Synthesis,characterization and biological performance of a calcium titanium oxide film prepared by sol-gel/dip coating technique on titanium

Highlights

(1) Coatings based on calcium titanate (CaTiO₃) were successfully deposited on c.p.-Ti using sol-gel and dip-coating techniques.

Introduction

Modifying the surface of a biomaterial is an effective strategy to enhance osseointegration and the biological performance of implants. ¹ Such surface modifications can trigger a cascade of cellular and extracellular biological events, ² ultimately stimulating the formation of a stable interface between biological tissue and the biomaterial.^3,4 A controlled inflammatory response to the implant is subsequently activated, which is considered a natural and necessary step for integrating the device into the host tissue. ⁵ This response promotes the formation of connective tissue and contributes to implant stability. ⁶

This process involves the activation of the local immune system leading to the release of various proteins such as growth factors Bone Morphogenetic Protein (BMP), Transforming Growth Factor (TGF), Platelet-Derived Growth Factor (PDGF), Insulin, Vascular Endothelial Growth Factor (VEGF) and cytokines such as Insulin-like Growth Factor I (IGF-1) and biologically contributes to the formation of a blood clot that protects the injured site from infection and enables tissue growth around the implant.^6,7 Properly, this mechanism is required to active paracrine signaling among cells through messengers including cytokines, hormones, extracellular vesicles, and matrix-binding receptors, coordinating biological responses and promoting cellular homeostasis, ³ such as the regulation of osteoblast, osteoclast, and osteocyte activity and function. More recently, it has been highlighted the involvement of endothelial^8–11 and vascular smooth cells^12,13 during biomaterials-induced bone healing and it has opened a new way to propose biomimetic materials.^14,15

Given this context, research efforts have focused on enhancing the physicochemical properties of metallic materials such as titanium (Ti) to improve bone-implant interaction. These efforts aim to optimize cell adhesion, migration, proliferation, and differentiation, ensure mechanical compatibility, and minimize immune rejection. ¹⁶ Among the most studied strategies is placed the use of hydroxyapatite (HA), as a mineral naturally found in bone and that is known to promote very interesting aspects on cell adhesion and further integration between the implant and the host tissue. ¹⁷ Technically, HA can be applied to titanium surfaces via heat treatment, ¹⁸ chemical deposition, ¹⁹ or dispersion in solvent-based suspensions, ²⁰ leading to improved mechanical properties, biocompatibility, and cell adhesion. ²¹ Despite its advantages, HA coatings are limited by their mechanical durability, resistance to delamination, and weak adhesion to the metallic substrate. ²² To overcome these limitations, promising approaches include incorporating organic or inorganic compounds into HA matrices, ²³ adding polymeric components, ²⁴ or functionalizing with mimetic peptides, ²⁵ ameliorating mechanical properties and also offering a bioactive substrate to promote cell adhesion. ²⁶

Additional strategies involve the inclusion of an intermediate titanium oxide layer,^27,28 pre-treatments of the Ti surface with baths of acids or bases, ²⁹ and calcium ion incorporation into the oxidized layer,^3,4 which improves HA stability and resistance to degradation. Calcium incorporation leads to the formation of a calcium titanate (CaTiO₃) phase, known to promote apatite precipitation ³⁰ and strengthen the coating-substrate interface. ³¹ This non-cytotoxic compound also supports cell adhesion and proliferation,^32,33 while serving as a protective barrier that prevents the diffusion of metal ions into surrounding bone tissue. ³¹

Most studies on bioactive calcium titanate coatings on titanium or titanium alloys often involve an alkaline treatment of the substrates, which initially leads to the formation of sodium titanate.^33–36 However, successful CaTiO₃ deposition requires strict control of the coating procedure to prevent metal ion aggregation at the interface, which could compromise coating stability prior to clinical application. Among various deposition techniques, sputtering ³⁷ and the sol-gel method ²⁶ are regarded as straightforward and effective for forming uniform and adherent CaTiO₃ films. These coatings promote accelerated osseointegration and reinforce the mechanical integration between bone and implant, improving the overall stability and longevity of the device.^38,39

Thus, this study aims to develop calcium titanate coatings on titanium surfaces, employing physicochemical characterization techniques to evaluate the structural and surface properties. Additionally, it aims to investigate the effects of these coatings on the expression of key genes and proteins associated with cell adhesion, proliferation, and extracellular matrix (ECM) remodeling in pre-osteoblasts. This approach seeks to elucidate the potential of calcium titanate-modified surfaces to enhance cellular interactions and support bone integration.

