Altered expression of STAT genes in periodontitis

Abstract

Signal Transducer and Activator of Transcription (STAT) pathway is functionally located downstream of Janus kinases proteins and can integrate signals from diverse pathways, thus regulating several aspects of immune responses. Although contribution of STAT proteins in the pathogenesis of several inflammatory conditions has been confirmed, their role in the development of periodontitis has been less appraised. Thus, we assessed levels of STAT transcripts in the periodontal tissues and circulation of affected individuals compared with the corresponding controls. Expression of STAT1 was remarkably lower in tissues samples of patients compared with control tissues (Ratio of mean expression (RME) $=$ 0.15, SE $=$ 0.99, $P$ value $=$ 0.01). Expression of STAT3 was lower in total periodontitis tissues compared with total control tissues (RME $=$ 0.20, SE $=$ 0.95, $P$ value $=$ 0.02). Expression of STAT6 was higher in total periodontitis tissues compared with total control tissues (RME $=$ 0.5.38, SE $=$ 0.74, $P$ value $<$ 0.001). Expressions of other STAT genes were statistically similar in tissues obtained from cases and controls. Moreover, blood levels of all STAT genes were statistically similar between patients and controls. Correlation analysis demonstrated significant correlations between tissues levels of individual STAT genes as well as between their blood levels. However, tissue and blood levels of each STAT gene were not correlated. The current investigation potentiates the role of certain STAT genes in the development of this immune-related condition and warrants functional assays to clarify the mechanism.

Keywords

STAT periodontitis expression

Table 1
Sequences of primers/probes

Gene name	Primer sequence	Probe sequence
HPRT1	Forward: TATATCCAACACTTCG Reverse: CTTTCCTTGGTCAGG	FAM-AAGCTTGCGACCTTGA-TAMRA
STAT1	Forward: GAGCACAGTGATGTTAGA Reverse: GCTGTTCTTGTTTCTGATC	FAM-CATTGGTCTCGTGTTCTCTGTTCT-TAMRA
STAT2	Forward: GAGCCTTTGTGGTAGAAA Reverse: CCTGTCAATGGAGACTTC	FAM-AGTGACTCATTGCCTTCCTGG-TAMRA
STAT3	Forward: CCTTCCTGCTAAGATTCA Reverse: GACTGGATCTGGGTCTTA	FAM-CGCTGATGTCCTTCTCCACC-TAMRA
STAT5a	Forward: GTTGGTCCGTCTTGCCTCCTG Reverse: GTCAAACCAGATCAGCTTTTACCC	FAM- TCCAGATTCCACAGGCACGCAGCA-TAMRA
STAT6	Forward: TGCTCTGCCCTGTTCAAGAAC Reverse: CGCACTTCTCCTCTGTGACAG	FAM- TGCCCTTCCGCTCACACCGCTTG- TAMRA

1. Introduction

Signal Transducer and Activator of Transcription (STAT) pathway is functionally located downstream of Janus kinases (JAK) proteins and can integrate signals from diverse pathways. Each of STAT proteins have distinctive roles in cell signaling and exert essential functions in reconciling cell response to various types of cytokines [1]. These proteins have distinct roles in the pathogenesis of cancers and inflammatory processes [1]. STAT1 is mainly involved in the signaling pathways downstream of IFN- $\gamma$ and growth hormone, relaying the effects of IFN- $\gamma$ on expression levels of inducible nitric oxide synthase (iNOS), COX, VCAM and ICAM, partaking in the inflammatory responses [2]. Expression of STAT2, STAT4, and STAT6 is induced by a number of cytokines including IL-12, IL-4/IL-13, and IFN- $\alpha$ [1]. STAT3 particularly participates in the modulation of host response to injury. Being induced by several cytokines such as IL-6, STAT3 initiates pro-proliferative and pro-survival processes that help the host in recovering tissue homeostasis. However, constitutive activation of STAT3 has been associated with chronic inflammatory responses and the resulting fibrotic process [3]. STAT3 has particular cooperation with STAT5 in the regulation of immune responses. Indeed, threshold of STAT3 and STAT5 signaling controls levels of innate receptor-stimulated pro-inflammatory cytokines [4]. Contribution of STAT proteins in the pathogenesis of several inflammatory conditions has been confirmed [5]. However, expression of these proteins has been less assessed in patients with periodontitis. Periodontitis is regarded as an inflammatory disease in which certain microorganisms stimulate a cascade of immune responses leading to tissue destruction [6, 7, 8]. Based on the importance of STAT signaling in the regulation of immune cells and cytokine activity [9] and participation of these elements in the pathogenesis of periodontitis [6], we aimed to assess levels of STAT transcripts in the periodontal tissues and circulation of affected individuals compared with the corresponding controls.

