An RNA Aptamer Targeting PAI-1 That Restores tPA Activity,Unexpectedly Suppresses Cancer Cell Progression

Abstract

Plasminogen activator inhibitor-1 (PAI-1), the primary physiological inhibitor of tissue-type plasminogen activator (tPA), is a key regulator of fibrinolysis. Elevated levels of PAI-1 are linked to thrombotic disorders and correlate with poor prognosis across various cancers. In this study, we further characterize the RNA aptamer R10-4, previously shown to bind PAI-1 with high affinity and inhibit its antiproteolytic activity. While R10-4’s role in modulating fibrinolysis is established, its influence on cancer cell behavior remains unclear. Here, we demonstrate that intracellular transfection of R10-4 in triple negative breast cancer cells significantly impairs migration and invasion without affecting proliferation, mirroring the effects observed with other PAI-1–specific RNA aptamers. Moreover, conditioned media from R10-4 transfected cells suppress endothelial tube formation and exhibit reduced secretion of the pro-angiogenic chemokine (C-C) motif ligand 5 (CCL5). Collectively, these findings reveal that R10-4 restores fibrinolytic balance and disrupts PAI-1–mediated tumor progression, positioning it as a promising multifunctional candidate for therapeutic development.

Keywords

aptamers RNA angiogenesis cancer cell migration cell invasion breast cancer

Introduction

Plasminogen activator inhibitor-1 (PAI-1), a member of the serine protease inhibitor (serpin) family, regulates fibrinolysis by binding and inactivating tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator. While transient PAI-1 expression is necessary for tissue remodeling and wound healing, persistently elevated PAI-1 is linked to thrombotic disease, fibrosis, and cancer progression.^1,2 In cancer, PAI-1 supports tumor growth, metastasis, and angiogenesis, in part through effects on extracellular matrix (ECM) remodeling and cell signaling.^3–8 High circulating PAI-1 is consistently associated with poor prognosis in breast cancer and other malignancies. Additionally, PAI-1 has been shown to promote angiogenesis, which supply tumors with essential nutrients and oxygen.^9–11

RNA aptamers are short, structured oligonucleotides that bind proteins with high affinity and specificity. My laboratory has developed several PAI-1 aptamers, including ones that interact with the vitronectin binding site and influence cell migration and invasion.^12–15 Another aptamer, R10-4, blocks PAI-1–tPA interaction and enhances fibrinolysis in vitro.¹² Activity data suggest that R10-4 interacts with the reactive center loop of PAI-1, stabilizing a conformation that inhibits protease inhibition.¹² Here, we extend the functional characterization of R10-4 to assess its effects on cancer progression. Using triple-negative breast cancer (TNBC) cells, we demonstrate that intracellular R10-4 impairs migration and invasion, and conditioned media (CM) from R10-4 transfected cells suppress angiogenesis via reduced Chemokine (C-C motif) ligand 5 (CCL5) secretion. These findings reveal a dual activity of R10-4 in targeting both thrombotic and oncogenic pathways of PAI-1.

Materials and Methods

Transient transfection

TNBCs were seeded into a 6-well plate in Dulbecco's Modified Eagle Medium (DMEM) until approximately 80% confluent. Cultured cells were transiently transfected using Lipofectamine 3000 according to the manufacturer’s protocol as previously described.¹⁴ The R10-4 aptamer (gggaggacgaugcggccaggcgucucacucguuacgcuaucguugcguacuucuggacgacucgcugaggauccgaga) and control scrambled aptamer (gggaggacgaugcgguuggugaagggaggucagcauaucuucccgcggaagcgacgacgacucgcugaggauccgaga) (100 nM) were transfected. Transfection efficiency was determined by isolating total RNA followed by Reverse-transcription-polymerase chain reaction (RT-PCR) analysis and by confocal microscopy.

Cell migration (scratch assay)

Transfected TNBCs (0.5 × 10⁵/well) were seeded in 12-well plates and grown overnight at 37°C. Scratch assays were performed as previously described.¹⁶ Images were taken at 0, 6, and 24 h. Cell migration into the denuded area was analyzed using Image J.

Transwell invasion assays were performed as previously described.¹² Briefly, transfected cells (0.5 × 10⁶) were seeded on ECM-coated Boyden chambers (in triplicates), respectively. After 24 h, invaded cells were fixed, stained, and counted.