Material and methods

Biological assay

Cell culture

Mouse pre-osteoblasts (MC3t3-E1, Subclone 4), acquired from the American Type Culture Collection (ATCC), were cultured at 37°C in a humidified atmosphere containing 5% CO₂ in Alpha-MEM medium supplemented with 10% fetal bovine serum (FBS; Nutricell, Campinas, SP, Brazil), antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin), and a mixture of ribonucleosides and deoxyribonucleosides. Subconfluent cultures were trypsinized, adjusted to a final concentration of 5 × 10⁴ cells/mL,^43,44 and used for all experiments.

Cell viability

Indirect contact assays were designed to isolate the biological effects mediated exclusively by surface-derived ionic species and soluble factors released from the coatings, independently of surface topography or direct mechanotransduction. In contrast, direct contact assays were performed to evaluate cell–surface interactions, including adhesion, spreading, and morphology, which are critically dependent on surface chemistry, wettability, and microstructural integrity. For the viability assay (in indirect contact conditions), culture media without FBS were previously conditioned with either unmodified or modified titanium samples for 24 h at 37°C, following ISO 10993:2016 guidelines for irregularly shaped solid devices. After conditioning, the media were supplemented with 10% FBS and referred to hereinafter as “conditioned media.” Separately, cells were seeded in 96-well plates at a density of 5 × 10⁴ cells/mL (5 × 10³ cells/well; n = 6 per group). After 24 h, the medium was replaced with the conditioned medium and incubated for an additional 24 h. Cell viability was assessed using the MTT assay: medium was replaced with fresh medium containing 0.5 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and incubated for 3 h at 37°C. Non-reacted MTT was discarded, and 100 µL/well of DMSO was added to solubilize the formazan crystals. Absorbance was measured at 570 nm using a microplate reader (SYNERGY-HTX multi-mode reader, BioTek, USA).^43,45

Cell adhesion assay

The effect of the conditioned media on cell adhesion was evaluated using the crystal violet assay.^46,47 Trypsinized cells were resuspended in conditioned media (with FBS) at a density of 5 × 10⁴ cells/mL and seeded into 96-well plates. After 24 h, non-adherent cells were removed, and adherent cells were gently rinsed with phosphate-buffered saline (PBS). Cells were fixed with a 3:1 (v/v) mixture of acetic acid and absolute ethanol for 20 min. Fixative was removed, and cells were stained with 100 µL of 0.1% (w/v) aqueous crystal violet solution for 15 min. After washing twice with PBS, the dye was solubilized with 10% acetic acid, and absorbance was measured at 540 nm using a microplate reader (SYNERGY-HTX, BioTek, USA). ⁴⁸

Cell attachment analysis by SEM

Direct contact assays were specifically employed to investigate cell adhesion and morphology as a function of direct interaction with the modified titanium surfaces. To assess cell attachment, cells at a density of 5 × 10⁴ cells/mL were seeded directly onto modified titanium surfaces in 24-well plates. After 24 h of incubation, cells were fixed with 2.5% glutaraldehyde in 0.1 mol.L^-1 phosphate buffer (pH 7.3). Samples were post-fixed in 0.5% osmium tetroxide for 40 min and dehydrated through a graded ethanol series (7.5% to 100%). Critical point drying was performed in CO₂ (Leica EM CPD030), and samples were sputter-coated with gold for scanning electron microscopy (SEM) analysis (FEI Quanta 200).

