Expression levels of ABCG2 and CD61 genes in breast cancer tissues of Iranian population

Abstract

Breast cancer as the most common female cancer is a malignancy with heterogeneous course. Dysregulation of several genes has been associated with development of this malignancy. Among these genes are the stem cell markers CD61 and breast cancer resistance protein (BCRP or ATP-binding cassette super-family G member 2 (ABCG2)). ABCG2 is one of the major efflux transporters implicated in multidrug resistance in cancer cells. In the present study, we compared expression of CD61 and ABCG2 transcripts between 30 breast cancer tissues and matched adjacent non-cancerous tissues (ANCTs) using real time qPCR technique. There was no significant difference in expression of CD61 or ABCG2 between tumoral tissues and ANCTs (Expression ratios = 1.21 and 0.98, P values = 0.55 and 0.96, respectively). There was a trend toward association between relative expression of CD61 (tumoral tissues versus ANCTs) and patients’ age (P = 0.05) in a way that older patients tended to over-express this marker in their tumoral tissues compared with the matched ANCTs. Moreover, there was a significant association between expression of this gene and tumor size (P = 0.04) in a way that all tumors with sizes less than 2 cm showed down-regulation of CD61 (as compared with the matched ANCTs). Expression of CD61 was significantly higher in tumor tissues with extracapsular nodal extension compared with confined lesions (P = 0.007). Moreover, expression of ABCG2 was significantly higher in tumor tissues of patients aged less than 55 years compared with older patients (P = 0.04). There was no significant correlation between expression of CD61 and ABCG2 either in tumoral tissues or in ANCTs. The current investigation shows association or trends toward association between expression of two cancer stem cell markers and some clinical data of breast cancer patients such as extracapsular nodal extension, age and tumor size which might imply their importance in the pathogenesis of breast cancer.

Keywords

Breast cancer cancer stem cell CD61 breast cancer resistance protein BCRP ATP-binding cassette super-family G member 2 ABCG2

1. Introduction

Table 1
Nucleotide sequences of primers and the corresponding amplicon sizes

Gene name Primer sequence Primer length (bp) Product length (bp)

GAPDH F: GTCTCCTCTGACTTCAACAGCG 22 131

R: ACCACCCTGTTGCTGTAGCCAA 22

ABCG2 F: GTATTACCACTGTCTCTGCACTG 23 81

R: GTCAAACCGGTACTGCACTC 20

CD61 F: GACACAGCCAACAACCCAC 19 73

R: ATTAAGTGCCCCGGTACGTG 20

Gene name	Primer sequence	Primer length (bp)	Product length (bp)
GAPDH	F: GTCTCCTCTGACTTCAACAGCG	22	131
	R: ACCACCCTGTTGCTGTAGCCAA	22
ABCG2	F: GTATTACCACTGTCTCTGCACTG	23	81
	R: GTCAAACCGGTACTGCACTC	20
CD61	F: GACACAGCCAACAACCCAC	19	73
	R: ATTAAGTGCCCCGGTACGTG	20

Breast cancer is the most frequent malignancy among females and the second principal reason of cancer-related death according to the International Agency for Research on Cancer [1]. In Iran, breast cancer is the 5th principal cause of cancer death among women [2]. Most cases of breast cancer have been recognized in omen between 40 to 50 years [2]. This kind of cancer is among human malignancies in which the role of cancer stem cells (CSCs) in their evolution has been acknowledged [3]. Previous studies have identified a number of surface markers for CSCs. For instance, over-expression of the integrin CD61 (β3) has been reported as a feature of a mammary progenitor cell population. This surface marker is merely expressed in normal epithelial cells of this tissue [4]. Tumorigenic ability of CD61 over-expressing cells has been also verified in mouse models of mammary tumorigenesis [5]. Further investigations have shown that the CD61 signaling pathway has a crucial role in maintenance of active TGF-β signaling and self-renewal of tumor initiating cells [6]. Another important factor in sustaining stem cell properties in breast cancer cells is the ATP-binding cassette (ABC) super-family G member 2 (ABCG2) [7]. This member of ABC transporter superfamily also participates in multidrug resistance (MDR) in cancer chemotherapy [8]. Burger et al. have reported association between expression level of ABCG2 in breast cancer and response to anthracycline-based chemotherapy [9]. Faneyte et al. demonstrated extensive variation in expression of this gene in clinical samples and no association between its levels and response of patients to therapeutic options. While they detected ABCG2 expression in vessels and normal breast epithelium, they could not detect its expression in tumor cells [10]. On the contrary, Yuan et al. appreciated the role of ABCG2 in determination of response of breast cancer cells to 5-fluorouracil [11].