In vitro angiogenesis assays were performed as previously described.¹⁴ Briefly, Human umbilical vein endothelial cells (HUVECs) (1.5 × 10⁴) were plated on Matrigel-coated μ-slides with endothelial cell growth media¹⁴ or CM from TNBCs transfected with scrambled or R10-4 aptamer. Tube formation was assessed hourly for 6 h, then every 6 h up to 24 h, stained with Calcein AM, and quantified by fluorescence microscopy. The number of tubes was determined using Image J with an Angiogenesis Analyzer plugin as described previously.¹⁴

Cytokine analysis

Transfected (R10-4 and scApt) and non-transfected cells were incubated in Opti-MEM media for 24 h, after which the CM were collected, centrifuged to remove cellular debris, and analyzed for cytokine expression using a human cytokine array kit (R&D Systems). Spot intensities were quantified with Image J. Although multiple cytokines were included on the membrane, we reported only the cytokines that were detectably expressed. The positive control on each membrane was detected, and each experiment was normalized to the controls provided on the filters, as per the manufacturer’s protocol.

Confocal microscopy

Alexa 647–labeled R10-4 were transiently transfected as described above into TNBCs, fixed, stained with DAPI, and imaged by confocal microscopy.

Statistical analysis

Data are mean ± SD. Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test (*P < 0.05, **P < 0.001).

Results

R10-4 inhibits cancer cell migration and invasion

To investigate whether R10-4 suppresses PAI-1–mediated cancer progression, we examined its effects on TNBCs. Directly adding R10-4 (100–500 nM) to cells had no effect on migration or invasion, because R10-4 did not internalize into the cells (data not shown). Thus, we transfected R10-4 into the cells and assessed transfection efficiency by Alexa 647 labeling and confocal microscopy. We show that R10-4 is localized to the cytoplasm (Fig. 1A). Since the presence of the label can alter the intracellular distribution of aptamers, we then isolated total RNA from the transfected cells and performed an RT-PCR analysis and detected a cDNA band that corresponds to R10-4 and the control scrambled aptamer (Fig. 1B). No band was detected in non-transfected cells (Fig. 1B). While this confirms intracellular uptake, the exact localization of the aptamers remains unknown. We then assessed cell migration using scratch assays. Control cells closed ∼90%, whereas R10-4 transfected cells achieved on average 20%–30% closure, and cells transfected with the control scrambled aptamer (scApt) closed ∼85% within 24 h (Fig. 1B and C). Transwell assays demonstrated a ∼43% reduction in invasion compared to controls (no aptamer and scApt) (Fig. 1D). Cell proliferation was unaffected (data not shown). These results suggest that intracellular R10-4 significantly impairs PAI-1–mediated migration and invasion of TNBCs.

FIG. 1.

Migration and Invasion of transfected TNBCs: (A) Confocal imaging of TNBCs transfected with R10-4 RNA aptamer: TNBCs were stained with DAPI to visualize the nuclei (blue; panels a and d). The aptamer R10-4 was labeled with Alexa Fluor 647(magenta, panel e), the control cells were not transfected with labeled R10-4 (panel b). Panels c and f are a merge of the two channels. Panels a–c (absence) and Panels d–f (presence) of Alexa Fluor 647-conjugated R10-4. The merged image (panels c and f) reveals co-distribution of R10-4 signal with extranuclear structures, providing insights into its intracellular transfection. (B) Upper panel: Total RNA from TNBCs transfected with scApt, or R10-4 and untransfected TNBCs was isolated and subjected to RTPCR analysis, respectively. The PCR band for both scApt and R10-4 are apparent while untransfected cells do not have a band that corresponds to aptamer transfection. Lower Panel: R10-4 inhibits breast cancer cell migration. TNBCs transfected with R10-4, were cultured and allowed to grow in serum containing media to approximately 80% confluency. The cells were then subjected to a scratch wound assay as described in materials and methods. Wound closure was monitored and imaged at 0, 6, and 24 h. Representative images show the wound area at each time point. (C) Quantification of wound closure after 24 h was performed by measuring the percent reduction in wound closure relative to no aptamer control, which was set at 100%. R10-4 significantly reduced cell migration compared to the scrambled control. Cell invasion was assessed using a modified Boyden Chamber transwell migration assay, where fetal bovine serum was used as the chemoattractant. There is a significant decrease in cell invasion compared to the scrambled aptamer control. Data are expressed as mean ± SD from at least three independent experiments. Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test (*P < 0.05, **P < 0.001).