Confocal microscopy

For confocal analysis, MC3t3-E1 cells were cultured on glass coverslips and treated with different Ti-conditioned media. Adherent cells were washed with PBS, fixed in 4% paraformaldehyde (v/v) for 1 h, and permeabilized in phosphate buffer containing 0.2% Triton X-100 and 1% bovine serum albumin (BSA) at 37°C for 1 h. For cytoskeletal analysis, cells were incubated with Alexa Fluor 488-conjugated phalloidin (10 µg/mL; Invitrogen/Molecular Probes, USA) for 40 min. Coverslips were washed and mounted with Fluoroshield containing DAPI (Sigma-Aldrich, St. Louis, MO, USA) and visualized using an inverted confocal laser scanning microscope (Leica TCS SP5, Allendale, USA). Direct confocal imaging on titanium surfaces was not performed due to the intrinsic opacity and reflective properties of metallic substrates, which impair optical sectioning and fluorescence signal acquisition. Therefore, cytoskeletal organization was evaluated under conditioned medium exposure as a strategy to investigate indirect biochemical modulation of actin dynamics.

RNA extraction and cDNA synthesis

Gene expression analyses were designed to investigate whether Titanium-conditioned environments modulate intracellular signaling pathways associated with cell adhesion, cytoskeletal remodeling, and early osteogenic commitment, complementing morphological and viability assessments. Cells were seeded in 6-well plates at 2 × 10⁵ cells/mL and exposed to conditioned media for 24 h under the same conditions as the viability assay. The supernatants were collected and stored for matrix metalloproteinase (MMP) analysis (see section 2.4.9). Total RNA was extracted using TRIzol Reagent (Ambion, Life Technologies/Fisher Scientific, Waltham, MA, USA). RNA extraction involved maceration in TRIzol, chloroform separation (5:1 v/v), centrifugation (12,000 × g, 15 min), isopropanol precipitation, ethanol washing (70%), and dissolution in RNase-free water. RNA was treated with DNase I (Invitrogen, Carlsbad, CA, USA) to eliminate residual genomic DNA. After thermal inactivation (65°C), RNA purity and concentration were determined by spectrophotometry (NanoDrop 2000, Thermo Fisher). cDNA was synthesized from 2 µg of total RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA), following the manufacturer’s protocol at 37°C for 120 min using a QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

Gene expression

Gene expression was evaluated by quantitative real-time PCR (qRT-PCR) using 10 µL of reaction mixture containing 5 µL of GoTaq® qPCR Master Mix (Cat. No. A6002, Promega, WI, USA), 0.5 µM of each forward and reverse primer, 1 µL (50 ng) of cDNA, and 3 µL of DEPC-treated water. Target genes, primer sequences, and assay details are listed in Table 1^49,50 Reactions were performed in triplicate (from three independent experiments) using the QuantStudio® 3 Real-Time PCR System. Gene expression levels were normalized to Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) and analyzed using the comparative Ct (ΔΔCt) method, relative to control groups (Table 1).

OPEN IN VIEWER

Table 1.

Expression primer sequences and PCR cycle conditions.

Gene	Primer	5′–3′ Sequence	Reaction condition
Integrin α1	Forward	TATCCTCCTGAGCGCCTTT	95°C-15°s; 55°C-30°s; 72°C-30°s
	Reverse	TGGCCTTTTGAAGAATCCAA
Integrin β1	Forward	CTGATTGGCTGGAGGAATGT
	Reverse	TGAGCAATTGAAGGATAATCATAG
Src	Forward	TCGTGAGGGAGAGTGAGAC
	Reverse	GCGGGAGGTGATGTAGAAAC
FAK	Forward	TCCACCAAAGAAACCACCTC
	Reverse	ACGGCTTGACACCCTCATT
Cofilin	Forward	CAGACAAGGACTGCCGCTAT
	Reverse	TTGCTCTTGAGGGGTGCATT
Gapdh	Forward	AGGCCGGTGCTGAGTATGTC
	Reverse	TGCCTGCTTCACCACCTTCT