Figure 1.

Relative expression amounts of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in affected tissues compared with control tissues.

Figure 2.

Relative expression amounts of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in blood samples of patients with periodontitis compared with controls.

2. Materials and methods

2.1 Samples

Totally, 26 cases and 28 controls were enrolled in the current study. Patients were assessed in the Department of Periodontology, Hamadan University of Medical Sciences, Hamadan, Iran. Cases were recruited based on the criteria presented in our recent work [10, 11, 12, 13]. Control samples were acquired from individuals underwent crown lengthening. A periodontist ruled out the presence of periodontitis in control subjects. Excluding criteria were smoking, systemic disorders, history of taking antibiotics or anti-inflammatory medicines in three-month period prior to excision of samples, pregnancy and breastfeeding.

2.2 Expression assay

GeneAll kit (Seoul, Korea) was used for extraction of RNA from blood and periodontal tissues. RNA was then converted to cDNA by using the Thermo Fisher Scientific kit (Brussels, Belgium). Expression levels of STAT genes were enumerated in case and control samples using Ampliqon kit (Odense, Denmark). Reactions were performed in the Step One Plus™Real-Time PCR equipment (Applied Biosystems, Foster city, CA, USA). Sequences of the primers used for expression assays are presented in Table 1.

2.3 Statistical analyses

Expression data was evaluated in the R software. Transcript quantities of STAT genes in relation to the housekeeping gene were measured from Ct and efficiency values. After being log2 transformed, the mean values of expression amounts of genes were compared between groups using the $t$ -test. Correlations between expressions were assessed using Spearman correlation coefficients. Receiver operating characteristic (ROC) curves were plotted to quantify the diagnostic values of expression levels of STAT genes. Youden’s J statistic was used to discover the optimum threshold. Area under curve (AUC), sensitivity and specificity values were calculated.

3. Results

The current gene expression assay was executed using tissue samples obtained from 26 patients with periodontitis (female/male: 16/10, mean age (standard deviation): 37.6 $\pm$ 2.5) and 28 controls (female/male: 12/16, mean age (standard deviation): 37.5 $\pm$ 1.7). Blood samples were also obtained from 23 patients (female/male: 15/8) and 17 control subjects (female/ male: 17/10).

3.1 Expression assays

Relative expressions of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in tissue and blood samples of patients and controls are displayed in Figs 1 and 2, respectively.

Expression of STAT1 was remarkably lower in tissues samples of patients compared with control tissues (Ratio of mean expression (RME) $=$ 0.15, SE $=$ 0.99, $P$ value $=$ 0.01). Such expression pattern was also detected among males (RME $=$ 0.09, SE $=$ 1.47, $P$ value $=$ 0.03). Expression of STAT3 was lower in total periodontitis tissues compared with total control tissues (RME $=$ 0.20, SE $=$ 0.95, $P$ value $=$ 0.02), but not among distinct subgroups of male and female patients compared with sex-matched controls). Expression of

Table 2
Statistical parameters of assessment of expression of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in tissues and blood specimens acquired from patients compared with controls