TNBCs transfected with R10-4 secrete factors that suppress angiogenesis

Because angiogenesis is central to tumor progression, we evaluated whether factors secreted from R10-4 transfected cells alter endothelial tube formation. As expected, HUVECs incubated with normal endothelial cell growth media and with CM from TNBCs transfected with the control scrambled aptamer effectively developed tubes (Fig. 2A). However, incubating HUVECs with CM from cells transfected with 100 nM of R10-4 resulted in a decrease in tube formation (Fig. 2A). Since the CM is Serum Free Medium (SFM: Opti-MEM), we show that SFM alone does not promote tube formation (Fig. 2B and C). CM from cells transfected with R10-4 induced significantly less tubes compared to tubes formed in the presence of CM from cells transfected with scApt. We next assessed the cytokine profiling from transfected cells, which revealed downregulation of CCL5 and MiF in R10-4 transfected cells compared to control cells (Fig. 2D).¹⁷

FIG. 2.

Analysis of angiogenic tube formation and cytokine expression in response to R10-4 conditioned media. (A) Quantitative assessment of endothelial tube formation over time reveals a progressive increase in the number of structures, indicative of active angiogenesis. There is a significant decrease in tubes formed in the presence of CM from cells transfected with R10-4, compared to HUVECs grown in endothelial cell media and cells incubated with CM from cells transfected with scApt. (B) Representative pictures depicting tube formation after 24-h exposure to CM from R10-4 transfected cells, scApt transfected cells, and HUVECs incubated with SFM (Opti-MEM). Tubular networks are distinctly visible under these conditions. (C) Quantification of tube structures after 24 h assessed by counting total branched points and complete tubes. (D) Relative expression of cytokines CCL5 and MIF was determined by ELISA as described in the methods section. CCL5 and MIF levels are reduced compared to control. Data are expressed as mean ± SD from four independent experiments. Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test (*P < 0.05,**P < 0.001).

Discussion

This study identifies R10-4 as a multifunctional RNA aptamer that antagonizes PAI-1, exerting effects on fibrinolysis and tumor progression. Intriguingly, intracellular transfection of R10-4 significantly reduces migration, invasion, and angiogenesis in TNBCs, revealing a previously underappreciated role for PAI-1 within the tumor microenvironment.

Previously, we reported that intracellular transfection of other PAI-1–specific RNA aptamers, SM-20 and WT-15, similarly inhibited breast cancer cell migration and invasion.^13,14 However, these aptamers target the VNBD of PAI-1 and do not disrupt the PAI-1/tPA interaction.¹³ The observation that aptamers targeting distinct PAI-1 domains produce comparable anti-migratory effects raises questions about the underlying mechanisms. One possibility is that R10-4 engages both the reactive center loop and VNBD of PAI-1, thereby exerting a broader functional inhibition profile.

Our findings also uncover a mechanistic link between PAI-1 and the pro-angiogenic chemokine CCL5, which has been shown previously.¹⁷ CM from R10-4 transfected cells contained markedly reduced levels of CCL5, correlating with impaired angiogenesis.¹⁴ Given CCL5′s role in immune cell recruitment, cancer cell progression, and angiogenesis, suppressing it could represent a downstream consequence of PAI-1 inhibition.^18–20 Dissecting PAI-1 and CCL5 synergistic roles in pathological vascularization could lead to the development of targeted strategies to disrupt these processes. Our data show that the intracellular inhibition of PAI-1 by R10-4, resulting in a significant decrease in CCL5, might be the key to mitigating disease progression (Fig. 3). Additionally, we observed downregulation of macrophage migration inhibitory factor (MIF), suggesting that R10-4 may modulate multiple PAI-1–regulated signaling pathways; however, the connection between PAI-1 and MIF is not well established and remains under investigation.

FIG. 3.

CCL5-mediated angiogenic signaling in TNBCs. Schematic representation of TNBC populations expressing either PAI-1 alone or both PAI-1 and R10-4. These cells secrete the chemokine CCL5 (blue dots), which act on surrounding endothelial cells to promote angiogenesis, illustrated by the formation of new blood vessels. In the presence of R10-4, CCL5 secretion is decreased with an overall decrease in angiogenesis. The diagram highlights a potential mechanism by which TNBCs enhance vascularization through CCL5 signaling, contributing to tumor progression and metastasis. This process is potentially regulated by PAI-1.

Footnotes

Acknowledgments

The authors thank Adi Breitman, Alicia Matthews, and Stephanie Brandal for their early contributions to this work.

Author Disclosure Statement

No financial competing interests exist.

Funding Information

This work was supported by a grant from the Hartwell Foundation (RES236407) and institutional support from Case Western Reserve University College of Arts and Sciences (OPN261229).