Western blot

Cells were exposed to titanium-conditioned media for 24 h, as previously described in Section 2.4.2. After incubation, cells were lysed using a buffer containing: 50 mmol.L^-1 Tris-HCl (pH 7.4), 1% Tween 20, 0.25% sodium deoxycholate, 150 mmol.L^-1 NaCl, 1 mmol.L^-1 EGTA, 1 mmol.L^-1 sodium orthovanadate, 1 mmol.L^-1 NaF, and a protease inhibitor cocktail (1 µg/mL aprotinin, 10 µg/mL leupeptin, and 1 mmol.L^-1 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride). Lysates were kept on ice for 2 h, sonicated, and centrifuged. Protein concentration in the supernatants was quantified using the Lowry method. ⁵¹ Equal volumes of Laemmli buffer (2× SDS, 100 mmol.L^-1 Tris-HCl pH 6.8, 200 mmol.L^-1 DTT, 4% SDS, 0.1% bromophenol blue, and 20% glycerol) were added to the samples, which were then boiled at 85°C for 5 min under denaturing conditions. Proteins were resolved by SDS-PAGE on 10% polyacrylamide gels at 100 V and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore). Membranes were blocked with 1% BSA in TBS containing 0.05% Tween-20 and incubated overnight at 4°C with primary antibodies diluted 1:1000. After washing in TBS, membranes were incubated with HRP-conjugated secondary antibodies (1:5000) for 1 h at room temperature. Protein bands were detected using enhanced chemiluminescence (ECL). GAPDH was used as the internal loading control. Primary antibodies used includes: Phospho-Cofilin (Ser3) (77G2) Rabbit mAb (#3313); Cofilin (D3F9) Rabbit mAb (#5175); Src Antibody (#2108); GAPDH (14C10) Rabbit mAb (#2118). All antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA).

Matrix metalloproteinase activities

Matrix metalloproteinase (MMP) activity was evaluated using gelatin zymography to assess the response of cells to surface-modified titanium-conditioned media. MC3t3-E1 cells were treated with conditioned media for 24 h and the culture supernatants were collected, as described in Section 2.4.6. Samples were mixed with loading buffer (2% SDS, 0.1% bromophenol blue) and subjected to SDS-PAGE under non-reducing conditions using 10% polyacrylamide gels containing 0.1% gelatin (pH 8.8). Electrophoresis was performed at 70 V and 10°C. Following electrophoresis, gels were washed twice in 2% Triton X-100 and incubated in proteolysis buffer (50 mmol.L^-1 Tris-HCl pH 7.6, 200 mmol.L^-1 NaCl, 10 mmol.L^-1 CaCl₂) for 18 h at 37°C. Gels were then stained with 0.5% Coomassie Brilliant Blue G-250 in an acetic acid/methanol/water solution (1:4:5, v/v/v), and destained using an acetic acid/methanol/water solution (1:2:7, v/v/v). ⁴⁵ For analysis, gel contrast was digitally inverted, and molecular weights of gelatinolytic bands were determined using a dual-color protein standard (10–250 kDa; Precision Plus Protein™ Dual Color Standards #1610374, Bio-Rad).

Statistical analysis

Data normality was assessed using the Shapiro-Wilk test. All results are expressed as mean ± standard deviation (SD). Comparisons among groups were made using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. A p-value <0.05 was considered statistically significant. All statistical analyses and graph generation were performed using GraphPad Prism 7.0 (GraphPad Software, San Diego, CA, USA).

Results and discussion

The XRD pattern of the calcium titanium oxide powder (Figure 1(a)) shows peaks corresponding to diffraction from calcium titanate (CaTiO₃) (PDF 75-2100), anatase-titanium dioxide (PDF 75-1537), and calcium oxide (CaO) (PDF 28-775). In the XRD patterns of the films (Figure 1(b)), peaks corresponding to diffraction from alpha-titanium (α-Ti), with a hexagonal close-packed structure (PDF 89-5009), and alpha-calcium titanate (CaTiO₃) (PDF 43-226) were identified. Neither the chemical treatment nor the coating associated with heat treatment altered the crystallographic structure of the titanium substrate. Moreover, film production interfered in a way that suppressed the crystallization of anatase-titanium dioxide and calcium oxide (CaO), which were observed in the powder, and altered the lattice parameters of calcium titanate, although the crystal structure itself remained unchanged. In other words, there is an interaction between the substrate and the film to an extent that affects the composition and structure of the film.

OPEN IN VIEWER

Figure 1.

XRD patterns of the following samples: (a) calcium titanium oxide (CT) powder; (b) CT films prepared on c.p.-Ti using different withdrawal rates (Ti, TiC5, TiC10, Ti2C10). The analysis of the powder was conducted using the 2theta/theta configuration, while the CT films on c.p.-Ti were analyzed in the 2theta configuration with an incident angle of 3.0° or 1.5°.