Number of samples		SE	Ratio of mean expressions	$P$ value	95% CI		SE	Ratio of mean expressions	$P$ value	95% CI		SE	Ratio of mean expressions	$P$ value	95% CI
		STAT1					STAT2					STAT3
Case/Control (Tissues)
Total	26/28	0.99	0.15	0.01	$-$ 4.71	$-$ 0.72	1.04	0.28	0.08	$-$ 3.94	0.26	0.95	0.20	0.02	$-$ 4.26	$-$ 0.43
F	16/12	1.43	0.22	0.15	$-$ 5.16	0.82	1.28	0.30	0.19	$-$ 4.40	0.94	1.40	0.25	0.17	$-$ 4.90	0.93
M	10/16	1.47	0.09	0.03	$-$ 6.58	$-$ 0.47	1.66	0.19	0.17	$-$ 5.81	1.06	1.41	0.14	0.06	$-$ 5.79	0.07
Case/Control (Blood)
Total	23/17	0.92	0.36	0.12	$-$ 3.33	0.39	0.75	0.36	0.06	$-$ 3.01	0.05	0.78	0.40	0.10	$-$ 2.90	0.26
F	15/10	1.00	0.43	0.23	$-$ 3.31	0.85	0.82	0.73	0.58	$-$ 2.14	1.23	0.96	0.51	0.32	$-$ 2.97	1.02
M	8/7	1.72	0.23	0.24	$-$ 5.87	1.60	1.32	0.11	0.04	$-$ 6.34	$-$ 0.10	1.33	0.25	0.16	$-$ 4.87	0.92
		STAT4					STAT5					STAT6
Number of samples		SE	Ratio of mean expressions	P value	95% CI		SE	Ratio of mean expressions	P value	95% CI		SE	Ratio of mean expressions	P value	95% CI
Total	26/28	1.00	0.52	0.35	$-$ 2.97	1.06	0.94	0.55	0.36	$-$ 2.74	1.02	0.74	5.38	0.00	0.94	3.91
F	16/12	1.53	0.64	0.67	$-$ 3.82	2.51	1.31	0.69	0.68	$-$ 3.24	2.17	1.09	9.10	0.01	0.93	5.44
M	10/16	1.35	0.42	0.37	$-$ 4.06	1.58	1.45	0.40	0.37	$-$ 4.36	1.70	0.93	3.15	0.09	$-$ 0.27	3.57
Case/Control (Blood)
Total	23/17	0.82	0.39	0.10	$-$ 3.03	0.30	0.93	0.31	0.08	$-$ 3.60	0.20	0.67	0.54	0.19	$-$ 2.23	0.47
F	15/10	1.03	0.45	0.28	$-$ 3.29	1.00	1.14	0.29	0.13	$-$ 4.13	0.59	0.97	0.45	0.24	$-$ 3.15	0.85
M	8/7	1.41	0.27	0.21	$-$ 4.92	1.20	1.60	0.31	0.32	$-$ 5.38	1.97	0.73	0.78	0.63	$-$ 1.97	1.24

Figure 3.

Correlations between tissue/ blood levels of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in tissue and blood samples. The distributions of parameters are denoted on the diagonals. The bivariate scatter plots with a fitted line are displayed on the lower partitions. Correlation coefficients and $P$ values are displayed on the upper partitions.

STAT6 was higher in total periodontitis tissues com- pared with total control tissues (RME $=$ 0.5.38, SE $=$ 0.74, $P$ value $<$ 0.001) and among female subgroups (RME $=$ 9.10, SE $=$ 1.09, $P$ value $=$ 0.01). Expressions of other STAT genes were statistically similar in tissues obtained from cases and controls. Moreover, blood levels of all STAT genes were statistically similar between patients and controls (Table 2).

Figure 4.

ROC curves depicted using the Bayesian Generalized Linear Model.

Correlation analysis demonstrated significant correlations between tissues levels of individual STAT genes as well as between their blood levels. However, tissue and blood levels of each STAT gene were not correlated (Fig. 3).

We also measured the diagnostic power of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in different sets of blood and tissue samples using the Bayesian Generalized Linear Model (Fig. 4).

STAT6 and STAT3 have been the most specific (specificity $=$ 0.95) and sensitive (sensitivity $=$ 0.90) markers in the recognition of disease status in tissue samples, respectively. In the blood samples, STAT3 and STAT4 have the sensitivity values of 0.75 and 0.76, respectively. The best AUC value (0.73) belonged to STAT6 in differentiation of affected tissues from normal tissues (Table 3).