Based on the putative importance of ABCG2 in response of patients to chemotherapeutic options and lack of consistent data in this regard, we selected this gene to compare its expression levels between breast cancer tissues and adjacent non-cancerous tissues (ANCTs). Moreover, we compared expression of the CSC marker CD61 in these two sets of tissues to assess its relative expression and its association with clinicopathological data of breast cancer patients.

2. Materials and methods

2.1. Patients

The current study was performed on 30 breast cancer samples and 30 matched ANCTs. All tissues were acquired from Tumor Bank of Cancer Research Institute, Imam Khomeini Hospital, Tehran, Iran. Comprehensive histopathological features were also gathered. The study protocol was approved by the institutional ethic committee. Patients signed the informed consent forms.

2.2. RNA extraction, cDNA synthesis and expression study

Total RNA was isolated from both tumor tissues and ANCTs using TRIzol^TM Reagent (Invitrogen, Paisley, UK). Then, 500 ng⁻¹ μg of the extracted RNA was used for cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (TaKaRa, Tokyo, Japan). Expression of CD61 and ABCG2 were measured in tumoral tissues and ANCTs using RealQ Plus 2x PCR Master Mix Green Without ROX^TM PCR Master Mix (Ampliqon, Odense, Denmark). Expression levels were normalized to the expression amounts of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The nucleotide sequences of primers and the corresponding amplicon sizes are summarized in Table 1.

2.3. Statistical methods

SPSS v.18.0 (IBM Corp., Armonk, NY, USA) was used for statistical analyses. Efficiencies of each primer set were used for calculation of relative expression levels. Associations between clinical data and relative expression of CD61 and ABCG2 were evaluated using Chi-square test. Mean values of expression of genes in tumoral tissues were compared between subgroups using independent sample T test. Correlation between relative expressions of CD61 and ABCG2 was assessed using the regression model. P values less than 0.05 was considered as significant. P values were calculated using Chi-square test for categorical variables [12] and using T test when comparing the means of two groups, which were related in certain features [13].

3. Results

3.1. General features of breast cancer patients

Patients enrolled in the current study had the mean age of 51.82 years. Tumors were originated from right and left sides in 53.3% and 46.7% of patients, respectively. Cancer stage, grade, tumor size and immunohistochemical parameters were obtained from medical records. Table 2 summarizes the clinical data of breast cancer patients.

Table 2
Clinical data of enrolled individuals in the current study

Parameters Values

Age (mean ± SD) 51.82 ± 11.25

Site of primary tumor

Right breast 16 (53.3%)

Left breast 14 (46.7%)

Cancer stage (%)

I 2 (6.7%)

II 19 (63.3%)

III 9 (30%)

Overall grade (%)

I 4 (13.3%)

II 15 (50%)

III 10 (33.3%)

Unavailable 1 (0.03%)

Lymphatic invasion

Yes 24 (80%)

No 6 (20%)

Vascular invasion

Yes 24 (80%)

No 6 (20%)

Tumor size (%)

≤2 cm 3 (10%)

>2 27 (90%)

Estrogen receptor (%)

Positive 10 (33.3%)

Negative 2 (6.6%)

Unavailable 18 (60%)

Progesterone receptor (%)

Positive 9 (30%)

Negative 3 (10%)

Unavailable 18 (60%)

Her2/neu expression (%)

Positive 2 (6.6%)

Negative 11 (36.6%)

Unavailable 17 (56.6%)

Parameters	Values
Age (mean ± SD)	51.82 ± 11.25
Site of primary tumor
Right breast	16 (53.3%)
Left breast	14 (46.7%)
Cancer stage (%)
I	2 (6.7%)
II	19 (63.3%)
III	9 (30%)
Overall grade (%)
I	4 (13.3%)
II	15 (50%)
III	10 (33.3%)
Unavailable	1 (0.03%)
Lymphatic invasion
Yes	24 (80%)
No	6 (20%)
Vascular invasion
Yes	24 (80%)
No	6 (20%)
Tumor size (%)
≤2 cm	3 (10%)
>2	27 (90%)
Estrogen receptor (%)
Positive	10 (33.3%)
Negative	2 (6.6%)
Unavailable	18 (60%)
Progesterone receptor (%)
Positive	9 (30%)
Negative	3 (10%)
Unavailable	18 (60%)
Her2/neu expression (%)
Positive	2 (6.6%)
Negative	11 (36.6%)
Unavailable	17 (56.6%)

3.2. Expression assays

There was no significant difference in expression of CD61 or ABCG2 between tumoral tissues and ANCTs (Expression ratios = 1.21 and 0.98, P values = 0.55 and 0.96, respectively). Figure 1 shows relative expression levels of these genes in each group of specimens.