The cross-sectional micrographs obtained by SEM-FEG in Figure 2 show that the sol-gel/dip coating produced layers with thicknesses of 0.170 ± 0.006 μm, 0.994 ± 0.157 μm and 2.316 ± 0.360 μm, respectively for TiCT5, TiCT10, and Ti2CT10 samples. These results are consistent with the X-ray diffraction data, as peaks related to the substrate (α-Ti) were observed. No significant differences were observed in the thickness of the films located 4 mm and 7 mm from the edge.

OPEN IN VIEWER

Figure 2.

Cross-sectional FE-SEM images of: (a) Ti5CT; (b) TiCT10, and (c) Ti2CT10.

SEM micrographs of the films, roughness profiles, and wettability measurements are shown in Figure 3. Grinding effectively removes surface defects,^52,53 but abrasion leaves scratches and creates irregular grooves and ridges, resulting in a roughness of Ra 0.643 (Rq 0.755 µm) (Figure 3(b) and (c)). These topographic imperfections were partially filled by the calcium titanium oxide, reducing the roughness to Ra 0.366 (Rq 0.456 µm) for TiCT5 and Ra 0.423 (Rq 0.540 µm) for TiCT10. However, in the case of TiCT10, microcracks appeared due to the difference between the thermal expansion coefficients of calcium titanium oxide (12.94 µm/K for CaTiO₃ and 8.4 µm/K for anatase-TiO₂)^54,55 and metallic alpha-titanium (8.6 µm/K), ⁵⁶ leading to increased roughness. The microcracks worsened as the film thickness increased in the case of Ti2CT10 (Ra 0.625 µm, Rq 0.759 µm), and the coating began to delaminate.

OPEN IN VIEWER

Figure 3.

(a) Surface morphology analysis by SEM; (b) 3D roughness analysis obtained through Vertical Scanning Interferometry, including a 2D representation; (c) line roughness profile; (d) wettability assessment by contact angle measurements for the surfaces of Ti, Ti5CT, TiCT10, and Ti2CT10. Cracks became apparent after coating the surface with CT at a withdrawal rate of 10 cm/min.

Surface wettability measurements were conducted to assess biocompatibility, which is crucial for bone integration with biomaterials. ⁵⁷ Pure titanium surfaces used for bone implants exhibited lower wettability, i.e., higher contact angles (90°) (Figure 3(d)), in agreement with the results of the literature. ⁵⁸ The CT-based coatings, however, exhibited lower contact angles, indicating greater surface wettability. ⁵⁹ According to the Wenzel and Cassie-Baxter models - theories that describe the wettability of rough surfaces, with Wenzel model assuming that water molecules completely fill the grooves and the Cassie-Baxter model assuming that waters do not penetrates the grooves - the intrinsic behavior of the surface tends to be amplified. In other words, the hydrophilic surfaces will become more hydrophilic with increasing roughness. ⁶⁰ In our study, the coating led to a reduction in the surface roughness. Consequently, assuming constant roughness conditions, an enhancement in wet ability would be expected, which in turn may promote increased cell viability and adhesion in direct contact assays.

In the corrosion analysis, performed in Hank’s balanced salt solution, the average open circuit potential (OCP) shifted toward more anodic values with surface modification (see Figure 4(a)), indicating that the steady state condition – where no net oxidation or reduction occurs – withstand up to more anodic potentials. The most noble potential was observed for Ti2CT10, followed by TiCT10 ≅ TiCT5, and Ti indicating that the crystallized oxides formed after thermal treatment on the titanium surface serve as a more effective protective layer. ⁶¹

OPEN IN VIEWER

Figure 4.

Electrochemical corrosion analysis of Ti, Ti5CT, TiCT10, and Ti2CT10: (a) OCP measured during 60 min; (b) polarization curve after 60 min, both at 37°C. The measurements were taken in Hanks’ balanced saline solution within an electrochemical system with an Ag/AgCl reference electrode and a platinum counter electrode. Polarization curves were obtained at a scan rate of 0.167 mV/s.