4. Discussion

As a disorder with mixed inflammatory and infectious aetiology, periodontitis is associated with over-production of cytokines, proteases and a number of pro-inflammatory mediators [14]. JAK/STAT pathway is among the most important mediators of pathogenic events in the periodontitis [14]. Experiments in the endothelial nitric oxide synthase gene knockout animal model have shown significant infiltration of macrophages and production of pro-inflammatory cytokines in the periodontal tissues. These effects have been related on induction of STAT1 pathway by angiotensin II [15]. Another animal study has revealed over-expression of STAT1 and STAT3 in the periodontal tissues in primary phase of disease development [16]. Yet, the role of STAT pathway in the development of periodontitis in human subject has been less understood. In the present work, we detected down-regulation of STAT1 in tissues samples of patients compared with control tissues. Such expression pattern was also detected among males. Moreover, expression of STAT3 was lower in total periodontitis tissues compared with total control tissues, but not among distinct subgroups of male and female patients compared with sex-matched controls. Therefore, the observed expression pattern of STAT1 and STAT3 genes in our study is in contrast with the reported results in two distinct animal models. As a central mediator of immune responses, IFN- $\gamma$ uses the JAK/STAT pathway to stimulate STAT1 [17]. Based on the observed up-regulation of this cytokine in periodontitis [18], we expected up-regulation of STAT1 in the affected tissues. Yet, we observed the opposite trend. It is worth mentioning that when we assessed expression of these genes among distinct sex-based subgroups, the only significant result was demonstrated for STAT1 expression among male subgroups. Sex-specific functions have been previously attributed to some members of STAT family particularly STAT1 and STAT3 [19, 20]. These observations highlight the importance of assessment of expression of these genes in distinct sex-based groups. Experiments in intestinal epithelial cells (IECs) have shown STAT1-dependent sex-specific influence of colitis on transcript levels of T-cell-attracting chemokines CXCL-9 and CXCL-10. Besides, STAT1 has a crucial role in stimulation of CXCL-11 only in male IECs. Expression of IL-6 was reduced in dextran sodium sulfate-treated male but not female STAT1 ${}^{\Delta IEC}$ mice, indicating sex-specific necessity of epithelial STAT1 for release of distinctive chemoattractants [19].

On the other hand, expression of STAT6 was higher in total periodontitis tissues compared with total control tissues and among female subgroups. STAT6 down-

Table 3

Statistical parameters of ROC curves in tissue and blood samples

		STAT1			STAT2			STAT3			STAT4			STAT5			STAT6			All
Number of samples		AUC	Sensitivity	Specificity	AUC	Sensitivity	Specificity	AUC	Sensitivity	Specificity	AUC	Sensitivity	Specificity	AUC	Sensitivity	Specificity	AUC	Sensitivity	Specificity	AUC	Sensitivity	Specificity
Case/Control (Tissue)
Total	26/28	0.71	0.88	0.52	0.63	0.64	0.69	0.67	0.90	0.40	0.53	0.64	0.61	0.52	0.54	0.68	0.73	0.58	0.95	0.75	0.71	0.80
Case/Control (Blood)
Total	23/17	0.60	0.64	0.69	0.66	0.69	0.67	0.64	0.75	0.67	0.62	0.76	0.52	0.66	0.74	0.73	0.55	0.65	0.55	0.57	0.53	0.72

regulation has been shown to attenuate inflammatory responses protecting against primary phases of colitis-related colon cancer [21]. On the other hand, induction of the STAT6 axis has central roles in alternative (M1 and M2) activation of macrophages, which influences inflammatory responses [22].

Expressions of other STAT genes were statistically similar in tissues obtained from cases and controls. Moreover, blood levels of all STAT genes were statistically similar between patients and controls. These data indicate independence of tissue STAT genes levels from their levels in the circulation and different sources of their expressions in these two sets of samples. Consistent with this observation, correlation analysis demonstrated significant correlations between tissues levels of individual STAT genes as well as between their blood levels. However, tissue and blood levels of each STAT gene were not correlated.

STAT6 and STAT3 have been the most specific and sensitive markers in the recognition of disease status in tissue samples, respectively. The best AUC value belonged to STAT6 in differentiation of affected tissues from normal tissues. However, none of genes could differentiate blood samples of affected individuals from controls. Combination of all STAT genes slightly improved the diagnostic power in tissue samples, yet the integrated panel was not appropriate for diagnostic purposes in blood samples.

The current investigation potentiates the role of certain STAT genes in the development of this immune-related condition and warrants functional assays to clarify the mechanism.

References

Loh

C.-Y.

et al., Signal transducer and activator of transcription (STATs) proteins in cancer and inflammation: functions and therapeutic implication, Frontiers in Oncology 9 (2019), 48.

de Prati

A.C.

et al., STAT1 as a new molecular target of anti-inflammatory treatment, Current Medicinal Chemistry 12 (2005), 1819–1828.

Kasembeli

M.M.

Bharadwaj

Robinson

and Tweardy

D.J.

