest, and apoptosis induction.^23,24 Transcriptional activation of p53 may reflect cellular stress responses triggered by treatment exposure. However, as protein stabilization and post-translational modifications are critical determinants of p53 activity, the present findings indicate transcriptional engagement rather than confirmed functional activation.

A key distinguishing observation was the significant upregulation of PTEN following glycyrrhizin treatment, which was not comparably observed with tamoxifen. PTEN negatively regulates the PI3K/AKT survival pathway and is frequently downregulated in breast cancer.^25,26 The selective enhancement of PTEN transcription by glycyrrhizin suggests potential engagement of growth-inhibitory signaling distinct from estrogen receptor antagonism. Given that tamoxifen primarily acts through estrogen receptor modulation, this divergence may reflect alternative upstream regulatory inputs, consistent with reports of differential downstream signaling responses to endocrine therapies.^27,28 Although PI3K/AKT pathway activity was not directly measured, the transcriptional upregulation of PTEN represents a biologically meaningful finding aligned with tumor suppressor pathway restoration.

Suppression of RAN by both agents is noteworthy, as RAN plays a critical role in nuclear transport, mitotic spindle assembly, and chromosomal stability, and its overexpression correlates with tumor aggressiveness.^29-31 Downregulation may therefore indicate impaired mitotic progression and reduced proliferative potential.

Downregulation of c-Myc and cyclin D1, two pivotal regulators of G1/S cell-cycle progression, suggests coordinated interference with proliferative signaling.^32-36 In parallel, reduced expression of stathmin and α-tubulin indicates potential disruption of microtubule dynamics and mitotic spindle organization.^37,38 As α-tubulin is a principal structural component of microtubules required for chromosome segregation, and its overexpression has been associated with aggressive and treatment-resistant breast cancer phenotypes,^39-41 its transcriptional suppression—together with decreased stathmin—suggests coordinated modulation of cytoskeletal regulatory networks. Collectively, these transcriptional alterations imply convergence on cell-cycle and mitotic control pathways rather than isolated gene-specific effects. However, functional validation through cell-cycle or cytoskeletal assays would be required to confirm downstream biological consequences.

The decrease in Bcl-2 transcripts aligns with previously reported apoptosis-associated gene modulation following glycyrrhizin^42,43 and tamoxifen^44,45 treatment. Although functional apoptosis assays were not performed, reduced anti-apoptotic signaling at the mRNA level may contribute to the observed reduction in cell viability.

Heat shock protein modulation provides additional insight. Suppression of hsp84, encoding the β-subunit of Hsp90, may have broader implications, as Hsp90 stabilizes numerous oncogenic client proteins and supports malignant phenotypes.^46,47 Transcriptional reduction could theoretically destabilize multiple signaling axes simultaneously, reinforcing the multi-targeted nature of glycyrrhizin’s activity.

Downregulation of IFN-γ also warrants consideration. While classically associated with antitumor immunity, IFN-γ can contribute to immune checkpoint induction and tumor-promoting inflammation under certain contexts.^48-51 In a monoculture epithelial system such as MCF-7, the biological implications remain uncertain; nevertheless, the observed modulation suggests that glycyrrhizin may influence cytokine-associated transcriptional networks beyond direct proliferative pathways.

Collectively, the gene-expression profile observed following glycyrrhizin treatment indicates simultaneous modulation of tumor suppressor pathways (p53, PTEN), proliferative drivers (c-Myc, cyclin D1), survival regulators (Bcl-2), mitotic regulators (RAN, stathmin, α-tubulin), and stress-associated proteins (hsp84). When interpreted in an integrated manner, these changes suggest a coordinated shift toward reduced proliferative capacity and altered survival signaling. While tamoxifen exhibited greater potency, glycyrrhizin demonstrated a partially overlapping yet transcriptionally distinct profile, particularly in relation to PTEN regulation, consistent with the study’s comparative objective.

Importantly, these interpretations remain limited to mRNA-level measurements. Protein quantification, apoptosis assays, cell-cycle profiling, and pathway-specific analyses would be necessary to confirm whether the transcriptional alterations translate into functional biological outcomes.

From a translational standpoint, glycyrrhizin’s pharmacokinetic limitations—including poor oral bioavailability and potential adverse effects such as pseudoaldosteronism—must be considered in therapeutic development. In addition, the exclusive use of the MCF-7 luminal A, estrogen receptor–positive model provides relevance for hormone-responsive disease but limits generalizability. Evaluation in additional subtypes, such as triple-negative models, and incorporation of in vivo systems will be essential to determine whether the transcriptional effects observed here extend across broader breast cancer contexts.

Conclusion

In this exploratory in vitro study, glycyrrhizin and tamoxifen were comparatively evaluated for their effects on cell viability and gene expression in the MCF-7. Both agents demonstrated concentration-dependent cell inhibition, with tamoxifen exhibiting greater potency. However, glycyrrhizin produced a distinct pattern of transcriptional modulation, including upregulation of the tumor suppressor gene PTEN, alongside regulation of other cancer-related genes.

These findings indicate that although glycyrrhizin shows less cell inhibition than tamoxifen under the tested conditions, it differentially modulates molecular pathways relevant to breast cancer biology. As the present study is limited to mRNA-level analysis in a single in vitro model, the results should be interpreted as preliminary and hypothesis-generating. Further investigations incorporating protein-level validation and functional assays are required to determine the biological and therapeutic significance of these transcriptional effects.