The corrosion behavior was further assessed through potentiodynamic polarization measurements (Figure 4(b)). In the cathodic region of the curve, polarization was limited to the range of E ≥ OCP - 0.200 mV to avoid intense hydrogen absorption, hydride and hydroxide formations. In the anodic region, distinct active and passive domains were generally observed. On titanium, a passive film forms spontaneously in the presence of oxygen, leading to a less distinct transition between the active and passive states. The passive layers comprised hydrated species and a mixture of oxides (TiO, Ti₂O₃, and TiO₂), ⁶² formed as oxidation products within these potential ranges. Despite these layers provide protective properties, further gradual oxidation may still occur at increasing potentials under low current densities (Figure 4(b)).

Based on the polarization data from the cathodic activation regions, the Evans Diagram was constructed. Assuming that the kinetics of both activation-controlled reactions are described by Butler-Volmer equation – despite differences in the reaction mechanisms between the anodic and cathodic domains – from the linear portions of the curves and by extrapolation, the Tafel slopes (b_a and b_c), corrosion potential (E_corr), and corrosion current density (i_corr, A/cm²) were determined, along with the polarization resistance (R_p) and corrosion rate (C_r), using equations (1) and (2). ⁶³ The determined parameters are summarized in Table 2. As mentioned previously, the anodic and cathodic reactions differ, so E_corr and i_corr corresponds to that of steady-state condition. Lower i_corr values indicate a lower corrosion rate (C_r) and reduced corrosion susceptibility, as observed with the following order: TiCT5, TiCT10 ≅ Ti2CT10, and Ti. Despite the small difference, the modification did not increase corrosion susceptibility.

OPEN IN VIEWER

Table 2.

Average open circuit potential over the last 5°min of the total period of 60°min and kinetic parameters obtained from the electrochemical polarization curve for Ti, TiTC5, TiTC10, Ti2TC10, in balanced Hanks’ solution: corrosion potential (E_corr), corrosion current density (i_corr), polarization resistance (R_p), anodic (b_a) and cathodic (b_c) Tafel slope, and corrosion rate (C_r).

Samples	OCP (V)	Ecorr(V)	icorr (A/cm2) x 108	ba (V/dec)	bc (V/dec)	Rp (Ωcm2) x 10-7	Cr (mm/year) x 104
Ti	−0.4250 ± 0.0007	−0.409 ± 0.003	1.299 ± 0.011	0.068 ± 0.007	−0.066 ± 0.003	0.112 ± 0.004	1.128 ± 0.010
TiCT5	−0.3085 ± 0.0003	−0.357 ± 0.029	0.191 ± 0.024	0.186 ± 0.019	−0.103 ± 0.007	1.515 ± 0.116	0.166 ± 0.002
TiCT10	−0.3053 ± 0.0009	−0.410 ± 0.004	0.279 ± 0.021	0.170 ± 0.012	−0.087 ± 0.008	0.900 ± 0.078	0.251 ± 0.002
Ti2CT10	−0.2116 ± 0.0002	−0.323 ± 0.014	0.305 ± 0.110	0.219 ± 0.020	−0.096 ± 0.014	0.949 ± 0.088	0.265 ± 0.010

To comprehensively evaluate the biological performance of those coatings, both direct and indirect experimental models were employed, allowing discrimination between surface-mediated mechanochemical effects and those driven by soluble factors released into the culture medium. The influence of surface modification on cell viability and adhesion was initially assessed under direct contact conditions (Figure 5(b)). The results confirmed that the modified surfaces were non-cytotoxic to pre-osteoblast MC3t3-E1 cells, as defined by ISO 10993:2016. Additionally, cell attachment analysis revealed improved spreading on TiCT5 and TiCT10 surfaces, with enhanced morphological features observed by SEM (Figure 5(a)). This improvement is likely related to the physicochemical characteristics of the coatings: the TiCT5 and TiCT10 surfaces exhibited enhanced wettability and surface homogeneity, which are known to facilitate cell-substrate interactions. ⁶⁴ The scarcity of adherent cells on Ti2CT10 surfaces is likely a consequence of coating instability, as microcracks and partial delamination compromise focal adhesion anchorage and mechanotransduction, despite the favorable integrin expression profile observed under conditioned media.

OPEN IN VIEWER

Figure 5.