, Contribution of STAT3 to inflammatory and fibrotic diseases and prospects for its targeting for treatment, Int J Mol Sci 19 (2018), 2299.

Hedl

Sun

Huang

and Abraham

, STAT3 and STAT5 signaling thresholds determine distinct regulation for innate receptor-induced inflammatory cytokines, and STAT3/STAT5 disease variants modulate these outcomes, Journal of Immunology (Baltimore, Md.: 1950) 203 (2019), 3325–3338.

Pfitzner

Kliem

Baus

and Litterst

C.M.

, The role of STATs in inflammation and inflammatory diseases, Current Pharmaceutical Design 10 (2004), 2839–2850.

Cekici

Kantarci

Hasturk

and Van Dyke

T.E.

, Inflammatory and immune pathways in the pathogenesis of periodontal disease, Periodontol 2000 64 (2014), 57–80.

Sayad

et al., Emerging role of long non-coding RNAs in the pathogenesis of periodontitis, Biomedicine & Pharmacotherapy 129 (2020), 110362.

Sayad

et al., Genetic susceptibility for periodontitis with special focus on immune-related genes: A concise review, Gene Reports (2020), 100814.

Gotthardt

Trifinopoulos

Sexl

and Putz

E.M.

, JAK/STAT Cytokine signaling at the crossroad of NK cell development and maturation, Front Immunol 10 (2019), 2590–2590.

10.

Gholami

et al., The lncRNA ANRIL is down-regulated in peripheral blood of patients with periodontitis, Noncoding RNA Res 5 (2020), 60–66.

11.

Sayad

et al., Blood and tissue levels of lncRNAs in periodontitis, Journal of Cellular Physiology 235 (2020), 9568–9576.

12.

Sayad

et al., Dysregulation of GAS5 and OIP5-AS1 lncRNAs in periodontitis, Gene Reports refvol20 (2020), 100712.

13.

Sayad

et al., Exploring the role of long non-coding RNAs in periodontitis, Meta Gene 24 (2020), 100687.

14.

Souza

J.A.C.d.

Rossa

, Jr. Garlet

G.P.

Nogueira

A.V.B.

and Cirelli

J.A.

, Modulation of host cell signaling pathways as a therapeutic approach in periodontal disease, J Appl Oral Sci 20 (2012), 128–138.

15.

Wei

et al., Activation of the STAT1 Pathway Accelerates Periodontitis in Nos3(-/-) Mice, J Dent Res 98 (2019), 1027–1036.

16.

de Souza

J.A.C.

et al., Expression of suppressor of cytokine signaling 1 and 3 in ligature-induced periodontitis in rats, Archives of Oral Biology 56 (2011), 1120–1128.

17.

and Ivashkiv

L.B.

, Cross-regulation of signaling pathways by interferon-gamma: implications for immune responses and autoimmune diseases, Immunity 31 (2009), 539–550.

18.

Fiorillo

et al., Interferon crevicular fluid profile and correlation with periodontal disease and wound healing: a systemic review of recent data, Int J Mol Sci 19 (2018), 1908.

19.

Crnčec

et al., STAT1 is a sex-specific tumor suppressor in colitis-associated colorectal cancer, Molecular Oncology 12 (2018), 514–528.

20.

Caetano

M.S.

et al., Sex specific function of epithelial STAT3 signaling in pathogenesis of K-ras mutant lung cancer, Nature Communications 9 (2018), 1–11.

21.

Leon-Cabrera

S.A.

et al., Lack of STAT6 attenuates inflammation and drives protection against early steps of colitis-associated colon cancer, Cancer Immunology Research 5 (2017), 385–396.

22.

Huang

et al., NEAT1 regulates Th2 cell development by targeting STAT6 for degradation, Cell Cycle 18 (2019), 312–319.

Altered expression of STAT genes in periodontitis

Abstract

Keywords

Table 1 Sequences of primers/probes

2.1 Samples

2.2 Expression assay

2.3 Statistical analyses

3. Results

3.1 Expression assays

Table 2 Statistical parameters of assessment of expression of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in tissues and blood specimens acquired from patients compared with controls

References

Table 1
Sequences of primers/probes

Table 2
Statistical parameters of assessment of expression of STAT1, STAT2, STAT3, STAT4, STAT5 and STAT6 genes in tissues and blood specimens acquired from patients compared with controls