Fig. 1.

Relative expression levels of CD61 and ABCG2 genes in tumoral tissues and ANCTs.

There was a trend toward association between relative expression of CD61 (tumoral tissues versus ANCTs) and patients’ age (P = 0.05) in a way that older patients tended to over-express this marker in their tumoral tissues compared with the matched ANCTs. Moreover, there was a significant association between expression of this gene and tumor size (P = 0.04) in a way that all tumors with sizes less than 2 cm showed down-regulation of CD61 (as compared with the matched ANCTs). Table 3 shows the results of association analysis between expression of genes and clinical data.

Table 3

The results of association analysis between expression of genes and clinical data (For some parameters, there was a number of missing or inconclusive data)

Parameters	CD61 up-regulation	CD61 down-regulation	P value	ABCG2 up-regulation	ABCG2 down-regulation	P value
Age			0.05			0.7
<55	7 (46.7%)	8 (53.3%)		7 (46.7%)	8 (53.3%)
≥55	11 (84.6%)	2 (15.4%)		7 (53.8%)	8 (46.2%)
Site of primary tumor			0.46			0.7
Right breast	9 (56.3%)	7 (43.8%)		8 (50%)	8 (50%)
Left breast	10 (71.4%)	4 (28.6%)		6 (42.9%)	8 (57.1%)
Stage			0.15			0. 84
1	0 (0%)	2 (100%)		1 (50%)	1 (50%)
2	13 (57.1%)	6 (42.9%)		8 (42.1%)	11 (57.9%)
3	6 (66.7%)	3 (33.3%)		5 (55.6%)	4 (44.4%)
Histological grade			0. 38			0. 87
1	1 (25%)	3 (75%)		2 (50%)	2 (50%)
2	10 (66.7%)	5 (33.3%)		8 (53.3%)	7 (46.7%)
3	7 (70%)	3 (30%)		4 (40%)	6 (60%)
Lymphatic invasion			1			0.38
Yes	15 (62.5%)	9 (37.5%)		10 (41.7%)	14 (58.3%)
No	4 (66.7%)	2 (33.3%)		4 (66.7%)	2 (33.3%)
Vascular invasion			1			0.38
Yes	15 (62.5%)	9 (37.5%)		10 (41.7%)	14 (58.3%)
No	4 (66.7%)	2 (33.3%)		4 (66.7%)	2 (33.3%)
Tumor size			0.04			1
≤2	0 (0%)	3 (100%)		1 (33.3%)	2 (66.7%)
>2	19 (70.4%)	8 (39.1%)		13 (48.1%)	14 (51.9%)
ER status			0.47			1
Positive	5 (50%)	5 (50%)		5 (50%)	5 (50%)
Negative	0 (50%)	2 (100%)		1 (50%)	1 (50%)
PR status			0.2			1
Positive	5 (55.6%)	4 (44.4%)		4 (44.4%)	5 (55.6%)
Negative	0 (0%)	3 (100%)		2 (66.7%)	1 (33.3%)
Her2 status			0.49			1
Positive	0 (0%)	2 (100%)		1 (50%)	1 (50%)
Negative	5 (45.5%)	6 (54.5%)		5 (45.5%)	6 (54.5%)

Expression of CD61 was significantly higher in tumor tissues with extracapsular nodal extension compared with confined lesions (P = 0.007). Moreover, expression of ABCG2 was significantly higher in tumor tissues of patients aged less than 55 years compared with older patients (P = 0.04). Table 4 shows the results of association analysis between expression of CD61 and ABCG2 genes in tumoral tissues and clinical data.

3.3. Correlation between expression of CD61 and ABCG2

There was no significant correlation between expressions of CD61 and ABCG2 in ANCTs or tumoral tissues (Figs 2A and 2B, respectively).

Fig. 2.

Correlations between expression levels of CD61 and ABCG2 in ANCTs (A) and tumoral tissues (B).