References

Sillen

, Declerck

. A Narrative review on plasminogen activator inhibitor-1 and Its (Patho)physiological role: To target or not to target? Int J Mol Sci, 2021; 22:2721; doi: 10.3390/ijms22052721

Milenkovic

, Milojkovic

, Jevtovic Stoimenov

, et al. Mechanisms of Plasminogen Activator Inhibitor 1 Action in Stromal Remodeling and Related Diseases. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub, 2017; 161:339–347; doi: 10.5507/bp.2017.046

Wei

, Li

, He

, et al. Tumor-secreted PAI-1 promotes breast cancer metastasis via the induction of adipocyte-derived collagen remodeling. Cell Commun Signal, 2019; 17:58; doi: 10.1186/s12964-019-0373-z

, Wei

, He

, et al. Plasminogen activator inhibitor-1 in cancer research. Biomed Pharmacother, 2018; 105:83–94; doi: 10.1016/j.biopha.2018.05.119

Ferroni

, Roselli

, Portarena

, et al. Plasma plasminogen activator inhibitor-1 (PAI-1) levels in breast cancer—Relationship with clinical outcome. Anticancer Res, 2014; 34:1153–1161.

Alessi

, Juhan-Vague

. PAI-1 and the metabolic syndrome: Links, causes, and consequences. Arterioscler Thromb Vasc Biol, 2006; 26:2200–2207; doi: 10.1161/01.ATV.0000242905.41404.68

Morrow

, Whyte

, Mutch

. A serpin with a finger in many PAIs: PAI-1’s central function in thromboinflammation and cardiovascular disease. Front Cardiovasc Med, 2021; 8:653655; doi: 10.3389/fcvm.2021.653655

Beaulieu

, Whitley

, Wiesner

, et al. Breast cancer and metabolic syndrome linked through the plasminogen activator inhibitor-1 cycle. Bioessays, 2007; 29:1029–1038; doi: 10.1002/bies.20640

Ismail

, Shaker

, Bajou

. The plasminogen–activator plasmin system in physiological and pathophysiological angiogenesis. Int J Mol Sci, 2021; 23:337; doi: 10.3390/ijms23010337

10.

Fortenberry

, Damare

. Inactivation of plasminogen activator inhibitor-1 by RNA aptamer molecules. Blood, 2012; 120:1107; doi: 10.1182/blood.v120.21.1107.1107

11.

Stefansson

, McMahon

, Petitclerc

, et al. Plasminogen Activator Inhibitor-1 in Tumor Growth, Angiogenesis and Vascular Remodeling. Curr Pharm Des, 2003; 9:1545–1564; doi: 10.2174/1381612033454621

12.

Damare

, Brandal

, Fortenberry

. Inhibition of PAI-1 antiproteolytic activity against tPA by RNA aptamers. Nucleic Acid Ther, 2014; 24:239–249; doi: 10.1089/nat.2013.0475

13.

Brandal

, Blake

, Sullenger

, et al. Effects of plasminogen activator inhibitor-1-specific RNA Aptamers on cell adhesion, motility, and tube formation. Nucleic Acid Ther, 2011; 21:373–381; doi: 10.1089/nat.2011.0320

14.

Fortenberry

, Brandal

, Carpentier

, et al. Intracellular expression of PAI-1 specific aptamers alters breast cancer cell migration, invasion and angiogenesis. PLoS One, 2016; 11:e0164288; doi: 10.1371/journal.pone.0164288

15.

Blake

, Sullenger

, Lawrence

, et al. Antimetastatic potential of PAI-1-specific RNA aptamers. Oligonucleotides, 2009; 19:117–128; doi: 10.1089/oli.2008.0177

16.

Carter

, Church

. Peroxisome proliferator-activated receptor-γ ligands alter breast cancer cell motility through modulation of the plasminogen activator system. J Oncol, 2011; 2011:594258; doi: 10.1155/2011/594258

17.

Zhang

, Xu

, Fang

, et al. Endothelial cells promote triple-negative breast cancer cell metastasis via PAI-1 and CCL5 signaling. Faseb J, 2018; 32:276–288; doi: 10.1096/fj.201700237RR

18.

Geindreau

, Bruchard

, Vegran

. Role of cytokines and chemokines in angiogenesis in a tumor context. Cancers (Basel), 2022; 14:2446; doi: 10.3390/cancers14102446

19.

Morein

, Erlichman

, Ben-Baruch

. Beyond cell motility: The expanding roles of chemokines and their receptors in malignancy. Front Immunol, 2020; 11:952; doi: 10.3389/fimmu.2020.00952

20.

Aldinucci

, Colombatti

. The Inflammatory chemokine CCL5 and cancer progression. Mediators Inflamm, 2014; 2014:292376; doi: 10.1155/2014/292376