(a) MC3t3 cell attachment analysis on the surfaces of Ti, Ti5CT, TiCT10, and Ti2CT10 by SEM after 24 h of incubation; (b) cell viability and adhesion assays of MC3t3 pre-osteoblastic cells following 24-h direct contact with Ti, Ti5CT, TiCT10, and Ti2CT10 surfaces.

Under indirect contact conditions (conditioned medium), cell viability assays showed no cytotoxic effects across all groups, including unmodified c.p.-Ti and coated samples (Figure 6(a)), consistent with the direct-contact findings. Notably, although the crystal violet adhesion assay revealed no significant differences among groups (Figure 6(b)), confocal analysis of actin cytoskeleton organization demonstrated more robust actin filament networks in the Ti group (Figure 6(c) and (d)), suggesting that conditioned media may influence cytoskeletal tension even in the absence of direct surface contact. It is important to note that confocal analyses under conditioned media do not reflect direct cell-surface interactions. Instead, these observations provide evidence of biochemical signaling induced by soluble species released from coatings. Soluble calcium species and surface-derived ions are known to modulate intracellular calcium homeostasis and downstream actin-regulatory proteins, including cofilin, thereby influencing cytoskeletal tension even in the absence of direct surface contact. ⁶⁵ Moreover, Direct contact assays consistently demonstrated more pronounced cellular responses compared to indirect exposure. This difference is expected, as direct contact integrates surface wettability, microtopography, and chemical composition, which collectively enhance focal adhesion formation and mechanotransduction. In contrast, indirect assays capture only soluble-mediated effects, which, although biologically relevant, are inherently less potent than direct cell–surface signaling.

OPEN IN VIEWER

Figure 6.

Cytotoxicity and cellular adhesion assays of pre-osteoblasts after conditioning and treatment of MC3t3 cells. The evaluation covered the toxic profile of titanium and the coated groups with CaTiO₃: (a) cell viability assessed by the MTT assay; (b) cell adhesion measured by the crystal violet assay; (c) beta-actin labeling; (d) confocal microscopy analysis. Sample sizes: cell viability (n = 6), cell adhesion (n = 6), and confocal microscopy (n = 3). All analyses were normalized to the control, and statistically significant differences were considered when p < 0.05.

Based on the absence of cytotoxicity and the cytoskeletal alterations observed under both direct and indirect conditions, we next investigated whether the coatings regulate canonical adhesion-related signaling pathways at the transcriptional and post-translational levels. The TiCT5 group exhibited upregulation of Src, Fak, and Integrin β1 (Itgb1) (Figure 7(b)–(e)). These molecules play central roles in the formation and stabilization of focal adhesions and actin stress fibers, thereby modulating adhesion and migratory behavior. ⁶⁴ In contrast, the TiCT10 group showed decreased Fak expression but increased levels of Integrin α1 and β1, indicating a potential shift toward Fak-independent integrin signaling pathways. Since integrins are primary mediators of cell–ECM interactions, this expression profile suggests preserved or even enhanced adhesive capacity through alternative cytoskeletal pathways, possibly involving Cofilin-mediated actin turnover. ⁶⁶ Notably, the TiC2T10 group exhibited pronounced upregulation of both Integrin α1 and β1, indicating a strong potential to promote stable cell adhesion. This finding aligns with previous studies demonstrating that the incorporation of calcium titanium oxide into Ti surfaces enhances hydrophilicity and provides nucleation sites for ECM protein adsorption, ultimately improving cellular responses.^67–70

OPEN IN VIEWER

Figure 7.

Effect of CaTiO₃-based coatings on cellular adhesion and cytoskeletal rearrangement. (a) Cellular adhesion pathway analysis by real-time PCR, activated by Integrins (α1 and β1) (b, c) and modulated by Fak, Src, and Cofilin (d–f). (g–k) Protein expression analysis by Western blot (WB) for Cofilin, Phospho-Cofilin (Ser03), and Src. The 18S gene served as the endogenous control for PCR, while GAPDH was used for band normalization in WB. Experimental replicates: n = 3. All results were normalized to the control, and statistically significant differences were considered when p < 0.05.