4. Discussion

In the current study, we compared expression of two CSC-related markers i.e. CD61 and ABCG2 between breast cancer tissues and matched ANCTs in a cohort of Iranian patients. Based on previous studies, Iranian patients with breast cancer have typically no history of abortion, smoking, or diabetes. The majority of these patients have been estrogen and progesterone receptor positive, HER2 negative, and P53 negative [2]. Although we reported similar expression levels of these transcripts between tumoral tissues and ANCTs, expressions of these transcripts were associated with some of clinical determinants of patients’ outcome. First, there was a trend toward association between relative expression of CD61 and patients’ age in a way that older patients tended to over-express this marker in their tumoral tissues compared with the matched ANCTs. Considering the role of CD61 in the maintenance of CSCs [6], this finding is in line with the previously reported poor survival of breast cancer in elderly [14]. Consistent with the role of CD61 in breast tumorigenesis, all tumors with sizes less than 2 cm showed down-regulation of CD61 when compared with the matched ANCTs. Moreover, expression of CD61 was significantly higher in tumor tissues with extracapsular nodal extension compared with confined lesions.

Table 4

Association between expression of CD61 and ABCG2 genes in tumoral tissues (designated by Ct housekeeping gene- Ct target gene) and clinical data (P values were calculated by independent samples T test)

Parameters	CD61 expression	P value	ABCG2 expression	P value
Age
<55 years versus ≥55 years	4.36 (1.55) versus 4.38 (2.56)	0.98	11.65 (1.54) versus 10 (2.45)	0.04
Extracapsular nodal extension
Yes versus No	7.22 (3.34) versus 4.09 (1.57)	0.007	11.64 (1) versus 10.89 (2.22)	0.57
Tumor grade
Grade 1 versus 2	4.59 (0.52) versus 3.46 (1.36)	0.49	11.47 (2.71) versus 11.54 (2.13)	0.99
Grade 1 versus 3	4.59 (0.52) versus 5.45 (2.42)	0.69	11.47 (2.71) versus 9.74 (1.59)	0.34
Grade 2 versus 3	3.46 (1.36) versus 5.45 (2.42)	0.03	11.54 (2.13) versus 9.74 (1.59)	0.09

However, expression of ABCG2 was significantly higher in tumor tissues of patients aged less than 55 years compared with older patients. This finding is in contrast with the previously reported role of estrogen in down-regulation of ABCG2 [15]. Considering the putative role of ABCG2 in determination of response to certain types of chemotherapeutic agents such as 5-fluorouracil [11], quantification of its expression levels in tumoral tissues might be a practical approach for selection of anti-cancer treatments.

Previous studies have mostly assessed expression of ABCG2 at protein level. Yoh et al. has shown association between expression of this protein in non-small cell lung cancer samples and response to platinum-based chemotherapy [16]. Omran has shown ABCG2 protein expression in the majority of patients with invasive ductal carcinoma. He also showed correlation between ABCG2 expression and tumor grade, clinical stage, lymph node metastasis, and HER2 status. However, ABCG2 expression was not correlated with PR or ER status [17]. Similar to this study, we demonstrated no association between ABCG2 expression and PR or ER status. But our results regarding lack of association with HER2 status differ from this study. Yuan et al. have examined expression of ABCG2 in 140 breast cancer samples and reported expression of this gene 47 samples at both protein and mRNA levels [18]. Our study differs with these studies as we assessed relative expression of ABCG2 in tumoral tissues compared with ANCTs to find whether its expression is influenced by the presence of malignancy. The similar levels of expression of this gene in the mentioned sets of samples might indicate the effect of tumor microenvironment on modulation of its expression. However, assessment of its expression levels in samples from cancer-free patients is needed to appraise this hypothesis.

There was no significant correlation between expression of CD61 and ABCG2 either in tumoral tissues or in ANCTs which might indicate the presence of independent mechanisms for their regulation.

Taken together, our study shows association or trends toward association between expression of two CSC marker and some clinical data of breast cancer patients such as extracapsular nodal extension, age and tumor size which might imply their importance in the pathogenesis of breast cancer. Our study had a limitation regarding the sample size.

Footnotes

Acknowledgements

This study was supported financially by Shahid Beheshti University of Medical Sciences.

Conflict of interest

The authors declare they have no conflict of interest.

References

Bray

, Ferlay

, Soerjomataram

, Siegel

, Torre

, Jemal

, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA: A Cancer Journal for Clinicians , 68(6): 394–424, 2018. PubMed PMID: 30207593. Epub 2018/09/13. eng.

Akbari

, Sayad

, Khayamzadeh

, Shojaee

, Shormeji

, Breast cancer status in Iran: statistical analysis of 3010 cases between 1998 and 2014, Int J Breast Cancer , 2017,2017.

Lorico

, Rappa

, Phenotypic heterogeneity of breast cancer stem cells, J Oncol , 2011: 135039, 2011. PubMed PMID: 21317983. Pubmed Central PMCID: 3026971.

Taddei

, Faraldo

, Teulière

, M-A

Deugnier

, Thiery

, Glukhova

, Integrins in mammary gland development and differentiation of mammary epithelium, J Mammary Gland Biol Neoplasia , 8(4): 383–394, 2003.

Vaillant

, Asselin-Labat

M-L

, Shackleton

, Forrest

, Lindeman

, Visvader

, The mammary progenitor marker CD61/β3 integrin identifies cancer stem cells in mouse models of mammary tumorigenesis, Cancer Res , 68(19): 7711–7717, 2008.

, Kanojia

, Liu

, Singh

, Berger

, Wang

, CD49f and CD61 identify Her2/neu-induced mammary tumor-initiating cells that are potentially derived from luminal progenitors and maintained by the integrin-TGFbeta signaling, Oncogene , 31(21): 2614–2626, 2012. PubMed PMID: 21996747. Pubmed Central PMCID: PMC3260386. Epub 2011/10/15. eng.

, Zhang

, Human ABCG2: structure, function, and its role in multidrug resistance, Int J Biochem Mol Biol , 3(1): 1–27, 2012. PubMed PMID: 22509477. Pubmed Central PMCID: 3325772.

Zhang

, Use of arrays to investigate the contribution of ATP-binding cassette transporters to drug resistance in cancer chemotherapy and prediction of chemosensitivity, Cell Res , 17(4): 311–323, 2007. PubMed PMID: 17404598. Epub 2007/04/04. eng.

Burger

, Foekens

, Look

, Meijer-van Gelder

, Klijn

, Wiemer

, RNA expression of breast cancer resistance protein, lung resistance-related protein, multidrug resistance-associated proteins 1 and 2, and multidrug resistance gene 1 in breast cancer: correlation with chemotherapeutic response, Clin Cancer Res , 9(2): 827–836, 2003. PubMed PMID: 12576456. Epub 2003/02/11. eng.

10.

Faneyte

, Kristel

, Maliepaard

, Scheffer

, Scheper

, Schellens

, Expression of the breast cancer resistance protein in breast cancer, Clin Cancer Res , 8(4): 1068–1074, 2002. PubMed PMID: 11948115. Epub 2002/04/12. eng.

11.

Yuan

, Lv

, Peng

, Wang

, Yu

, He

, Role of BCRP as a biomarker for predicting resistance to 5-fluorouracil in breast cancer, Cancer Chemotherapy Pharmacol , 63(6): 1103–1110, 2009. PubMed PMID: 18820913. Epub 2008/09/30. eng.

12.

Ugoni

, Walker

, The Chi square test: an introduction, COMSIG Review , 4(3): 61, 1995.

13.

Ugoni

, Walker

, The t test: an introduction, COMSIG Review , 4(2): 37, 1995.

14.

Tesarova

, Breast cancer in the elderly-Should it be treated differently? Reports of Practical Oncology and Radiotherapy: Journal of Greatpoland Cancer Center in Poznan and Polish Society of Radiation Oncology , 18(1): 26–33, 2012. PubMed PMID: 24381744. Pubmed Central PMCID: PMC3863252. Epub 2012/01/01. eng.

15.

Imai

, Ishikawa

, Asada

, Sugimoto

, Estrogen-mediated post transcriptional down-regulation of breast cancer resistance protein/ABCG2, Cancer Res , 65(2): 596–604, 2005. PubMed PMID: 15695404.

16.

Yoh

, Ishii

, Yokose

, Minegishi

, Tsuta

, Goto

, Breast cancer resistance protein impacts clinical outcome in platinum-based chemotherapy for advanced non-small cell lung cancer, Clin Cancer Res , 10(5): 1691–1697, 2004. PubMed PMID: 15014021. Epub 2004/03/12. eng.

17.

Omran

, The prognostic value of breast cancer resistance protein (BCRB/ABCG2) expression in breast carcinomas, Journal of Environmental Pathology, Toxicology and Oncology: Official Organ of the International Society for Environmental Toxicology and Cancer , 31(4): 367–376, 2012. PubMed PMID: 23394449. Epub 2013/02/12. eng.

18.

Yuan

, Cheng

, Jiang

, Ji

, Guo

, Liu

, Breast cancer resistance protein expression and 5-fluorouracil resistance, Biomed Environ Sci: BES , 21(4): 290–295, 2008. PubMed PMID: 18837291. Epub 2008/10/08. eng.