Regarding cytoskeletal dynamics, Cofilin expression was reduced in the Ti group but progressively increased in TiCT5, TiCT10, and TiC2T10 (Figure 7(f)). Importantly, the phosphorylation of Cofilin at Ser3, which inhibits its actin-severing function and stabilizes actin filaments, followed a similar trend (Figure 7(g)–(j)). These results support the hypothesis that the coatings not only modulate gene expression but also impact cytoskeletal organization, which is crucial for cell spreading and mechanotransduction. ⁷⁰ Figure 6(k) confirms the consistency of protein loading and supports the specificity of the observed changes in cofilin phosphorylation and Src expression.

To further explore the remodeling behavior of the cell–ECM interface, gelatin zymography was employed to evaluate matrix metalloproteinase (MMP) activity. Interestingly, TiCT10 significantly reduced the activity of both pro-MMP2 and pro-MMP9 (Figure 8(a)–(d)), suggesting that despite the upregulation of integrin expression, ECM degradation potential was diminished. This paradoxical result indicates the formation of a microenvironment that promotes stable cell adhesion with limited matrix turnover, which may reduce migratory potential. This behavior is particularly relevant in scenarios requiring early and sustained implant integration, as lower MMP activity correlates with a more intact and mechanically supportive ECM. ⁷⁰

OPEN IN VIEWER

Figure 8.

Analysis of gelatinolytic activity of MMPs modulated by CaTiO₃-based coatings: Culture medium was collected for metalloproteinase (MMP) activity assessment via zymography, specifically targeting MMP9, pro-MMP2, and MMP2 (a–d). Experimental replicates: n = 3. All analyses were normalized to the control, and statistically significant differences were considered when p < 0.05.

Collectively, these findings demonstrate that CT-based coatings modulate cellular behavior in a coating-specific manner. TiCT5 induced a coordinated upregulation of adhesion and cytoskeletal genes, supporting both cell attachment and potential migration. In contrast, TiCT10, despite promoting integrin expression, resulted in decreased MMP activity, which may favor adhesion at the cost of reduced mobility. TiC2T10 induced strong integrin expression, reinforcing its potential for robust and stable adhesion. These divergent biological outcomes are closely linked to the underlying physicochemical properties of each coating, such as surface roughness, wettability, and mechanical integrity, underscoring the need to optimize deposition parameters to balance cell adhesion, migration, and long-term implant surface stability. Future studies should validate these in vitro findings using in vivo models to assess how such coatings perform within complex physiological environments, particularly regarding osseointegration and mechanical stability under load-bearing conditions.

Conclusion

The successful development and characterization of CT-based coatings on commercially pure titanium (c.p.-Ti) surfaces have demonstrated significant improvements in surface properties relevant to biomedical applications. The dip-coating technique enabled the formation of cubic alpha-calcium titanate layers with strong adhesion, despite the appearance of microcracks caused by thermal expansion mismatch. Importantly, the increased film thickness enhanced surface wettability, promoting better cell adhesion.

Corrosion analysis revealed that CT-based films improve the corrosion behavior, as indicated by lower corrosion current density (i_corr), resulting from the formation of a protective oxide layer. Biological assays confirmed that these coatings are non-cytotoxic to pre-osteoblast cells (MC3t3-E1) in both direct and indirect contact conditions, thereby ensuring biocompatibility. Furthermore, the coatings, particularly TiCT5 and TiC2T10, significantly improved cell adhesion and promoted cytoskeletal organization through the upregulation of genes associated with focal adhesion and actin filament stabilization (Src, Fak, Integrin β1, Cofilin). Interestingly, the TiCT10 sample, while enhancing integrin expression, was associated with reduced MMP activity, indicating a more stable extracellular matrix (ECM) environment that supports adhesion while limiting cell migration. This effect suggests that the physicochemical characteristics of the coatings, such as roughness and wettability, critically influence cellular responses and the stability of the implant interface.

Collectively, our data shows that CT-based coatings on titanium surfaces exhibit a promising combination of improved corrosion resistance, enhanced cell adhesion, and favorable cytoskeletal dynamics without cytotoxic effects, making them suitable for biomedical implant applications. Future studies should extend these in vitro findings to in vivo models to validate their effectiveness under physiological conditions, particularly regarding osseointegration and mechanical stability.

Supplemental material